1. Evolutionary Biology

The evolutionary mechanism of non-carbapenemase carbapenem-resistant phenotypes in Klebsiella spp

  1. Natalia C Rosas
  2. Jonathan Wilksch
  3. Jake Barber
  4. Jiahui Li
  5. Yanan Wang
  6. Zhewei Sun
  7. Andrea Rocker
  8. Chaille T Webb
  9. Laura Perlaza-Jiménez
  10. Christopher J Stubenrauch
  11. Vijaykrishna Dhanasekaran
  12. Jiangning Song
  13. George Taiaroa
  14. Mark Davies
  15. Richard A Strugnell
  16. Qiyu Bao
  17. Tieli Zhou  Is a corresponding author
  18. Michael J McDonald  Is a corresponding author
  19. Trevor Lithgow  Is a corresponding author
  1. Centre to Impact AMR, Monash University, Australia
  2. Infection Program, Biomedicine Discovery Institute and Department of Microbiology, Monash University, Australia
  3. School of Biological Sciences, Monash University, Australia
  4. The First Affiliated Hospital of Wenzhou Medical University, China
  5. Infection Program, Biomedicine Discovery Institute and Department of Biochemistry & Molecular Biology, Monash University, Australia
  6. Wenzhou Medical University, China
  7. School of Public Health, LKS Faculty of Medicine, The University of Hong Kong, China
  8. Department of Microbiology and Immunology, The Peter Doherty Institute, The University of Melbourne, Australia
https://doi.org/10.7554/eLife.83107
Share this article
Cite this article
  1. Natalia C Rosas
  2. Jonathan Wilksch
  3. Jake Barber
  4. Jiahui Li
  5. Yanan Wang
  6. Zhewei Sun
  7. Andrea Rocker
  8. Chaille T Webb
  9. Laura Perlaza-Jiménez
  10. Christopher J Stubenrauch
  11. Vijaykrishna Dhanasekaran
  12. Jiangning Song
  13. George Taiaroa
  14. Mark Davies
  15. Richard A Strugnell
  16. Qiyu Bao
  17. Tieli Zhou
  18. Michael J McDonald
  19. Trevor Lithgow
(2023)
The evolutionary mechanism of non-carbapenemase carbapenem-resistant phenotypes in Klebsiella spp
eLife 12:e83107.
https://doi.org/10.7554/eLife.83107
  2. Download BibTeX
  3. Download .RIS
6 figures, 6 tables and 1 additional file

Figures

Figure 1 with 3 supplements
Download asset Open asset
Experiment overview.

(A) Carbapenem-resistant Klebsiella spp. were isolated from a patient, and the genome was sequenced and assembled. The genetic cause of resistance was confirmed by re-engineering the carbapenem resistance, partly based on structure guided restoration of a partially truncated membrane protein. The evolutionary drivers of resistance and sensitivity were determined using experimental evolution and extensive phenotypic and genotypic measures of evolutionary change. (B) Maximum likelihood phylogenetic tree of 377 publicly available Klebsiella genomes shows K. pneumoniae and K. quasipneumoniae as distinct species. The inner ring colours refer to the country of isolation according to the key, and further data is described in Figure 1—figure supplement 2 and Figure 1—source data 1. (C) Eight candidate carbapenemases were identified in the FK688 genome sequence and overexpressed in an E. coli model of resistance. Only two enzymes (DHA1 and OKP-B-21) conferred resistance to the cephem antibiotics tested, and none of the enzymes conferred resistance to the carbapenem antibiotics (Figure 1—source data 6 and Figure 1—figure supplement 3).

Figure 1—source data 1

Strain information for Figure 1B.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig1-data1-v1.xlsx
Figure 1—source data 2

Growth rate analysis of Escherichia coli BW25113 strains expressing the indicated open-reading frames cloned into plasmid pJP-CmR.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig1-data2-v1.xlsx
Figure 1—source data 3

Antibiotic resistance genes identified in pNAR1.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig1-data3-v1.xlsx
Figure 1—source data 4

Transmembrane transporter systems identified in pNAR1.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig1-data4-v1.xlsx
Figure 1—source data 5

β-lactamase prediction and classification using DeepBL.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig1-data5-v1.xlsx
Figure 1—source data 6

Minimum inhibitory concentration (MIC) analysis of Escherichia coli BW25113 expressing DeepBL candidates and MIC analysis of FK688 pNAR1ΔblaDHA-1 strains expressing DHA-1.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig1-data6-v1.xlsx
Figure 1—figure supplement 1
Download asset Open asset
Physical map of the K. quasipneumoniae subsp. similipneumoniae FK688 chromosome.

The position of genes encoding antibiotic resistance determinants (oqxAB, blaOKP-B-21, kdeA, and fosA5) and major outer membrane porin proteins (ompK35, ompK36, ompK37, and ompK38) are indicated. The blue lines in the two outer concentric circles represent the location of predicted coding sequences in the forward (outermost) and reverse DNA strands. The middle circle (black) indicates the % Guanine-Cytosine (GC) content, and the inner circle indicates the positive (green) and negative (purple) GC skew ([G−C]/[G+C]). The map was generated with DNAPlotter (Carver et al., 2009).

Figure 1—figure supplement 2
Download asset Open asset
The phylogeny of Klebsiella.

Maximum likelihood phylogenetic tree of 377 publicly available Klebsiella genomes shows K. pneumoniae and K. quasipneumoniae as distinct species. The inner ring indicates the country of strain isolation, as specified in the colour key (NA, not applicable, indicates the genomes with location not deposited in the NCBI). The middle and outer ring colours indicate the distribution of the sequence type classifications with the ST number and colour key, respectively (ST, sequence type; SLV, single-locus variant; 2LV, two-locus variant). The position of strain FK688 is shown.

Figure 1—figure supplement 3
Download asset Open asset
Domain architecture of DeepBL candidates.

(A) The Conserved Domain Architecture Retrieval Tool (CDART; Geer et al., 2002) was used to create the graphical display of domain architectures for the protein sequences identified from DeepBL analysis of the FK688 genome sequence data (Figure 1—source data 5). DHA-1, OPK-B-21, and several other of the open-reading frames show protein architecture of the Class C β-lactamase (green). TRN, ABH, and OPHC have a domain architecture similar to Serine-tRNA deacylase (blue), Alpha/Beta fold hydrolase (yellow), and Metallo-hydrolase-like_MBL-fold superfamily (orange), respectively. Numbers map the amino acid residues for each protein. (B) Growth rate analysis of E. coli BW25113 strains expressing the indicated open-reading frames cloned into plasmid pJP-CmR (Figure 1—source data 2). In each case, the comparison is made between untransformed BW25113 (“no vector”, green triangles), and BW25113 transformed with the parental plasmid (“pJP-CmR”, red squares) or the plasmid carrying the indicated open-reading frame (blue dots). Strains were cultured in Lysogeny Broth (LB) for 24 hr at 37°C, and cell density (OD600) was measured every hour. Error bars represent the SD of biological triplicates.

Figure 2 with 2 supplements
Download asset Open asset
Reconstruction of mutant OmpK36 protein based structural characteristics of OmpK36 in K. quasipneumoniae subsp. similipneumoniae.

(A) PSIPRED (Buchan and Jones, 2019) secondary structure prediction of the OmpK36, using the protein sequence encoded in the K. quasipneumoniae subsp. similipneumoniae genome. The location of the 16 amino acid deleted region in FK688 OmpK36 is highlighted in red on the β14-β15 strands of the corresponding structural model. (B) Tertiary structure of the β-barrel OmpK36 monomer (PDB ID 5O79 Acosta-Gutiérrez et al., 2018). Coloured red are the β14-β15 strands, the same region designated with red colour in panel (A). (C) Schematic depicting the engineering to restore a functional version of ompK36 in FK688 by the insertion of 48 nucleotides in ompK36, as shown in red. FRT (flippase recognition target) sites permitted excision of the KmR (kanamycin resistance) cassette using Flp recombinase. Following KmR excision, a single FRT site and scar region remain in between the ompK36 and apbE genes. The amino acid identity between the OmpK36 from ATCC 700603 and FK688 is 95% (Figure 2—figure supplement 2), and the ATCC 700603 sequence (Elliott et al., 2016) was used to repair the ompK36 locus of FK688, as described in the Materials and methods section. (D) Total membrane extracts were prepared from the indicated strains, the proteins in the samples analysed by sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) and immunoblotting using an antibody probe that recognises OmpK36 (Rocker et al., 2020). The outer-membrane protein BamD was used as a sample loading control for the analysis.

Figure 2—source data 1

Original gel image for Figure 2.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig2-data1-v1.zip
Figure 2—source data 2

Alternative gel image for Figure 2.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig2-data2-v1.zip
Figure 2—figure supplement 1
Download asset Open asset
Gene alignment of four major porins.

Gene synteny comparison alignments of ompK35, ompK36, ompK37, and ompK38 (green arrows) and neighbouring open reading frames (ORFs) with either predicted (purple arrows) or unknown (grey arrows) functions in FK688 and K. pneumoniae subsp. pneumoniae ATCC 43816 reference strain. Comparisons were created with BLASTn and the Easyfig application (Sullivan et al., 2011) using the default parameters (min. length = 0, max. e value = 0.001, and min. identity value = 0). The red line was drawn to indicate the position of a 48 bp intragenic region within ompK36 present in ATCC 43816 and absent in FK688, which was not detected at the level of resolution used in BLASTn comparative analysis. The nucleotide sequence percentage identity between strains is represented by the gradient indicator (bottom left).

Figure 2—figure supplement 2
Download asset Open asset
Comparative sequence analysis of ompK35 and ompK36 genes of Klebsiella spp. and reference genomes.

(A) BLAST searches of sequence data held at NCBI did not identify any other Klebsiella strains carrying a tnpA insertion in the 5’ end of ompK35. However, such an insertion is seen in E. coli 1290/03 which has a tnpA inserted 45 bp upstream of the start codon of the ompK35 homolog (ompF). A non-identical but similar tnpA insertion is seen 42 bp upstream of the start codon of the ompK36 gene of K. pneumoniae WJ19, and 45 bp upstream of the start codon of the ompK36 homolog (ompC) in E. coli strains 1290/03, 917/05, and 1566/03. Alternate means disrupting the functionality of the porin encoding genes were also observed with SNPs that generate premature stop codons indicated by red lines. GenBank accession numbers of the sequences are as follows: E. coli 1290/03, GQ465829; K. pneumoniae WJ19, Q4557043; E. coli 917/05, GQ167039; E. coli 1566/03, GQ167038. Sequence comparisons were created with ViPTree (Nishimura et al., 2017). (B) OmpK36 amino acid sequences from FK688, other K. quasipneumoniae subsp. similipneumoniae (Kqs) strains and a K. pneumoniae strain (Kpn) extracted from the NCBI database. The conceptual translation of the OmpK36 encoded by the Kpn KP549/04 strain (Wu et al., 2011) had the same 16-amino acid deletion as FK688 (blue box). Residues showing 100% identity among sequences are highlighted in red. Similarity among sequences is indicated by black bold font highlighted in yellow. Accession numbers for the proteins shown are as follows: UNMC_7493: OVT66776.1; G1129: OVX13856.1; KP-24175: KYZ7217.4; CAB1577: OVX38519.1; KPPSTH03: OYM42369.1; KPCTRSRTH03: TNJ78288.1; ATCC 700603: AWO62949.1; MGH44: ESM62951.1; SWT10: TWV32269.1; KP549/04: ADG56566.1; SB610: VGP86012.1; G747: AZJ27052.1. Sequence alignments were performed with Clustal Omega (Madeira et al., 2019) and rendered with ESPript 3.0 (Buchan and Jones, 2019).

Figure 3 with 2 supplements
Download asset Open asset
Evolution and physical map of plasmid pNAR1.

(A) Schematic representation of the in vitro evolution experiment. After passage #3 (P3), a ceftazidime-susceptible (CAZS) mutant evolved, lacking a 17 kb region of pNAR1 that included blaDHA-1 (referred to as ΔompK36 pNAR1ΔblaDHA-1). After 11 passages (P11) a CAZS colony missing the entire plasmid (referred to as ΔompK36 pNAR1¯) evolved. In total, 20 passages were performed, and another five CAZS colonies were identified, each missing the 17 kb region of pNAR1 that includes blaDHA-1. (B) The position of genes encoding antibiotic resistance determinants (red), and efflux pumps annotated as being for mercury resistance (green), copper resistance (orange), and silver resistance (pink) are indicated. In addition to blaDHA-1, pNAR1 carries genes encoding AmpR (ID00077) a transcriptional regulator known to regulate expression of blaDHA-1 (Realegeno et al., 2021). Also, other drug resistance genes including those responsible for resistance to tetracycline (tetA[B]), rifamycin (arr-3), trimethoprim (dfrA27), streptomycin (aadA16), macrolides (qacΔE1), sulfonamides (sul1), and quinolones and fluoroquinolones (qnrB4; Figure 3—figure supplement 1, Figure 1—source data 3). The location of predicted coding sequences in the forward (outer most) and reverse DNA strands is designated by purple boxes in the outer concentric circles. The middle circle (black) graphs the % GC content, and the inner circle indicates the positive (green) and negative (purple) GC skew ([G−C]/[G+C]). The map was generated with DNAPlotter (Carver et al., 2009). The black arc designates a 41 kb segment of DNA expanded in panel C. (C) Linear map of the 41 kb segment of pNAR1 showing the genetic arrangement of antimicrobial resistance genes (red), mobile genetic elements (blue), annotated coding sequences (purple), and hypothetical genes of unknown function (grey). Assigned IS families are shown underneath each transposase gene (tnpA). The loci within the two brackets represent the 17 kb DNA segment (tnpA-sul1) deleted from pNAR1ΔblaDHA-1.

Figure 3—source data 1

Growth rate analysis of K. quasipneumoniae strains.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Download asset Open asset
Detailed physical map of the FK688 plasmid pNAR1.

The coloured lines in the outer concentric circles represent the location of predicted coding sequences in the forward and reverse DNA strands. Annotated CoDing Sequences (CDS) are shown in dark blue and labelled with gene names. Hypothetical genes of unknown function are in grey. Mobile genetic elements are in light blue. The position of genes encoding antibiotic resistance determinants (red), mercury (mer) resistance (green), copper (pco) resistance (orange), and silver (sil) resistance (pink) is indicated. The genes encoding a Fe (3+) dicitrate ABC transporter system are in dark brown. The Type 1 hsdRMS restriction-modification and H-N-H endonuclease (hnh) systems (yellow) and phage shock protein (Psp) system (light brown) are indicated. The middle circle (black) indicates the % GC content, and the inner circle indicates the positive (green) and negative (purple) GC skew ([G−C]/[G+C]). The map was generated with DNAPlotter (Carver et al., 2009).

Figure 3—figure supplement 2
Download asset Open asset
Growth rate analysis of K. quasipneumoniae strains.

Bacteria was cultured in cation-adjusted Mueller-Hinton Broth (CAMHB), and the OD600 was measured every hour for 24 hr. Error bars represent SD (n=3). The genotypes of the strains are indicated in the legend. Note that the parental FK688 strain is ΔompK36 pNAR1. Where indicated, the other isogenic strains express a functional OmpK36 porin (i.e. ompK36+), carry the complete pNAR1 plasmid or pNAR1 with a 17 kb (tnpA-sul1) deletion (pNAR1ΔblaDHA-1), or have been cured of the plasmid (pNAR1¯).

Figure 4
Download asset Open asset
Competitive fitness assay of FK688 strain variants against GFP-labelled FK688.

(A) Schematic of the competitive fitness assay experiment (Materials and methods). FACS: fluorescence-activated cell sorting. (B) The relative fitness of the engineered mutant strains relative to the carbapenem resistant FK688 strain, measured in Lysogeny Broth (LB) growth media without antibiotics. Mutant strains either have the OmpK36 outer membrane transporter restored (ompK36+), the DHA-1 β-lactamase deleted (pNAR1¯ or pNAR1ΔblaDHA-1), or both (orange circles). The y-axis shows the selection coefficient (S) per generation compared to the carbapenem resistant ancestor FK688 which has its fitness set at 0. The legend indicates the genotypes for each strain (note FK688 is genotype ΔompK36 pNAR1). Error bars represent mean ± SD (n=4). (C) Relative fitness of FK688 mutant strains compared to parental FK688, measured in LB media supplemented increasing concentrations of the carbapenem antibiotic imipenem. The legend shows the genotype for each Klebsiella strain. Error bars represent mean ± SD (n=4).

Figure 4—source data 1

Relative fitness values for each data point in Figure 4B and C.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig4-data1-v1.xlsx
Figure 5 with 2 supplements
Download asset Open asset
Genotypic and phenotypic evolution of FK688 ΔompK36 and ompK36+strains.

(A) Schematic of the evolution experiment of Lineage A (FK688:ΔompK36 pNAR1) and Lineage B (FK688:ompK36+pNAR1). 20 replicate populations (A1, A2, A3,…A20 and B1, B2, B3,…B20) for each lineage were serially passaged (1000-fold dilutions at each passage) for 200 generations. Of the evolved strains, population A2 and population B3 were characterised as described in the text. While population A2 showed a mixture of both opaque (o) and translucent (t) colony morphotypes, the asterisk (*) denotes that only a single colony of opaque (o) morphotype was observed in population B3. (B) Colony morphotypes seen in the evolved populations. Colonies were grown on 0.5✕ Lysogeny Broth (LB) agar for an overnight incubation at 37°C and photographed with stereo microscope using transmitted light to capture translucency. (C) The relative fitness assessments for the populations of FK688 ΔompK36 pNAR1(pink) and populations of ompK36+pNAR1 (blue) genotypes (left). The error bars represent mean ± SD (n=4). Relative fitness assays were also performed for 20 evolved populations after 200 generations of evolution in LB growth media without antibiotics (right). The line represents individual replicates with means connected. (D) Relative numbers of opaque colonies in the 20 replicate populations of FK688 ΔompK36 pNAR1 (lineage A) and ompK36+pNAR1 (lineage B) strains after 200 generations. Each dot represents an individually evolved population. The inset photographs (above the graph) are an example of frequency of opaque and translucent colonies on an agar plate in one of the 20 replicate populations. (E) Capsular polysaccharide was extracted from cell cultures for glucuronic acid measurement (Materials and methods; Campos et al., 2004). The error bars represent mean ± SD (n=3). For reference, ancestral and evolved strains were compared with the hypermucoid (i.e. heavily capsulated) clinical isolate B5055 and an isogenic mutant B5055nm Δwza-wzc (non-mucoid) strain. (F) Total cell extracts from the indicated strains were analysed by sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) and Coomassie staining. The migration positions of OmpK36, PhoE, and OmpA are indicated. The identities of these protein species were confirmed by mass spectrometry of the corresponding region of the gel.

Figure 5—source data 1

Fitness assay ancestral and evolved lineages A and B strains.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig5-data1-v1.xlsx
Figure 5—source data 2

Relative numbers of opaque colonies in the 20 replicate populations of FK688 ΔompK36 pNAR1 (lineage A) and ompK36+pNAR1 (lineage B) strains after 200 generations.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig5-data2-v1.xlsx
Figure 5—source data 3

FK688 OmpK36+, B3(o), and B3(t) genome modification and SNP analysis.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig5-data3-v1.xlsx
Figure 5—source data 4

Glucuronic acid measurement of ancestral and evolved strains.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig5-data4-v1.xlsx
Figure 5—source data 5

Original gel image for Figure 5.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig5-data5-v1.zip
Figure 5—figure supplement 1
Download asset Open asset
Comparative sequence analysis of the fim gene cluster in evolved K. quasipneumoniae strains.

Sequence comparison of FK688 ompK36+ revealed a tnpA gene from the IS4 family (blue arrow) inserted upstream of fimE in B3(o). Sequence comparisons were performed with ViPTree (Nishimura et al., 2017).

Figure 5—figure supplement 2
Download asset Open asset
Comparative sequence analysis of the fim gene cluster in evolved K. quasipneumoniae strains.

Schematic of the FK688 and its evolved strains A2(o) and A2(t) fim gene cluster with 100% gene similarity between the strains. Sequence comparisons were performed with ViPTree (Nishimura et al., 2017).

Figure 6
Download asset Open asset
Competitive fitness assay of FK688 strain variants in the presence of ceftazidime.

(A) The fitness of FK688 mutants measured in Lysogeny Broth (LB) media supplemented with ceftazidime across a concentration range from 0.125 to 2 µg/mL. Only strains with an intact pNAR1 plasmid, including the blaDHA-1 gene, are able to survive high concentrations of ceftazidime. The legend has the genotypes for the Klebsiella strains. Error bars represent mean with ± SD (n=4). (B) Schematic of the imipenem resistance landscape. Each genotype is depicted as being resistant (red) or susceptible (blue) to imipenem. The x and y planes depict the antimicrobial resistance (AMR) genotypes, and the z plane represents growth measured at each concentration of imipenem. Circles represent the genotype of each strain, and lines show strain connected by a single mutation. The evolution of imipenem resistance requires two genes - the blaDHA-1 gene, and a loss of function mutation in ompK36: these two alleles are both found in FK688, indicated at “D”. Since both single-step mutants “B” and “C” are imipenem susceptible and do not have a fitness advantage in growth media without drugs (Figure 4B), we propose that the population had recently been exposed to conditions that selected for the pNAR1 plasmid. Then after exposure of the population to imipenem, the ΔompK36 mutant was strongly selected. This suggests that the most likely evolutionary path to imipenem resistance was A → B → D.

Figure 6—source data 1

Relative fitness values for each data point in Figure 6A.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig6-data1-v1.xlsx
Figure 6—source data 2

Data used to construct fitness landscape in Figure 6B.

https://cdn.elifesciences.org/articles/83107/elife-83107-fig6-data2-v1.xlsx

Tables

Table 1
Antimicrobial susceptibility profiling of K. quasipneumoniae FK688.
AntimicrobialAntimicrobialMIC (µg/mL)*
ClassDrugFK688E. coli (ATCC 25922)Breakpoints†
PenicillinsAmpicillin>20488≥32
CephemsCefazolin>20482≥8
Cefotaxime10240.125≥4
Ceftazidime>20480.5≥16
CarbapenemsErtapenem640.016≥2
Imipenem80.25≥4
Meropenem40.03≥4
LipopeptidesPolymyxin B42≥4
AminoglycosidesGentamicin12≥16
Tobramycin12≥16
Kanamycin24≥64
TetracyclinesTetracycline1281≥16
FluoroquinolonesCiprofloxacin10.016≥1
  1. *

    Drug-sensitive, italics; drug-resistant, bold-text.

  2. †

    Resistant clinical breakpoint for Enterobacterales given by CLSI, 2022.

Table 2
Antimicrobial susceptibility profiling of FK688-derived strains.
Antimicrobial ClassAntimicrobialDrugMIC (µg/mL)*
ΔompK36ompK36+
pNAR1pNAR1ΔblaDHA-1pNAR1−pNAR1pNAR1ΔblaDHA-1
PenicillinsAmpicillin>2048256128>2048128
CephemsCefazolin>20483232>20484
Cefotaxime10240.50.5320.125
Ceftazidime>204810.55120.25
CarbapenemsErtapenem640.50.50.50.016
Imipenem80.250.2510.12
Meropenem40.060.1250.1250.03
LipopeptidesPolymyxin B44444
AminoglycosidesKanamycin24244
TetracyclinesTetracycline1282562128128
FluoroquinolonesCiprofloxacin10.060.0610.125
  1. *

    Drug-sensitive, italics; drug-resistant, bold-text.

Table 3
Antimicrobial susceptibility profiling FK688 ΔompK36 and ompK36+ strains and their respective evolved strains.
MIC (µg/mL)*
AntimicrobialAntimicrobialΔompK36ompK36+
ClassDrugpNAR1pNAR1 ΔblaDHA-1 A2(o)pNAR1 ΔblaDHA-1A2(t)pNAR1pNAR1 ΔblaDHA-1B3(o)pNAR1 ΔblaDHA-1 B3(t)
CephemsCefazolin>2048321>204821
Cefotaxime10240.50.25320.1250.25
Ceftazidime>20480.50.255120.250.25
CarbapenemsErtapenem640.50.0310.50.0160.031
Imipenem80.1250.12510.250.125
Meropenem40.1250.0160.120.0160.016
TetracyclinesTetracycline128128128128128128
FluoroquinolonesCiprofloxacin10.1250.2510.0310.063
AminoglycosidesKanamycin222422
Tobramycin0.511111
Gentamicin0.510.50.50.50.5
LipopeptidesPolymyxin B444484
  1. *

    Drug-sensitive, italics; drug-resistant, bold-text.

Table 4
List of plasmids used in this study.
PlasmidRelevant characteristics*Source/reference
pKD4Contains kanamycin resistance cassette (kan) flanked by FRT sites (FRT-kan-FRT); oriR6K, AmpR, KmRDatsenko and Wanner, 2000
pJET1.2/bluntBlunt-end cloning vector for insertion of DNA fragments with single deoxyadenosine overhangs; AmpRThermo Scientific
pDonor(OmpK36)pJET1.2/blunt carrying FRT-kan-FRT and K. quasipneumoniae FK688 ompK36 regions (donor plasmid for lambda Red recombination-mediated repair of ompK36 gene in FK688); AmpR, KmRThis study
pACBSRArabinose-inducible promoter; I-SceI endonuclease; lambda Red recombination genes, CmRHerring et al., 2003
pFLP-BSRpACBSR carrying fragment length polymorphism (FLP) recombinase to excise the kanamycin cassette, temp-sensitive replication; CmRRocker et al., 2020
pJP-CmRDerivative of pJP168 for anhydrotetracycline inducible protein expression. CmRRocker et al., 2020
pJP-blaDHA-1pJP-Cm containing blaDHA-1 from FK688This study
pJP-blaOKP-B-21pJP-Cm containing blaOKP-B-21 from FK688This study
pJP-blaSHKpJP-Cm containing CKCOFDID_01495 from FK688This study
pJP-blaOPHCpJP-Cm containing CKCOFDID_02113 from FK688This study
pJP-blaDAEpJP-Cm containing pbpG from FK688This study
pJP-blaTRNpJP-Cm containing CKCOFDID_04153 from FK688This study
pJP-blaABHpJP-Cm containing dhmA from FK688This study
pJP-blaDACpJP-Cm containing dacB from FK688This study
  1. *

    Amp, ampicillin; Km, kanamycin; Cm, chloramphenicol.

Table 5
List of strains used in this study.
StrainRelevant characteristics*Source or reference
K. quasipneumoniae
FK688 ΔompK36 pNAR1Wildtype, clinical isolate from a bloodstream infection case from the First Affiliated Hospital of Wenzhou Medical University, China. Expresses β-lactamase blaOKP-B-21. Deficient in ompK35 and ompK36 porin expression. Harbours a 258 kb plasmid pNAR1 (AmpR, TetR, RifR, TrpR, StpR, EryR, SdzR, CipR).Bi et al., 2017
ΔompK36 pNAR1ΔblaDHA-1FK688 with a 17 kb deletion from tnpA-sul1 in pNAR1.This study
ΔompK36 pNAR1–FK688 cured of pNAR1.This study
ompK36+ pNAR1FK688 with a genetically repaired and functional ompK36 gene. Carries pNAR1.This study
ompK36+ pNAR1ΔblaDHA-1FK688 with a genetically repaired and functional ompK36 gene. It has a 17 kb deletion from tnpA-sul1 in pNAR1.This study
FK688-GFP+FK688 with a constitutively expressed green fluorescent protein (GPF). GFP gene inserted downstream of the glmS gene via pGRG-eGFP.This study
A2(o)
ΔompK36 pNAR1ΔblaDHA-1		Evolved strain from Kq1. It has a 17 kb deletion from tnpA-sul1 in pNAR1. Forms opaque colonies.This study
A2(t)
ΔompK36 pNAR1ΔblaDHA-1		Evolved strain from Kq1. It has a 17 kb deletion from tnpA-sul1 in pNAR1. Forms translucent colonies.This study
B3(o) ompK36+ pNAR1ΔblaDHA-1Evolved strain from Kq4. It has a 17 kb deletion from tnpA-sul1 in pNAR1. Forms opaque colonies.This study
B3(t) ompK36+ pNAR1ΔblaDHA-1Evolved strain from Kq4. It has a 17 kb deletion from tnpA-sul1 in pNAR1. Forms translucent colonies.This study
K. pneumoniae
B5055Hypermucoviscous phenotype. Wildtype, clinical isolate, serotype K2;O1Statens Serum Institut, Denmark
B5055 nmB5055 deletion mutant ∆wza-wzc::km (non-mucoid); KmRProf. Richard Strugnell University of Melbourne
E. coli
DH5αF– endA1 hsdR17(rK–, mK+) supE44 λ– thi-1 recA1 gyrA96 relA1 deoR Δ(lacZYA-argF) U169 Φ80dlacZ∆M15; NalR
E. coli DH5α was used for cloning purposes		Invitrogen
ATCC 25922CLSI control strain for antimicrobial susceptibility testingATCC
BW25113 (WT)rrnB3 ΔlacZ4787(::rrnB-3) hsdR514 Δ(araD-araB)567 Δ(rhaD-rhaB)568, rph-1Baba et al., 2006
  1. *

    Amp, ampicillin; Tet, tetracycline; Rif, rifamycin; Trp, trimethoprim; Stp, streptomycin; Ery, erythromycin; Sdz, sulfadiazine; Cip, ciprofloxacin; Nal, nalidixic acid.

Table 6
List of oligonucleotide primers used in this study.
PrimerSequence (5–3’)*Description
Construction of FK688 OmpK36+ strains
K36_insert-RgcgcgacctactacttcaacaaaaacatgtccacctatgttgactacaaaatcaacctgctgConstruction of pDonor(OmpK36) plasmid
K36_insert-Fgttgaagtagtaggtcgcgcccacgtcaacatatttcaggatgtcctggtcgcc
K36_Km-Fctaaggaggatattcatatggtcgcaagctgcataacaaa
K36_Km-Rgaagcagctccagcctacacattagaactggtaaaccaggcccag
K36_ISceI-Rtagggataacagggtaatgcccgacggtgatatccatc
K36_ISceI-Ftagggataacagggtaatgcttcggtacctctgtaacttatga
pKD4-FtgtgtaggctggagctgcttcKanamycin cassette from pKD4
pKD4-Rcatatgaatatcctccttag
Cloning of putative β-lactamases genes for anhydrotetracycline-inducible expression
blaDHA-1_For_NRgtccCCATGGtgaaaaaatcgttatctgcaac
blaDHA-1_Rev_NRcgtcAAGCTTattccagtgcactcaaa
blaOKP_F_NRtagcGAATTCatgcgttatgttcgcctgtgcc
blaOKP_R_NRgcatAAGCTTctagcgctgccagtg
blaSHK1_F_NRgttcCCATGGtgataagaaaaccactggcc
blaSHK1_R_NRatgcAAGCTTaacgcagctcgcg
blaOPHC2_F_NRctagGAATTCatgacaccagctcccttttataccctgac
blaOPHC2_R_NRacggAAGCTTtcgctgtgatcggtgtt
blaDAE1_F_NRtgcaGAATTCatgatgccgaaatttcgagtctctttgc
blaDAE1_R_NRgatcAAGCTTttaatcgttctgcgcg
blaABH1_F_NRacgtCCATGGTGaacagattatccctgatcc
blaABH1_R_NRgatcAAGCTTacaaccgatcggcg
blaDAC1_F_NRaaggCCATGGtgcgatttcccagatttatc
blaDAC1_R_NRaagcAAGCTTtagttgttctggtacaaatcc
blaTRN1_F_NRcgtaCCATGGtgactgaacgggtttattacac
blaTRN1_R_NRaatcAAGCTTacgtcagggaatagctgatc
pJPMCS_ForcctaatttttgttgacactctatcattgpJP-CmR-gene insert sequencing primers
pJPMCS_Revgccaggcaaattctgttttatcagaccg
  1. *

    Restriction endonuclease recognition sites are capitalised.

Additional files

MDAR checklist
https://cdn.elifesciences.org/articles/83107/elife-83107-mdarchecklist1-v1.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Natalia C Rosas
  2. Jonathan Wilksch
  3. Jake Barber
  4. Jiahui Li
  5. Yanan Wang
  6. Zhewei Sun
  7. Andrea Rocker
  8. Chaille T Webb
  9. Laura Perlaza-Jiménez
  10. Christopher J Stubenrauch
  11. Vijaykrishna Dhanasekaran
  12. Jiangning Song
  13. George Taiaroa
  14. Mark Davies
  15. Richard A Strugnell
  16. Qiyu Bao
  17. Tieli Zhou
  18. Michael J McDonald
  19. Trevor Lithgow
(2023)
The evolutionary mechanism of non-carbapenemase carbapenem-resistant phenotypes in Klebsiella spp
eLife 12:e83107.
https://doi.org/10.7554/eLife.83107