(A) Carbapenem-resistant Klebsiella spp. were isolated from a patient, and the genome was sequenced and assembled. The genetic cause of resistance was confirmed by re-engineering the carbapenem …
Strain information for Figure 1B.
Growth rate analysis of Escherichia coli BW25113 strains expressing the indicated open-reading frames cloned into plasmid pJP-CmR.
Antibiotic resistance genes identified in pNAR1.
Transmembrane transporter systems identified in pNAR1.
β-lactamase prediction and classification using DeepBL.
Minimum inhibitory concentration (MIC) analysis of Escherichia coli BW25113 expressing DeepBL candidates and MIC analysis of FK688 pNAR1ΔblaDHA-1 strains expressing DHA-1.
The position of genes encoding antibiotic resistance determinants (oqxAB, blaOKP-B-21, kdeA, and fosA5) and major outer membrane porin proteins (ompK35, ompK36, ompK37, and ompK38) are indicated. …
Maximum likelihood phylogenetic tree of 377 publicly available Klebsiella genomes shows K. pneumoniae and K. quasipneumoniae as distinct species. The inner ring indicates the country of strain …
(A) The Conserved Domain Architecture Retrieval Tool (CDART; Geer et al., 2002) was used to create the graphical display of domain architectures for the protein sequences identified from DeepBL …
(A) PSIPRED (Buchan and Jones, 2019) secondary structure prediction of the OmpK36, using the protein sequence encoded in the K. quasipneumoniae subsp. similipneumoniae genome. The location of the 16 …
Original gel image for Figure 2.
Alternative gel image for Figure 2.
Gene synteny comparison alignments of ompK35, ompK36, ompK37, and ompK38 (green arrows) and neighbouring open reading frames (ORFs) with either predicted (purple arrows) or unknown (grey arrows) …
(A) BLAST searches of sequence data held at NCBI did not identify any other Klebsiella strains carrying a tnpA insertion in the 5’ end of ompK35. However, such an insertion is seen in E. coli …
(A) Schematic representation of the in vitro evolution experiment. After passage #3 (P3), a ceftazidime-susceptible (CAZS) mutant evolved, lacking a 17 kb region of pNAR1 that included blaDHA-1 …
Growth rate analysis of K. quasipneumoniae strains.
The coloured lines in the outer concentric circles represent the location of predicted coding sequences in the forward and reverse DNA strands. Annotated CoDing Sequences (CDS) are shown in dark …
Bacteria was cultured in cation-adjusted Mueller-Hinton Broth (CAMHB), and the OD600 was measured every hour for 24 hr. Error bars represent SD (n=3). The genotypes of the strains are indicated in …
(A) Schematic of the competitive fitness assay experiment (Materials and methods). FACS: fluorescence-activated cell sorting. (B) The relative fitness of the engineered mutant strains relative to …
Relative fitness values for each data point in Figure 4B and C.
(A) Schematic of the evolution experiment of Lineage A (FK688:ΔompK36 pNAR1) and Lineage B (FK688:ompK36+pNAR1). 20 replicate populations (A1, A2, A3,…A20 and B1, B2, B3,…B20) for each lineage were …
Fitness assay ancestral and evolved lineages A and B strains.
Relative numbers of opaque colonies in the 20 replicate populations of FK688 ΔompK36 pNAR1 (lineage A) and ompK36+pNAR1 (lineage B) strains after 200 generations.
FK688 OmpK36+, B3(o), and B3(t) genome modification and SNP analysis.
Glucuronic acid measurement of ancestral and evolved strains.
Original gel image for Figure 5.
Sequence comparison of FK688 ompK36+ revealed a tnpA gene from the IS4 family (blue arrow) inserted upstream of fimE in B3(o). Sequence comparisons were performed with ViPTree (Nishimura et al., 2017…
Schematic of the FK688 and its evolved strains A2(o) and A2(t) fim gene cluster with 100% gene similarity between the strains. Sequence comparisons were performed with ViPTree (Nishimura et al., 2017…
(A) The fitness of FK688 mutants measured in Lysogeny Broth (LB) media supplemented with ceftazidime across a concentration range from 0.125 to 2 µg/mL. Only strains with an intact pNAR1 plasmid, …
Relative fitness values for each data point in Figure 6A.
Data used to construct fitness landscape in Figure 6B.
Antimicrobial | Antimicrobial | MIC (µg/mL)* | ||
---|---|---|---|---|
Class | Drug | FK688 | E. coli (ATCC 25922) | Breakpoints† |
Penicillins | Ampicillin | >2048 | 8 | ≥32 |
Cephems | Cefazolin | >2048 | 2 | ≥8 |
Cefotaxime | 1024 | 0.125 | ≥4 | |
Ceftazidime | >2048 | 0.5 | ≥16 | |
Carbapenems | Ertapenem | 64 | 0.016 | ≥2 |
Imipenem | 8 | 0.25 | ≥4 | |
Meropenem | 4 | 0.03 | ≥4 | |
Lipopeptides | Polymyxin B | 4 | 2 | ≥4 |
Aminoglycosides | Gentamicin | 1 | 2 | ≥16 |
Tobramycin | 1 | 2 | ≥16 | |
Kanamycin | 2 | 4 | ≥64 | |
Tetracyclines | Tetracycline | 128 | 1 | ≥16 |
Fluoroquinolones | Ciprofloxacin | 1 | 0.016 | ≥1 |
Drug-sensitive, italics; drug-resistant, bold-text.
Resistant clinical breakpoint for Enterobacterales given by CLSI, 2022.
Antimicrobial Class | AntimicrobialDrug | MIC (µg/mL)* | ||||
---|---|---|---|---|---|---|
ΔompK36 | ompK36+ | |||||
pNAR1 | pNAR1ΔblaDHA-1 | pNAR1− | pNAR1 | pNAR1ΔblaDHA-1 | ||
Penicillins | Ampicillin | >2048 | 256 | 128 | >2048 | 128 |
Cephems | Cefazolin | >2048 | 32 | 32 | >2048 | 4 |
Cefotaxime | 1024 | 0.5 | 0.5 | 32 | 0.125 | |
Ceftazidime | >2048 | 1 | 0.5 | 512 | 0.25 | |
Carbapenems | Ertapenem | 64 | 0.5 | 0.5 | 0.5 | 0.016 |
Imipenem | 8 | 0.25 | 0.25 | 1 | 0.12 | |
Meropenem | 4 | 0.06 | 0.125 | 0.125 | 0.03 | |
Lipopeptides | Polymyxin B | 4 | 4 | 4 | 4 | 4 |
Aminoglycosides | Kanamycin | 2 | 4 | 2 | 4 | 4 |
Tetracyclines | Tetracycline | 128 | 256 | 2 | 128 | 128 |
Fluoroquinolones | Ciprofloxacin | 1 | 0.06 | 0.06 | 1 | 0.125 |
Drug-sensitive, italics; drug-resistant, bold-text.
MIC (µg/mL)* | |||||||
---|---|---|---|---|---|---|---|
Antimicrobial | Antimicrobial | ΔompK36 | ompK36+ | ||||
Class | Drug | pNAR1 | pNAR1 ΔblaDHA-1 A2(o) | pNAR1 ΔblaDHA-1A2(t) | pNAR1 | pNAR1 ΔblaDHA-1B3(o) | pNAR1 ΔblaDHA-1 B3(t) |
Cephems | Cefazolin | >2048 | 32 | 1 | >2048 | 2 | 1 |
Cefotaxime | 1024 | 0.5 | 0.25 | 32 | 0.125 | 0.25 | |
Ceftazidime | >2048 | 0.5 | 0.25 | 512 | 0.25 | 0.25 | |
Carbapenems | Ertapenem | 64 | 0.5 | 0.031 | 0.5 | 0.016 | 0.031 |
Imipenem | 8 | 0.125 | 0.125 | 1 | 0.25 | 0.125 | |
Meropenem | 4 | 0.125 | 0.016 | 0.12 | 0.016 | 0.016 | |
Tetracyclines | Tetracycline | 128 | 128 | 128 | 128 | 128 | 128 |
Fluoroquinolones | Ciprofloxacin | 1 | 0.125 | 0.25 | 1 | 0.031 | 0.063 |
Aminoglycosides | Kanamycin | 2 | 2 | 2 | 4 | 2 | 2 |
Tobramycin | 0.5 | 1 | 1 | 1 | 1 | 1 | |
Gentamicin | 0.5 | 1 | 0.5 | 0.5 | 0.5 | 0.5 | |
Lipopeptides | Polymyxin B | 4 | 4 | 4 | 4 | 8 | 4 |
Drug-sensitive, italics; drug-resistant, bold-text.
Plasmid | Relevant characteristics* | Source/reference |
---|---|---|
pKD4 | Contains kanamycin resistance cassette (kan) flanked by FRT sites (FRT-kan-FRT); oriR6K, AmpR, KmR | Datsenko and Wanner, 2000 |
pJET1.2/blunt | Blunt-end cloning vector for insertion of DNA fragments with single deoxyadenosine overhangs; AmpR | Thermo Scientific |
pDonor(OmpK36) | pJET1.2/blunt carrying FRT-kan-FRT and K. quasipneumoniae FK688 ompK36 regions (donor plasmid for lambda Red recombination-mediated repair of ompK36 gene in FK688); AmpR, KmR | This study |
pACBSR | Arabinose-inducible promoter; I-SceI endonuclease; lambda Red recombination genes, CmR | Herring et al., 2003 |
pFLP-BSR | pACBSR carrying fragment length polymorphism (FLP) recombinase to excise the kanamycin cassette, temp-sensitive replication; CmR | Rocker et al., 2020 |
pJP-CmR | Derivative of pJP168 for anhydrotetracycline inducible protein expression. CmR | Rocker et al., 2020 |
pJP-blaDHA-1 | pJP-Cm containing blaDHA-1 from FK688 | This study |
pJP-blaOKP-B-21 | pJP-Cm containing blaOKP-B-21 from FK688 | This study |
pJP-blaSHK | pJP-Cm containing CKCOFDID_01495 from FK688 | This study |
pJP-blaOPHC | pJP-Cm containing CKCOFDID_02113 from FK688 | This study |
pJP-blaDAE | pJP-Cm containing pbpG from FK688 | This study |
pJP-blaTRN | pJP-Cm containing CKCOFDID_04153 from FK688 | This study |
pJP-blaABH | pJP-Cm containing dhmA from FK688 | This study |
pJP-blaDAC | pJP-Cm containing dacB from FK688 | This study |
Amp, ampicillin; Km, kanamycin; Cm, chloramphenicol.
Strain | Relevant characteristics* | Source or reference |
---|---|---|
K. quasipneumoniae | ||
FK688 ΔompK36 pNAR1 | Wildtype, clinical isolate from a bloodstream infection case from the First Affiliated Hospital of Wenzhou Medical University, China. Expresses β-lactamase blaOKP-B-21. Deficient in ompK35 and ompK36 porin expression. Harbours a 258 kb plasmid pNAR1 (AmpR, TetR, RifR, TrpR, StpR, EryR, SdzR, CipR). | Bi et al., 2017 |
ΔompK36 pNAR1ΔblaDHA-1 | FK688 with a 17 kb deletion from tnpA-sul1 in pNAR1. | This study |
ΔompK36 pNAR1– | FK688 cured of pNAR1. | This study |
ompK36+ pNAR1 | FK688 with a genetically repaired and functional ompK36 gene. Carries pNAR1. | This study |
ompK36+ pNAR1ΔblaDHA-1 | FK688 with a genetically repaired and functional ompK36 gene. It has a 17 kb deletion from tnpA-sul1 in pNAR1. | This study |
FK688-GFP+ | FK688 with a constitutively expressed green fluorescent protein (GPF). GFP gene inserted downstream of the glmS gene via pGRG-eGFP. | This study |
A2(o) ΔompK36 pNAR1ΔblaDHA-1 | Evolved strain from Kq1. It has a 17 kb deletion from tnpA-sul1 in pNAR1. Forms opaque colonies. | This study |
A2(t) ΔompK36 pNAR1ΔblaDHA-1 | Evolved strain from Kq1. It has a 17 kb deletion from tnpA-sul1 in pNAR1. Forms translucent colonies. | This study |
B3(o) ompK36+ pNAR1ΔblaDHA-1 | Evolved strain from Kq4. It has a 17 kb deletion from tnpA-sul1 in pNAR1. Forms opaque colonies. | This study |
B3(t) ompK36+ pNAR1ΔblaDHA-1 | Evolved strain from Kq4. It has a 17 kb deletion from tnpA-sul1 in pNAR1. Forms translucent colonies. | This study |
K. pneumoniae | ||
B5055 | Hypermucoviscous phenotype. Wildtype, clinical isolate, serotype K2;O1 | Statens Serum Institut, Denmark |
B5055 nm | B5055 deletion mutant ∆wza-wzc::km (non-mucoid); KmR | Prof. Richard Strugnell University of Melbourne |
E. coli | ||
DH5α | F– endA1 hsdR17(rK–, mK+) supE44 λ– thi-1 recA1 gyrA96 relA1 deoR Δ(lacZYA-argF) U169 Φ80dlacZ∆M15; NalR E. coli DH5α was used for cloning purposes | Invitrogen |
ATCC 25922 | CLSI control strain for antimicrobial susceptibility testing | ATCC |
BW25113 (WT) | rrnB3 ΔlacZ4787(::rrnB-3) hsdR514 Δ(araD-araB)567 Δ(rhaD-rhaB)568, rph-1 | Baba et al., 2006 |
Amp, ampicillin; Tet, tetracycline; Rif, rifamycin; Trp, trimethoprim; Stp, streptomycin; Ery, erythromycin; Sdz, sulfadiazine; Cip, ciprofloxacin; Nal, nalidixic acid.
Primer | Sequence (5–3’)* | Description |
---|---|---|
Construction of FK688 OmpK36+ strains | ||
K36_insert-R | gcgcgacctactacttcaacaaaaacatgtccacctatgttgactacaaaatcaacctgctg | Construction of pDonor(OmpK36) plasmid |
K36_insert-F | gttgaagtagtaggtcgcgcccacgtcaacatatttcaggatgtcctggtcgcc | |
K36_Km-F | ctaaggaggatattcatatggtcgcaagctgcataacaaa | |
K36_Km-R | gaagcagctccagcctacacattagaactggtaaaccaggcccag | |
K36_ISceI-R | tagggataacagggtaatgcccgacggtgatatccatc | |
K36_ISceI-F | tagggataacagggtaatgcttcggtacctctgtaacttatga | |
pKD4-F | tgtgtaggctggagctgcttc | Kanamycin cassette from pKD4 |
pKD4-R | catatgaatatcctccttag | |
Cloning of putative β-lactamases genes for anhydrotetracycline-inducible expression | ||
blaDHA-1_For_NR | gtccCCATGGtgaaaaaatcgttatctgcaac | |
blaDHA-1_Rev_NR | cgtcAAGCTTattccagtgcactcaaa | |
blaOKP_F_NR | tagcGAATTCatgcgttatgttcgcctgtgcc | |
blaOKP_R_NR | gcatAAGCTTctagcgctgccagtg | |
blaSHK1_F_NR | gttcCCATGGtgataagaaaaccactggcc | |
blaSHK1_R_NR | atgcAAGCTTaacgcagctcgcg | |
blaOPHC2_F_NR | ctagGAATTCatgacaccagctcccttttataccctgac | |
blaOPHC2_R_NR | acggAAGCTTtcgctgtgatcggtgtt | |
blaDAE1_F_NR | tgcaGAATTCatgatgccgaaatttcgagtctctttgc | |
blaDAE1_R_NR | gatcAAGCTTttaatcgttctgcgcg | |
blaABH1_F_NR | acgtCCATGGTGaacagattatccctgatcc | |
blaABH1_R_NR | gatcAAGCTTacaaccgatcggcg | |
blaDAC1_F_NR | aaggCCATGGtgcgatttcccagatttatc | |
blaDAC1_R_NR | aagcAAGCTTtagttgttctggtacaaatcc | |
blaTRN1_F_NR | cgtaCCATGGtgactgaacgggtttattacac | |
blaTRN1_R_NR | aatcAAGCTTacgtcagggaatagctgatc | |
pJPMCS_For | cctaatttttgttgacactctatcattg | pJP-CmR-gene insert sequencing primers |
pJPMCS_Rev | gccaggcaaattctgttttatcagaccg |
Restriction endonuclease recognition sites are capitalised.