The evolutionary mechanism of non-carbapenemase carbapenem-resistant phenotypes in Klebsiella spp
- Centre to Impact AMR, Monash University, Australia
- Infection Program, Biomedicine Discovery Institute and Department of Microbiology, Monash University, Australia
- School of Biological Sciences, Monash University, Australia
- The First Affiliated Hospital of Wenzhou Medical University, China
- Infection Program, Biomedicine Discovery Institute and Department of Biochemistry & Molecular Biology, Monash University, Australia
- Wenzhou Medical University, China
- School of Public Health, LKS Faculty of Medicine, The University of Hong Kong, China
- Department of Microbiology and Immunology, The Peter Doherty Institute, The University of Melbourne, Australia
Figures
Figure 1 with 3 supplements
Experiment overview.
(A) Carbapenem-resistant Klebsiella spp. were isolated from a patient, and the genome was sequenced and assembled. The genetic cause of resistance was confirmed by re-engineering the carbapenem …
-
Figure 1—source data 1
Strain information for Figure 1B.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig1-data1-v1.xlsx
-
Figure 1—source data 2
Growth rate analysis of Escherichia coli BW25113 strains expressing the indicated open-reading frames cloned into plasmid pJP-CmR.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig1-data2-v1.xlsx
-
Figure 1—source data 3
Antibiotic resistance genes identified in pNAR1.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig1-data3-v1.xlsx
-
Figure 1—source data 4
Transmembrane transporter systems identified in pNAR1.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig1-data4-v1.xlsx
-
Figure 1—source data 5
β-lactamase prediction and classification using DeepBL.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig1-data5-v1.xlsx
-
Figure 1—source data 6
Minimum inhibitory concentration (MIC) analysis of Escherichia coli BW25113 expressing DeepBL candidates and MIC analysis of FK688 pNAR1ΔblaDHA-1 strains expressing DHA-1.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig1-data6-v1.xlsx
Figure 1—figure supplement 1
Physical map of the K. quasipneumoniae subsp. similipneumoniae FK688 chromosome.
The position of genes encoding antibiotic resistance determinants (oqxAB, blaOKP-B-21, kdeA, and fosA5) and major outer membrane porin proteins (ompK35, ompK36, ompK37, and ompK38) are indicated. …
Figure 1—figure supplement 2
The phylogeny of Klebsiella.
Maximum likelihood phylogenetic tree of 377 publicly available Klebsiella genomes shows K. pneumoniae and K. quasipneumoniae as distinct species. The inner ring indicates the country of strain …
Figure 1—figure supplement 3
Domain architecture of DeepBL candidates.
(A) The Conserved Domain Architecture Retrieval Tool (CDART; Geer et al., 2002) was used to create the graphical display of domain architectures for the protein sequences identified from DeepBL …
Figure 2 with 2 supplements
Reconstruction of mutant OmpK36 protein based structural characteristics of OmpK36 in K. quasipneumoniae subsp. similipneumoniae.
(A) PSIPRED (Buchan and Jones, 2019) secondary structure prediction of the OmpK36, using the protein sequence encoded in the K. quasipneumoniae subsp. similipneumoniae genome. The location of the 16 …
-
Figure 2—source data 1
Original gel image for Figure 2.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig2-data1-v1.zip
-
Figure 2—source data 2
Alternative gel image for Figure 2.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig2-data2-v1.zip
Figure 2—figure supplement 1
Gene alignment of four major porins.
Gene synteny comparison alignments of ompK35, ompK36, ompK37, and ompK38 (green arrows) and neighbouring open reading frames (ORFs) with either predicted (purple arrows) or unknown (grey arrows) …
Figure 2—figure supplement 2
Comparative sequence analysis of ompK35 and ompK36 genes of Klebsiella spp. and reference genomes.
(A) BLAST searches of sequence data held at NCBI did not identify any other Klebsiella strains carrying a tnpA insertion in the 5’ end of ompK35. However, such an insertion is seen in E. coli …
Figure 3 with 2 supplements
Evolution and physical map of plasmid pNAR1.
(A) Schematic representation of the in vitro evolution experiment. After passage #3 (P3), a ceftazidime-susceptible (CAZS) mutant evolved, lacking a 17 kb region of pNAR1 that included blaDHA-1 …
-
Figure 3—source data 1
Growth rate analysis of K. quasipneumoniae strains.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Detailed physical map of the FK688 plasmid pNAR1.
The coloured lines in the outer concentric circles represent the location of predicted coding sequences in the forward and reverse DNA strands. Annotated CoDing Sequences (CDS) are shown in dark …
Figure 3—figure supplement 2
Growth rate analysis of K. quasipneumoniae strains.
Bacteria was cultured in cation-adjusted Mueller-Hinton Broth (CAMHB), and the OD600 was measured every hour for 24 hr. Error bars represent SD (n=3). The genotypes of the strains are indicated in …
Figure 4
Competitive fitness assay of FK688 strain variants against GFP-labelled FK688.
(A) Schematic of the competitive fitness assay experiment (Materials and methods). FACS: fluorescence-activated cell sorting. (B) The relative fitness of the engineered mutant strains relative to …
-
Figure 4—source data 1
Relative fitness values for each data point in Figure 4B and C.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig4-data1-v1.xlsx
Figure 5 with 2 supplements
Genotypic and phenotypic evolution of FK688 ΔompK36 and ompK36+strains.
(A) Schematic of the evolution experiment of Lineage A (FK688:ΔompK36 pNAR1) and Lineage B (FK688:ompK36+pNAR1). 20 replicate populations (A1, A2, A3,…A20 and B1, B2, B3,…B20) for each lineage were …
-
Figure 5—source data 1
Fitness assay ancestral and evolved lineages A and B strains.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig5-data1-v1.xlsx
-
Figure 5—source data 2
Relative numbers of opaque colonies in the 20 replicate populations of FK688 ΔompK36 pNAR1 (lineage A) and ompK36+pNAR1 (lineage B) strains after 200 generations.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig5-data2-v1.xlsx
-
Figure 5—source data 3
FK688 OmpK36+, B3(o), and B3(t) genome modification and SNP analysis.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig5-data3-v1.xlsx
-
Figure 5—source data 4
Glucuronic acid measurement of ancestral and evolved strains.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig5-data4-v1.xlsx
-
Figure 5—source data 5
Original gel image for Figure 5.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig5-data5-v1.zip
Figure 5—figure supplement 1
Comparative sequence analysis of the fim gene cluster in evolved K. quasipneumoniae strains.
Sequence comparison of FK688 ompK36+ revealed a tnpA gene from the IS4 family (blue arrow) inserted upstream of fimE in B3(o). Sequence comparisons were performed with ViPTree (Nishimura et al., 2017…
Figure 5—figure supplement 2
Comparative sequence analysis of the fim gene cluster in evolved K. quasipneumoniae strains.
Schematic of the FK688 and its evolved strains A2(o) and A2(t) fim gene cluster with 100% gene similarity between the strains. Sequence comparisons were performed with ViPTree (Nishimura et al., 2017…
Figure 6
Competitive fitness assay of FK688 strain variants in the presence of ceftazidime.
(A) The fitness of FK688 mutants measured in Lysogeny Broth (LB) media supplemented with ceftazidime across a concentration range from 0.125 to 2 µg/mL. Only strains with an intact pNAR1 plasmid, …
-
Figure 6—source data 1
Relative fitness values for each data point in Figure 6A.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig6-data1-v1.xlsx
-
Figure 6—source data 2
Data used to construct fitness landscape in Figure 6B.
- https://cdn.elifesciences.org/articles/83107/elife-83107-fig6-data2-v1.xlsx
Tables
Table 1
Antimicrobial susceptibility profiling of K. quasipneumoniae FK688.
| Antimicrobial | Antimicrobial | MIC (µg/mL)* | ||
|---|---|---|---|---|
| Class | Drug | FK688 | E. coli (ATCC 25922) | Breakpoints† |
| Penicillins | Ampicillin | >2048 | 8 | ≥32 |
| Cephems | Cefazolin | >2048 | 2 | ≥8 |
| Cefotaxime | 1024 | 0.125 | ≥4 | |
| Ceftazidime | >2048 | 0.5 | ≥16 | |
| Carbapenems | Ertapenem | 64 | 0.016 | ≥2 |
| Imipenem | 8 | 0.25 | ≥4 | |
| Meropenem | 4 | 0.03 | ≥4 | |
| Lipopeptides | Polymyxin B | 4 | 2 | ≥4 |
| Aminoglycosides | Gentamicin | 1 | 2 | ≥16 |
| Tobramycin | 1 | 2 | ≥16 | |
| Kanamycin | 2 | 4 | ≥64 | |
| Tetracyclines | Tetracycline | 128 | 1 | ≥16 |
| Fluoroquinolones | Ciprofloxacin | 1 | 0.016 | ≥1 |
-
*
Drug-sensitive, italics; drug-resistant, bold-text.
-
†
Resistant clinical breakpoint for Enterobacterales given by CLSI, 2022.
Table 2
Antimicrobial susceptibility profiling of FK688-derived strains.
| Antimicrobial Class | AntimicrobialDrug | MIC (µg/mL)* | ||||
|---|---|---|---|---|---|---|
| ΔompK36 | ompK36+ | |||||
| pNAR1 | pNAR1ΔblaDHA-1 | pNAR1− | pNAR1 | pNAR1ΔblaDHA-1 | ||
| Penicillins | Ampicillin | >2048 | 256 | 128 | >2048 | 128 |
| Cephems | Cefazolin | >2048 | 32 | 32 | >2048 | 4 |
| Cefotaxime | 1024 | 0.5 | 0.5 | 32 | 0.125 | |
| Ceftazidime | >2048 | 1 | 0.5 | 512 | 0.25 | |
| Carbapenems | Ertapenem | 64 | 0.5 | 0.5 | 0.5 | 0.016 |
| Imipenem | 8 | 0.25 | 0.25 | 1 | 0.12 | |
| Meropenem | 4 | 0.06 | 0.125 | 0.125 | 0.03 | |
| Lipopeptides | Polymyxin B | 4 | 4 | 4 | 4 | 4 |
| Aminoglycosides | Kanamycin | 2 | 4 | 2 | 4 | 4 |
| Tetracyclines | Tetracycline | 128 | 256 | 2 | 128 | 128 |
| Fluoroquinolones | Ciprofloxacin | 1 | 0.06 | 0.06 | 1 | 0.125 |
-
*
Drug-sensitive, italics; drug-resistant, bold-text.
Table 3
Antimicrobial susceptibility profiling FK688 ΔompK36 and ompK36+ strains and their respective evolved strains.
| MIC (µg/mL)* | |||||||
|---|---|---|---|---|---|---|---|
| Antimicrobial | Antimicrobial | ΔompK36 | ompK36+ | ||||
| Class | Drug | pNAR1 | pNAR1 ΔblaDHA-1 A2(o) | pNAR1 ΔblaDHA-1A2(t) | pNAR1 | pNAR1 ΔblaDHA-1B3(o) | pNAR1 ΔblaDHA-1 B3(t) |
| Cephems | Cefazolin | >2048 | 32 | 1 | >2048 | 2 | 1 |
| Cefotaxime | 1024 | 0.5 | 0.25 | 32 | 0.125 | 0.25 | |
| Ceftazidime | >2048 | 0.5 | 0.25 | 512 | 0.25 | 0.25 | |
| Carbapenems | Ertapenem | 64 | 0.5 | 0.031 | 0.5 | 0.016 | 0.031 |
| Imipenem | 8 | 0.125 | 0.125 | 1 | 0.25 | 0.125 | |
| Meropenem | 4 | 0.125 | 0.016 | 0.12 | 0.016 | 0.016 | |
| Tetracyclines | Tetracycline | 128 | 128 | 128 | 128 | 128 | 128 |
| Fluoroquinolones | Ciprofloxacin | 1 | 0.125 | 0.25 | 1 | 0.031 | 0.063 |
| Aminoglycosides | Kanamycin | 2 | 2 | 2 | 4 | 2 | 2 |
| Tobramycin | 0.5 | 1 | 1 | 1 | 1 | 1 | |
| Gentamicin | 0.5 | 1 | 0.5 | 0.5 | 0.5 | 0.5 | |
| Lipopeptides | Polymyxin B | 4 | 4 | 4 | 4 | 8 | 4 |
-
*
Drug-sensitive, italics; drug-resistant, bold-text.
Table 4
List of plasmids used in this study.
| Plasmid | Relevant characteristics* | Source/reference |
|---|---|---|
| pKD4 | Contains kanamycin resistance cassette (kan) flanked by FRT sites (FRT-kan-FRT); oriR6K, AmpR, KmR | Datsenko and Wanner, 2000 |
| pJET1.2/blunt | Blunt-end cloning vector for insertion of DNA fragments with single deoxyadenosine overhangs; AmpR | Thermo Scientific |
| pDonor(OmpK36) | pJET1.2/blunt carrying FRT-kan-FRT and K. quasipneumoniae FK688 ompK36 regions (donor plasmid for lambda Red recombination-mediated repair of ompK36 gene in FK688); AmpR, KmR | This study |
| pACBSR | Arabinose-inducible promoter; I-SceI endonuclease; lambda Red recombination genes, CmR | Herring et al., 2003 |
| pFLP-BSR | pACBSR carrying fragment length polymorphism (FLP) recombinase to excise the kanamycin cassette, temp-sensitive replication; CmR | Rocker et al., 2020 |
| pJP-CmR | Derivative of pJP168 for anhydrotetracycline inducible protein expression. CmR | Rocker et al., 2020 |
| pJP-blaDHA-1 | pJP-Cm containing blaDHA-1 from FK688 | This study |
| pJP-blaOKP-B-21 | pJP-Cm containing blaOKP-B-21 from FK688 | This study |
| pJP-blaSHK | pJP-Cm containing CKCOFDID_01495 from FK688 | This study |
| pJP-blaOPHC | pJP-Cm containing CKCOFDID_02113 from FK688 | This study |
| pJP-blaDAE | pJP-Cm containing pbpG from FK688 | This study |
| pJP-blaTRN | pJP-Cm containing CKCOFDID_04153 from FK688 | This study |
| pJP-blaABH | pJP-Cm containing dhmA from FK688 | This study |
| pJP-blaDAC | pJP-Cm containing dacB from FK688 | This study |
-
*
Amp, ampicillin; Km, kanamycin; Cm, chloramphenicol.
Table 5
List of strains used in this study.
| Strain | Relevant characteristics* | Source or reference |
|---|---|---|
| K. quasipneumoniae | ||
| FK688 ΔompK36 pNAR1 | Wildtype, clinical isolate from a bloodstream infection case from the First Affiliated Hospital of Wenzhou Medical University, China. Expresses β-lactamase blaOKP-B-21. Deficient in ompK35 and ompK36 porin expression. Harbours a 258 kb plasmid pNAR1 (AmpR, TetR, RifR, TrpR, StpR, EryR, SdzR, CipR). | Bi et al., 2017 |
| ΔompK36 pNAR1ΔblaDHA-1 | FK688 with a 17 kb deletion from tnpA-sul1 in pNAR1. | This study |
| ΔompK36 pNAR1– | FK688 cured of pNAR1. | This study |
| ompK36+ pNAR1 | FK688 with a genetically repaired and functional ompK36 gene. Carries pNAR1. | This study |
| ompK36+ pNAR1ΔblaDHA-1 | FK688 with a genetically repaired and functional ompK36 gene. It has a 17 kb deletion from tnpA-sul1 in pNAR1. | This study |
| FK688-GFP+ | FK688 with a constitutively expressed green fluorescent protein (GPF). GFP gene inserted downstream of the glmS gene via pGRG-eGFP. | This study |
| A2(o) ΔompK36 pNAR1ΔblaDHA-1 | Evolved strain from Kq1. It has a 17 kb deletion from tnpA-sul1 in pNAR1. Forms opaque colonies. | This study |
| A2(t) ΔompK36 pNAR1ΔblaDHA-1 | Evolved strain from Kq1. It has a 17 kb deletion from tnpA-sul1 in pNAR1. Forms translucent colonies. | This study |
| B3(o) ompK36+ pNAR1ΔblaDHA-1 | Evolved strain from Kq4. It has a 17 kb deletion from tnpA-sul1 in pNAR1. Forms opaque colonies. | This study |
| B3(t) ompK36+ pNAR1ΔblaDHA-1 | Evolved strain from Kq4. It has a 17 kb deletion from tnpA-sul1 in pNAR1. Forms translucent colonies. | This study |
| K. pneumoniae | ||
| B5055 | Hypermucoviscous phenotype. Wildtype, clinical isolate, serotype K2;O1 | Statens Serum Institut, Denmark |
| B5055 nm | B5055 deletion mutant ∆wza-wzc::km (non-mucoid); KmR | Prof. Richard Strugnell University of Melbourne |
| E. coli | ||
| DH5α | F– endA1 hsdR17(rK–, mK+) supE44 λ– thi-1 recA1 gyrA96 relA1 deoR Δ(lacZYA-argF) U169 Φ80dlacZ∆M15; NalR E. coli DH5α was used for cloning purposes | Invitrogen |
| ATCC 25922 | CLSI control strain for antimicrobial susceptibility testing | ATCC |
| BW25113 (WT) | rrnB3 ΔlacZ4787(::rrnB-3) hsdR514 Δ(araD-araB)567 Δ(rhaD-rhaB)568, rph-1 | Baba et al., 2006 |
-
*
Amp, ampicillin; Tet, tetracycline; Rif, rifamycin; Trp, trimethoprim; Stp, streptomycin; Ery, erythromycin; Sdz, sulfadiazine; Cip, ciprofloxacin; Nal, nalidixic acid.
Table 6
List of oligonucleotide primers used in this study.
| Primer | Sequence (5–3’)* | Description |
|---|---|---|
| Construction of FK688 OmpK36+ strains | ||
| K36_insert-R | gcgcgacctactacttcaacaaaaacatgtccacctatgttgactacaaaatcaacctgctg | Construction of pDonor(OmpK36) plasmid |
| K36_insert-F | gttgaagtagtaggtcgcgcccacgtcaacatatttcaggatgtcctggtcgcc | |
| K36_Km-F | ctaaggaggatattcatatggtcgcaagctgcataacaaa | |
| K36_Km-R | gaagcagctccagcctacacattagaactggtaaaccaggcccag | |
| K36_ISceI-R | tagggataacagggtaatgcccgacggtgatatccatc | |
| K36_ISceI-F | tagggataacagggtaatgcttcggtacctctgtaacttatga | |
| pKD4-F | tgtgtaggctggagctgcttc | Kanamycin cassette from pKD4 |
| pKD4-R | catatgaatatcctccttag | |
| Cloning of putative β-lactamases genes for anhydrotetracycline-inducible expression | ||
| blaDHA-1_For_NR | gtccCCATGGtgaaaaaatcgttatctgcaac | |
| blaDHA-1_Rev_NR | cgtcAAGCTTattccagtgcactcaaa | |
| blaOKP_F_NR | tagcGAATTCatgcgttatgttcgcctgtgcc | |
| blaOKP_R_NR | gcatAAGCTTctagcgctgccagtg | |
| blaSHK1_F_NR | gttcCCATGGtgataagaaaaccactggcc | |
| blaSHK1_R_NR | atgcAAGCTTaacgcagctcgcg | |
| blaOPHC2_F_NR | ctagGAATTCatgacaccagctcccttttataccctgac | |
| blaOPHC2_R_NR | acggAAGCTTtcgctgtgatcggtgtt | |
| blaDAE1_F_NR | tgcaGAATTCatgatgccgaaatttcgagtctctttgc | |
| blaDAE1_R_NR | gatcAAGCTTttaatcgttctgcgcg | |
| blaABH1_F_NR | acgtCCATGGTGaacagattatccctgatcc | |
| blaABH1_R_NR | gatcAAGCTTacaaccgatcggcg | |
| blaDAC1_F_NR | aaggCCATGGtgcgatttcccagatttatc | |
| blaDAC1_R_NR | aagcAAGCTTtagttgttctggtacaaatcc | |
| blaTRN1_F_NR | cgtaCCATGGtgactgaacgggtttattacac | |
| blaTRN1_R_NR | aatcAAGCTTacgtcagggaatagctgatc | |
| pJPMCS_For | cctaatttttgttgacactctatcattg | pJP-CmR-gene insert sequencing primers |
| pJPMCS_Rev | gccaggcaaattctgttttatcagaccg | |
-
*
Restriction endonuclease recognition sites are capitalised.
