TLR7 activation at epithelial barriers promotes emergency myelopoiesis and lung antiviral immunity
- Centre for Inflammatory Disease, Department of Immunology and Inflammation, Imperial College London, United Kingdom
- National Heart and Lung Institute, Imperial College London, United Kingdom
- Division of Cancer, Department of Surgery and Cancer, Imperial College London, United Kingdom
Figures
Figure 1 with 1 supplement
Repetitive R848 administration at barrier sites drives a profound monocytosis.
(A) BALB/c mice (n = 3 per group) received 100 µg of R848 topically or intraperitoneally (IP), 3× per week for 4 wk. Control BALB/c mice were given topical acetone or 200 µl of PBS IP. Left panel …
-
Figure 1—source data 1
FACS raw data.
- https://cdn.elifesciences.org/articles/85647/elife-85647-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
The effects of TLR7 stimulation depend on dose and route of administration.
(A) Graphical illustration of R848 treatment regimen. (B) BALB/c mice (n = 3 per group) received 100 μg of R848 topically or intraperitoneally (IP), 3× per week for 4 wk. Control mice given topical …
Figure 2 with 1 supplement
R848-induced monocytosis is specific to TLR7 activation.
Blood counts are shown for total monocytes, Ly6C-high monocytes, Ly6C-low monocytes, monocyte subpopulation ratio, and lymphocytes 24 hr after the indicated treatment. (A) BALB/c mice (n = 4 per …
-
Figure 2—source data 1
FACS raw data.
- https://cdn.elifesciences.org/articles/85647/elife-85647-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
IFNs and cytokines are not involved in the R848-induced monocytosis.
(A) C57BL/6 (black triangles) or Ifng-/- mice (red squares) were either left untreated (n = 4 WT, n = 2 Ifng-/-) or given 4× topical treatments with R848 (n = 3 per group). Blood counts for total …
Figure 3 with 1 supplement
R848-induced monocytosis is driven by TLR7 activation of myeloid cells.
(A, B) Blood counts for total monocytes, Ly6C-high monocytes, Ly6C-low monocytes, monocyte subpopulation ratio, and lymphocytes at baseline and 24 hr after the indicated treatment. (A) C57BL/6 mice …
-
Figure 3—source data 1
FACS raw data.
- https://cdn.elifesciences.org/articles/85647/elife-85647-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
The role of myeloid cell populations in R848-driven monocytosis.
(A) Lethally irradiated WT or Tlr7-/- host mice were reconstituted with bone marrow (BM) from WT or Tlr7-/- donor mice as follows: WT BM into WT host (n = 5, open circles), WT BM into Tlr7-/- host …
Figure 4 with 1 supplement
R848-induced monocytes are derived from the bone marrow (BM) and have features of emergency myelopoiesis.
(A) BALB/c mice underwent splenectomy or sham surgery and were left to recover for 7 wk. Among the splenectomised mice, a group was treated 6× with topical R848 (n = 4, blue line) and the remaining …
-
Figure 4—source data 1
FACS raw data.
- https://cdn.elifesciences.org/articles/85647/elife-85647-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Bone marrow (BM) gating strategy.
(A, B) HSC-SCL-Cre-ERT;R26R-EYFP mice (n = 4 per group) were treated for five consecutive days with tamoxifen (4 mg/100 μl) by oral gavage. Three days after the tamoxifen administration, the left …
Figure 5
Topical R848 drives Ly6C-high monocyte differentiation to intravascular and tissue macrophages.
(A) C57BL/6 mice were injected intraperitoneally (IP) with either anti-GR1 antibody (n = 3, red squares) or matched isotype control (n = 3, black triangles). Blood Ly6C-high and Ly6C-low monocyte …
-
Figure 5—source data 1
FACS raw data.
- https://cdn.elifesciences.org/articles/85647/elife-85647-fig5-data1-v2.xlsx
Figure 6 with 1 supplement
Immature monocytes egress from the bone marrow (BM) independently of CCR2.
(A, B) C57BL/6 mice (n = 4, black triangles) or Ccr2RFP/RFP mice (n = 6, red squares) were treated topically six times with R848. (A) Blood counts for total monocytes, Ly6C-high and Ly6C-low …
-
Figure 6—source data 1
FACS raw data.
- https://cdn.elifesciences.org/articles/85647/elife-85647-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
R848-induced myeloid response is independent from CX3CR1 and vascular permeability.
(A) C57BL/6 mice (n = 3, black lines) or Cx3cr1GFP/GFP (n = 3, orange lines) were treated topically four times with R848. Blood counts for total monocytes, Ly6C-high monocytes, Ly6C-low monocytes, …
Figure 7 with 1 supplement
R848-induced emergency monocytes have antiviral effects in the lung.
(A–C) C57BL/6 mice were either naive (n = 4, black circles) or treated four times with topical R848 (n = 4, red squares). (A) Percentage of cells positive for Sca-1 and representative histograms in …
-
Figure 7—source data 1
FACS raw data.
- https://cdn.elifesciences.org/articles/85647/elife-85647-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
R848-induced monocytes are activated and functionally impaired.
(A) Cx3cr1GFP/+ mice were treated topically four times with R848 (n = 5, grey bars) or acetone (n = 3 white bars) on the right ear. 24 hr after the last treatment, mice were anaesthetised and the …
Figure 8
Repetitive application of a TLR7 agonist (R848) to the skin activates tissue macrophages which signal to the bone marrow to drive the expansion of haematopoietic stem and progenitor cells (HSPCs) and their differentiation into monocytes.
These Ly6C-high monocytes have an immature phenotype and egress from the bone marrow independently of CCR2. Subsequently, Ly6C-high monocytes differentiate into Ly6C-low blood monocytes and into …
Author response image 1
(A) BALB/c mice (n=4 per group) received 2x topical ear treatments with 100ug R848, while vehicle mice received 2x treatments with acetone. Ear skin was harvested at 24 hours after the final …
Videos
Video 1
Cx3cr1GFP/+ mice were treated topically on the right ear for four times with R848 (panel on the right) or acetone (panel on the left).
24 hr after the last treatment, the mice were anaesthetised and the contralateral ear was visualised using intravital microscopy (red = dextran, green = CX3CR1-GFP).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Rat anti-mouse Ly6G FITC (1A8) | BioLegend | Cat# 127606 | Flow (1:100) |
| Antibody | Rat anti-mouse MHC-II FITC (M5/114.15.2) | BioLegend | Cat# 107606 | Flow (1:400) |
| Antibody | Rat anti-mouse Ly6C PerCP-Cy5.5 (HK1.4) | BioLegend | Cat# 128012 | Flow (1:200) |
| Antibody | Rat anti-mouse Ly6C Brilliant Violet 605 (HK1.4) | BioLegend | Cat# 128036 | Flow (1:100) |
| Antibody | Rat anti-mouse CD11b PE-Cy7 (M1/70) | BioLegend | Cat# 101216 | Flow (1:400) |
| Antibody | Rat anti-mouse CD11b APC (M1/70) | BioLegend | Cat# 101212 | Flow (1:400) |
| Antibody | Rat anti-mouse CD115 PE (AFS98) | BioLegend | Cat# 135506 | Flow (1:100) |
| Antibody | Rat anti-mouse CD115 APC (AFS98) | BioLegend | Cat# 135510 | Flow (1:100) |
| Antibody | Rat anti-mouse B220 Brilliant Violet 605 (RA3-6B2) | BioLegend | Cat# 103244 | Flow (1:400) |
| Antibody | Rat anti-mouse B220 FITC (RA3-6B2) | BD Biosciences | Cat# 553087 | Flow (1:400) |
| Antibody | Hamster anti-mouse CD3e Brilliant Violet 711 (145-2C11) | BioLegend | Cat# 100349 | Flow (1:100) |
| Antibody | Hamster anti-mouse CD3e FITC (145-2C11) | BD Biosciences | Cat# 553062 | Flow (1:100) |
| Antibody | Rat anti-mouse CD11a APC (M17/4) | BioLegend | Cat# 101120 | Flow (1:100) |
| Antibody | Rat anti-mouse CD117 PE-Cy7 (2B8) | BioLegend | Cat# 105814 | Flow (1:100) |
| Antibody | Rat anti-mouse CD11b PerCP-Cy5.5 (M1/70) | BioLegend | Cat# 101228 | Flow (1:400) |
| Antibody | Rat anti-mouse CD135 Brilliant Violet 421 (A2F10.1) | BioLegend | Cat# 135315 | Flow (1:100) |
| Antibody | Rat anti-mouse Sca1 Brilliant Violet 711 (D7) | BioLegend | Cat# 108131 | Flow (1:100) |
| Antibody | Rat anti-mouse CD16/CD32 APC-Cy7 (93) | BioLegend | Cat# 101328 | Flow (1:100) |
| Antibody | Rat anti-mouse CD135 APC (A2F10.1) | BioLegend | Cat# 135310 | Flow (1:100) |
| Antibody | Rat anti-mouse CD49b FITC (DX5) | BD Biosciences | Cat# 553857 | Flow (1:100) |
| Antibody | Hamster anti-mouse CD11c APC (HL3) | BD Biosciences | Cat# 550261 | Flow (1:100) |
| Antibody | Anti-mouse CD45 APC-eFluor 780 (30-F11) | eBioscience | Cat# 47-0451-82 | Flow (1:100) |
| Antibody | Rat anti-mouse Ly6G Brilliant Violet 421 (1A8) | BioLegend | Cat# 127628 | Flow (1:100) |
| Antibody | Rat anti-mouse F4/80 Brilliant Violet 785 (BM8) | BioLegend | Cat# 123141 | Flow (1:400) |
| Antibody | Rat anti-mouse F4/80 Alexa Fluor 488 (BM8) | BioLegend | Cat# 123120 | IF (1:200) |
| Antibody | Rat anti-mouse MHC-II PerCP eFluor710 (M5/114.15.2) | eBioscience | Cat# 46-5321-82 | Flow (1:400) |
| Antibody | Rat anti-mouse Sca1 PE-Dazzle 594 (D7) | BioLegend | Cat# 108138 | Flow (1:100) |
| Antibody | Rat anti-mouse CD43 Alexa Fluor 700 (S11) | BioLegend | Cat# 143214 | Flow (1:400) |
| Antibody | Rat anti-mouse CD43 | BioLegend | Cat# 143202 | IF (1:50) |
| Antibody | Goat anti-Art IgG (H+L) Cross-Adsorbed secondary antibody, Alexa-Fluor 555 | Thermo Fisher | Cat# A-21434 | IF (1:400) |
| Antibody | Rat anti-mouse CXCR4 Alexa Fluor 647 (L276F12) | BioLegend | Cat# 146504 | Flow (1:100) |
| Antibody | Rat anti-mouse CCR2 Brilliant Violet 510 (SA203G11) | BioLegend | Cat# 150617 | Flow (1:100) |
| Antibody | Hamster anti-mouse CD11c PE-Cy7 (HL3) | BD Biosciences | Cat# 561022 | Flow (1:100) |
| Antibody | Rat anti-mouse Ly6C eFluor450 (HK1.4) | eBioscience | Cat# 48-5932-82 | Flow (1:100) |
| Antibody | Rat anti-mouse CD68 Alexa Fluor 488 (FA-11) | BioLegend | Cat# 137012 | IF (1:100) |
| Antibody | Rat anti-mouse Ly6G eFluor450 (1A8) | eBioscience | Cat# 48-9668-82 | Flow (1:100) |
| Antibody | Rat anti-mouse B220 PE-Cy5 (RA3-6B2) | BioLegend | Cat# 103210 | Flow (1:400) |
| Antibody | Rat anti-mouse CD4 PE-Cy5 (RM4-5) | BioLegend | Cat# 100513 | Flow (1:100) |
| Antibody | Rat anti-mouse CD5 PE-Cy5 (53-7.3) | BioLegend | Cat# 100604 | Flow (1:100) |
| Antibody | Rat anti-mouse CD8 PE-Cy5 (53-6.7) | BioLegend | Cat# 100710 | Flow (1:100) |
| Antibody | Rat anti-mouse TER119 PE-Cy5 (TER119) | BioLegend | Cat# 116210 | Flow (1:100) |
| Antibody | Rat anti-mouse GR1 PE-Cy5 (RB6-8C5) | BioLegend | Cat# 108410 | Flow (1:100) |
| Antibody | Rat anti-mouse CD150 PE-Cy7 (TC15-12F12.2) | BioLegend | Cat# 115914 | Flow (1:100) |
| Antibody | Rat anti-mouse CD117 APC eFluro780 (2B8) | eBioscience | Cat# 47-1171-82 | Flow (1:100) |
| Antibody | Rat anti-mouse Sca1 BV785 (D7) | BioLegend | Cat# 108139 | Flow (1:100) |
| Antibody | Hamster anti-mouse CD48 APC (HM48-1) | BioLegend | Cat# 103412 | Flow (1:100) |
| Antibody | Anti-mouse Ly6G (1A8, mouse chimeric) | Absolute Antibody | Cat# Ab00295-2.3 | Flow (1:100) |
| Antibody | Anti-mouse GR1 (RB6-8C5, mouse chimeric) | Absolute Antibody | Cat# Ab01030-2.0 | Flow (1:100) |
| Antibody | Rat anti-mouse IL-6R (15A7) | BioXcell | Cat# BE0047 | |
| Antibody | Rat IgG2b isotype control, anti-keyhole limpet hemocyanin (LTF-2) | BioXcell | Cat# BE0090 | |
| Peptide, , recombinant protein | R848 (water soluble) | Invivogen | tlrl-r848 | |
| Peptide, , recombinant protein | R848 | Enzo | ALX-420-038M025 | |
| Peptide, , recombinant protein | Poly(I:C) (LMW) | Invivogen | tlrl-picw | |
| Peptide, , recombinant protein | CpG (ODN 2395) | Invivogen | tlrl-2395 | |
| Peptide, , recombinant protein | LPS (E. coli 055:B5) | Invivogen | tlrl-b5lps | |
| Chemical compound, drug | Aldara (Imiquimod) | Meda Pharmaceuticals | 5% cream | |
| Chemical compound, drug | Anakinra | Swedish Orphan Biovitrum | 150 mg/ml | |
| Chemical compound, drug | Etanercept (Enbrel) | Pfizer Europe | 25 mg | |
| Chemical compound, drug | Baytril | Bayer Corporation | ||
| Chemical compound, drug | Tamoxifen | Sigma | Cat# T5648-1G | |
| Chemical compound, drug | Phorbol 12-myristate 13-acetate (TPA) | Sigma-Aldrich | Cat# P8139 | |
| Chemical compound, drug | Tetramethylrhodamine isothiocyanate–Dextran, 70 kDa | Sigma-Aldrich | Cat# T11-62 | |
| Chemical compound, drug | Bromodeoxyuridine (BrDU) | BioLegend | Cat# 423401 | |
| Chemical compound, drug | Liberase TM Research grade | Roche | Cat# 5401119001 | |
| Chemical compound, drug | DNase I (grade II) from bovine pancreas | Sigma-Aldrich | Cat# 10104159001 | |
| Commercial assay or kit | RNA-Later | Thermo Fisher | Cat# AM7020 | |
| Commercial assay or kit | LIVE/DEAD Fixable Aqua Dead Cell Stain Kit | Life Technologies | Cat# L34597 | |
| Commercial assay or kit | BD FACS Lysis Solution 10X Concentrate | BD Biosciences | Cat# 349202 | |
| Commercial assay or kit | RNEasy Mini Kit | QIAGEN | Cat# 74104 | |
| Commercial assay or kit | RNEasy Micro Plus Kit | QIAGEN | Cat# 74034 | |
| Commercial assay or kit | iScript cDNA Synthesis Kit | Bio-Rad | Cat# 1708891 | |
| Commercial assay or kit | QuantiTect Probe PCR Kit | QIAGEN | Cat# 204343 | |
| Commercial assay or kit | High-Capacity RNA-to-cDNA kit | Applied Biosystems | Cat# 4387406 | |
| Commercial assay or kit | Legendplex Mix and Match Kit | BioLegend | ||
| Commercial assay or kit | BrdU Staining Kit | eBioscience | Cat# 8817-6600 | |
| Strain, strain background (Mus musculus, C57BL/6) | B6.129P-Cx3cr1tm1Litt/J | Jackson Laboratory | JAX stock #005582 | Jung et al., 2000 |
| Strain, strain background (M. musculus, C57BL/6) | B6(Cg)-Ifnar1tm1.2Ees/J | Jackson Laboratory | JAX stock #028288 | Hwang et al., 1995 |
| Strain, strain background (M. musculus, C57BL/6) | B6(Cg)-Rag2tm1.1Cgn/J | Jackson Laboratory | JAX stock #08449 | Hao and Rajewsky, 2001 |
| Strain, strain background (M. musculus, C57BL/6) | B6.129P2-Lyz2tm1(cre)Ifo/J | Jackson Laboratory | JAX stock #004781 | Clausen et al., 1999 |
| Strain, strain background (M. musculus, C57BL/6) | B6.129(Cg)-Ccr2tm2.1Ifc/J | Jackson Laboratory | JAX stock #017586 | Saederup et al., 2010 |
| Strain, strain background (M. musculus, C57BL/6) | B6.129P2-Tlr7tm1Aki | Hemmi et al., 2002 | ||
| Strain, strain background (M. musculus, C57BL/6) | B6.129S7-Ifngtm1Ts/J | Jackson Laboratory | JAX stock #002287 | Dalton et al., 1993 |
| Strain, strain background (M. musculus; C57BL/6) | Tlr7flox/flox | Solmaz et al., 2019 | ||
| Strain, strain background (M. musculus; BALB/c) | Cpa3- cre4Glli | Jackson Laboratory | JAX stock #026828 | Feyerabend et al., 2011 |
| Strain, strain background (M. musculus; BALB/c) | Gata1tm6Sho/J | Jackson Laboratory | JAX stock #05653 | Yu et al., 2002 |
| Strain, strain background (M. musculus; C57BL/6) | HSC-SCL-Cre-ERT;R26R-EYFP | Göthert et al., 2005 | ||
| Strain, strain background (influenza A virus) | strain X31 | John McCauley | Davidson, S., 2014 | |
| Strain, strain background (RSV) | Strain A2 | ATCC | ATCC VR-1540 | |
| Sequence-based reagent | RSV L gene forward | Invitrogen | GAACTCAGT GTA GGT AGAATGTTTGCA | |
| Sequence-based reagent | RSV L gene reverse | Invitrogen | TTCAGCTATCATTTTCTCTGCCAAT | |
| Sequence-based reagent | RSV L FAM-TAMRA probe | Eurofins MWG Operon | TTTGAACCTGTCTGAACATTCCCGGTT | |
| Sequence-based reagent | Flu M1 gene forward | Invitrogen | AAGACCAATCCTGTCACCTCTGA | |
| Sequence-based reagent | Flu M1 gene reverse | Invitrogen | CAAAGCGTCTACGCTGCA | |
| Sequence-based reagent | Flu M1 FAM-TAMRA probe | Eurofins MWG Operon | TTTGTGTTCACGCTCACCGT | |
| Software, algorithm | GraphPad Software (Prism) | GraphPad Software, Inc, La Jolla, California, USA | Version 9 | |
| Software, algorithm | FlowJo | Tree Star Inc Ashland, OR, USA | Version 10.7.1 | |
| Software, algorithm | Imaris 8.0.1 | Bitplane AG | ||
| Software, algorithm | FIJI | ImageJ2 (open source) | ||
| Software, algorithm | 7500 Fast System SDS v1.4 21 CFR Part 11 Module | Applied Biosystems | ||
| Software, algorithm | QuantStudio Software V1.2.4 | Applied Biosystems |
