Main text

Pathak T, Gueguinou M, Walter V, Delierneux C, Johnson MT, Zhang X, Xin P, Yoast RE, Emrich SM, Yochum GS, Sekler I, Koltun WA, Gill DL, Hempel N, Trebak M. YYYY. Dichotomous role of the human mitochondrial Na+/Ca2+/Li+ exchanger NCLX in colorectal cancer growth and metastasis. eLife 9:e59686. doi: 10.7554/eLife.59686.

Published 11 September 2020

We have been made aware through PubPeer of a mistake in Figure 3—figure supplement 1. Although the issues identified on PubPeer do not change the conclusions of the paper, they warrant correction. All sequences of primers and guide RNAs used in generating knockout (KO) cell clones and in genotyping are correct. Unfortunately, two sets of sequences were inadvertently swapped by the first author, a confusion that was caused by the fact that the NCLX gene is reversed in mammals. Although there is no excuse for such errors, unfortunately none of the contributing authors noticed these issues. We corrected this and added the sequences of the primers for the housekeeping genes that were identified as missing. Therefore, we modified the Appendix 1—key resources table and the cartoon in Figure 3—figure supplement 1 to reflect these corrections. Finally, we provide a Supplementary file 1, which contains genomic sequencing data for all our NCLX KO clones that provide decisive evidence that the NCLX is indeed knocked out in these cells. The details of the corrections are as follow:

We have corrected the text in the Methods section to change the guide RNA from g1 to g2 and add the predicted location of the stop codon for NCLX KO #33. The corrected text is shown here:

For the case of HCT116 cells, which we generated first, NCLX KO #33 was generated using a guide RNA (g2) which resulted in a single cut at nucleotide 150 in exon one causing a frameshift mutation and introduction of a stop codon at predicted position 181–183 bp and 184–186 bp in the NCLX open reading frame (Figure 3—figure supplement 1A).

Original text for reference:

For the case of HCT116 cells, which we generated first, NCLX KO #33 was generated using a guide RNA (g1) which resulted in a single cut at nucleotide 150 in exon one causing a frameshift mutation and introduction of a stop codon at position 180 in the NCLX open reading frame (Figure 3—figure supplement 1A).

We have corrected the text in the Results section to change the guide RNA from g1 to g2 and add the predicted location of the stop codon for NCLX KO #33. The corrected text is shown here:

For in vivo studies NCLX KO clone #33 was used, which was generated using a guide RNA (g2) resulting in a single cut at nucleotide 150 in exon one causing a frameshift mutation and introduction of a stop codon at predicted position 181–183 bp and 184–186 bp in the NCLX open reading frame (Figure 2A).

Original text for reference:

For in vivo studies NCLX KO clone #33 was used, which was generated using a guide RNA (g1) resulting in a single cut at nucleotide 150 in exon one causing a frameshift mutation and introduction of a stop codon at position 180 in the NCLX open reading frame (Figure 2A).

We have corrected the text in the Results section to fix the gene name from Fox3 to Foxo3. The corrected text is shown here:

In agreement with these findings, we found that transcript levels of stem cell markers NANOG, Oct4, Sox2, and Foxo3, as well as regulators of the glutathione synthesis pathway implicated in regulating these transcription factors in breast cancer, SLC7A11 and GCLM (Lu et al., 2015), were significantly upregulated in NCLX KO cells (Figure 5H–J, Figure 5—figure supplement 1G–O).

Original text for reference:

In agreement with these findings, we found that transcript levels of stem cell markers NANOG, Oct4, Sox2, and Fox3, as well as regulators of the glutathione synthesis pathway implicated in regulating these transcription factors in breast cancer, SLC7A11 and GCLM (Lu et al., 2015), were significantly upregulated in NCLX KO cells (Figure 5H–J, Figure 5—figure supplement 1G–O).

We have corrected the figure legend of Figure 5—figure supplement 1M to fix the gene name from Fox3 to Foxo3. The corrected text is shown here:

(G–N) RT-qPCR data plotted as the 2-ΔCt mRNA value of SLC7A11 (G), GCLM (H) in clones of HCT116 NCLX KO cells normalized to control HCT116 cells, and SLC7A11 (I), GCLM (J) NANOG (K), Sox2 (L), Foxo3 (M), and Oct4 (N) in clones of DLD1 NCLX KO cells relative to tubulin and normalized to control DLD1 cells.

Original text for reference:

(G–N) RT-qPCR data plotted as the 2-ΔCt mRNA value of SLC7A11 (G), GCLM (H) in clones of HCT116 NCLX KO cells normalized to control HCT116 cells, and SLC7A11 (I), GCLM (J) NANOG (K), Sox2 (L), Fox3 (M), and Oct4 (N) in clones of DLD1 NCLX KO cells relative to tubulin and normalized to control DLD1 cells.

The unfortunate confusion described above led to mislabelling of primers and the two guide RNA in the cartoon of Figure 3—figure supplement 1A-F. This confusion occurred because the NCLX gene is reversed in mammals. We now include an updated version of Figure 3—figure supplement 1, where the guide RNAs and primers within the cartoons are drawn as much to scale as possible with the relative positions of primers and guide RNAs and the predicted positions of the STOP codons introduced by CRISPR/Cas9. In the case of DLD1 cells in Figure 3—figure supplement 1G, the correct primer combination is 4+5 and not 3+6 as originally stated. The corrected Figure 3—figure supplement 1 is shown here:

The originally published Figure 3—figure supplement 1 is shown for reference:

The original Figure 3—figure supplement 1A was reproduced in Figure 2A for convenience. Therefore, we also need to fix the cartoon in Figure 2A. The corrected Figure 2 is shown here:

The originally published Figure 2 is shown for reference:

We also corrected the gene name Fox3 to Foxo3 in Figure 5—figure supplement 1M. The corrected Figure 5—figure supplement 1 is shown here:

The original Figure 5—figure supplement 1 is shown here for reference:

The GAPDH and FOXO3 primers were identified wrong, and the primers for two housekeeping genes, NONO and Tubulin, were missing from the Appendix 1—key resources table. We have updated the Appendix 1—key resources table to include these primer pairs. In addition, we have corrected the primer sequences of qNCLX1_F, qNCLX1_R, NCLX_1, and NCLX_2, which were inadvertently swapped in the original Appendix 1—key resources table. We have also corrected the name from HCT116 shNCLX KO and DLD1 shNCLX KO to HCT116 shNCLX and DLD1 shNCLX in the Appendix 1—key resources table. The latter mistakes happened because we uploaded the wrong version of the Appendix 1—key resources table in the original manuscript. The corrected Appendix 1—key resources table is shown here (The corrections are highlighted in bold for illustrative purposes):

Appendix 1—key resources table

AReagent type(species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Homo sapiens)SLC8B1/NCLXGenBankGene ID: 80024
Gene Mus musculusSlc8b1/NCLXGenBankGene ID: 170756
Genetic reagent Mus musculusNOD.CB17-Prkdcscid/JJackson LaboratoryStock No: 010636, RRID:IMSR_JAX:010636Male
Cell line (Homo-sapiens)HCT116 (colon, epithelial)ATCCATCC# CCL-247Male
Cell line (Homo-sapiens)HT29 (colon, epithelial)ATCCATCC# HTB-38Female
Cell line (Homo-sapiens)DLD1 (colon, epithelial)ATCCATCC# CCL-221Male
Cell line (Homo-sapiens)HCT116 NCLX KO (colon, epithelial)This paperNCLX Knockout clones of HCT116 cells were generated by the Trebak lab using CRISPR/Cas9 and are available upon request
Cell line (Homo-sapiens)DLD1 NCLX KO (colon, epithelial)This paperNCLX Knockout clones of DLD1 cells were generated in the Trebak lab using CRISPR/Cas9 and are available upon request
Cell line (Homo-sapiens)HCT116 shNCLX (colon, epithelial)This paperHCT116 cells with stable shRNA-mediated knockdown of NCLX (shNCLX) were generated by the Trebak Lab using shRNA sequences (listed below in this table) cloned in the lentiviral vector pLKO. These plasmids are available upon request
Cell line (Homo-sapiens)DLD1 shNCLX (colon, epithelial)This paperDLD1 cells with stable shRNA-mediated knockdown of NCLX (shNCLX) were generated by the Trebak Lab using shRNA sequences (listed below in this table) cloned in the lentiviral vector pLKO. These plasmids are available upon request
Antibodyanti-Hif1α (Rabbit polyclonal)Cell Signaling TechnologyCat# 14,179 s, RRID:AB_2622225WB (1:500)
Antibodyanti- ALDOA (Rabbit polyclonal)Cell Signaling TechnologyCat# 8060 S, RRID:AB_2797635WB (1:1000)
Antibodyanti- HK2 (Rabbit polyclonal)Cell Signaling TechnologyCat# 2867 S, RRID:AB_2232946WB (1:1000)
Antibodyanti- LDHA (Rabbit polyclonal)Cell Signaling TechnologyCat# 2012 S, RRID:AB_2137173WB (1:1000)
Antibodyanti- MMP1 (Rabbit polyclonal)AbcamCat# ab38929, RRID:AB_776395WB (1:1000)
Antibodyanti- MMP2 (Mouse monoclonal)Santa Cruz BiotechnologyCat# sc-13594, RRID:AB_627956WB (1:500)
Antibodyanti- MMP9 (Rabbit polyclonal)AbcamCat# ab73734, RRID:AB_1860201WB (1:1000)
Antibodyanti- LC3B (Rabbit polyclonal)AbcamCat# ab51520, RRID:AB_881429WB (1:1000)
Antibodyanti- OXPHOS (Mouse monoclonal)AbcamCat# ab110413, RRID:AB_2629281WB (1:5000)
Antibodyanti- GAPDH (Mouse monoclonal)Millipore SigmaCat# MAB374, RRID:AB_2107445WB (1:10000)
Antibodyanti- HSC70 (Mouse monoclonal)Santa Cruz BiotechnologyCat# sc-24, RRID:AB_627760WB (1:5000)
Antibodyanti- p62 (Rabbit polyclonal)AbcamCat# ab109012, RRID:AB_2810880WB (1:1000)
Antibodyanti- cleaved caspase-3 (Rabbit polyclonal)Cell Signaling TechnologyCat# 9661 S, RRID:AB_2341188WB (1:1000), IF (1:500)
Antibodyanti- pAMPK (Rabbit polyclonal)Cell Signaling TechnologyCat# 2535 S, RRID:AB_331250WB (1:1000)
Antibodyanti- AMPK (Rabbit polyclonal)Cell Signaling TechnologyCat# 5831 S, RRID:AB_10622186WB (1:1000)
Antibodyanti- pS6K (Rabbit polyclonal)Cell Signaling TechnologyCat# 9234 S, RRID:AB_2269803WB (1:1000)
Antibodyanti- S6K (Rabbit polyclonal)Cell Signaling TechnologyCat# 2708 S, RRID:AB_390722WB (1:1000)
Sequence-based reagentSLC7A11_FThis paperRT-PCR primersAGGGTCACCTTCCAGAAATC
Sequence-based reagentSLC7A11_RThis paperRT-PCR primersGAAGATAAATCAGCCCAGCA
Sequence-based reagentGCLM _FThis paperRT-PCR primersCATTTACAGCCTTACTGGGAGG
Sequence-based reagentGCLM _RThis paperRT-PCR primersATGCAGTCAAATCTGGTGGCA
Sequence-based reagentFOXO3_FThis paperRT-PCR primersCGGACAAACGGCTCACTCT
Sequence-based reagentFOXO3_RThis paperRT-PCR primersGGACCCGCATGAATCGACTAT
Sequence-based reagentNANOG _FThis paperRT-PCR primersTTTGTGGGCCTGAAGAAAACT
Sequence-based reagentNANOG _RThis paperRT-PCR primersAGGGCTGTCCTGAATAAGCAG
Sequence-based reagentOCT4_FThis paperRT-PCR primersTTCAGCCAAACGACCATCTG
Sequence-based reagentOCT4_RThis paperRT-PCR primersCACGAGGGTTTCTGCTTTGC
Sequence-based reagentSOX2_FThis paperRT-PCR primersGCCGAGTGGAAACTTTTGTCG
Sequence-based reagentSOX2_RThis paperRT-PCR primersGGCAGCGTGTACTTATCCTTCT
Sequence-based reagentGLUT1_FThis paperRT-PCR primersTATCGTCAACACGGCCTTCACT
Sequence-based reagentGLUT1_RThis paperRT-PCR primersAACAGCTCCTCGGGTGTCTTAT
Sequence-based reagentHK2_FThis paperRT-PCR primersGCCATCCTGCAACACTTAGGG
Sequence-based reagentHK2_RThis paperRT-PCR primersGTGAGGATGTAGCTTGTAGAGGGT
Sequence-based reagentGPI_FThis paperRT-PCR primersTGTGTTCACCAAGCTCACAC
Sequence-based reagentGPI_RThis paperRT-PCR primersGTAGAAGCGTCGTGAGAGGT
Sequence-based reagentALDOA_FThis paperRT-PCR primersAGGCCATGCTTGCACTCAG
Sequence-based reagentALDOA_RThis paperRT-PCR primersAGGGCCCAGGGCTTCAG
Sequence-based reagentENO1_FThis paperRT-PCR primersGACTTGGCTGGCAACTCTG
Sequence-based reagentENO1_RThis paperRT-PCR primersGGTCATCGGGAGACTTGAAG
Sequence-based reagentLDHA_FThis paperRT-PCR primersGGTTGGTGCTGTTGGCATGG
Sequence-based reagentLDHA_RThis paperRT-PCR primersTGCCCCAGCCGTGATAATGA
Sequence-based reagentMMP1_FThis paperRT-PCR primersATGCTGAAACCCTGAAGGTG
Sequence-based reagentMMP1_RThis paperRT-PCR primersGAGCATCCCCTCCAATACCT
Sequence-based reagentMMP2_FThis paperRT-PCR primersACCAGCTGGCCTAGTGATGATG
Sequence-based reagentMMP2_RThis paperRT-PCR primersGGCTTCCGCATGGTCTCGATG
Sequence-based reagentMMP9_FThis paperRT-PCR primersACGCACGACGTCTTCCAGTA
Sequence-based reagentMMP9_RThis paperRT-PCR primersCCACCTGGTTCAACTCACTCC
Sequence-based reagentqNCLX_1_FThis paperRT-PCR primersGCGTGCTGGTTACCACAGT
Sequence-based reagentqNCLX_1_RThis paperRT-PCR primersCCACGGAAGAGCATGAGGAA
Sequence-based reagentqNCLX_2_FThis paperRT-PCR primersCCGGCAGAAGGCTGAATCTG
Sequence-based reagentqNCLX_2_RThis paperRT-PCR primersACCTTGCGGCAGTCTACCAC
Sequence-based reagentGAPDH_FThis paperRT-PCR primersCCCTTCATTGACCTCAACTACA
Sequence-based reagentGAPDH_RThis paperRT-PCR primersATGACAAGCTTCCCGTTCTC
Sequence-based reagentNONO_FThis paperRT-PCR primersTCCGAGGAGATACCAGTCGG
Sequence-based reagentNONO_RThis paperRT-PCR primersCCTGGGCCTCTCAACTTCGAT
Sequence-based reagentTubulin_FThis paperRT-PCR primersAGTCCAAGCTGGAGTTCTCTAT
Sequence-based reagentTubulin_RThis paperRT-PCR primersCAATCAGAGTGCTCCAGGGT
Sequence-based reagentG6PD_FThis paperRT-PCR primersCGAGGCCGTCACCAAGAAC
Sequence-based reagentG6PD_RThis paperRT-PCR primersGTAGTGGTCGATGCGGTAGA
Sequence-based reagentPGD_FThis paperRT-PCR primersATGGCCCAAGCTGACATCG
Sequence-based reagentPGD_RThis paperRT-PCR primersAAAGCCGTGGTCATTCATGTT
Sequence-based reagentTKT_FThis paperRT-PCR primersTCCACACCATGCGCTACAAG
Sequence-based reagentTKT_RThis paperRT-PCR primersCAAGTCGGAGCTGATCTTCCT
Sequence-based reagentg1This paperGuide RNA sequences (Figure 2A and Figure 3—figure supplement 1A)GCGCAGATTCAGCCTTCTGC
Sequence-based reagentg2This paperGuide RNA sequences (Figure 3—figure supplement 1B and C)GGGATACTCACGTCTACCAC
Sequence-based reagentg3This paperGuide RNA sequences (Figure 3—figure supplement 1E)GTAGACGTGAGTATCCCGGT
Sequence-based reagentg4This paperGuide RNA sequences (Figure 3—figure supplement 1E)ACCCACACCAGCAGTCCGTC
Sequence-based reagentshRNA (shNCLX#2)This paperFigure 3—figure supplement 1IGCCTTCTTGCTGTCATGCAAT
Sequence-based reagentshRNA (shNCLX#3)This paperFigure 3—figure supplement 1IGCTCCTCTTCTACCTGAACTT
Sequence-based reagentsiRNA (siNCLX)This paperFigure 4—figure supplement 1MAACGGCCCCUCAACUGUCUT
Sequence-based reagentNCLX_1This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)GCCAGCATTTGTGTCCATTT
Sequence-based reagentNCLX_2This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)AATTCGTCTCGGCCACTTAC
Sequence-based reagentNCLX_3This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)ACTTAGCACATCGCCACCTG
Sequence-based reagentNCLX_4This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)CTGATCTGCACGCTGAATGG
Sequence-based reagentNCLX_5This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)GAGGTACACAGCAGTTCT CCC
Sequence-based reagentNCLX_6This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)CAGCTGGTGCCCTCAAACAC
Sequence-based reagentPX75 NCLX test FThis paperPCR primers for screening genomic DNA of NCLX KO HCT116 cellsGTTGTTGAGACAGAGTCTTGC TTC
Sequence-based reagentPX76 NCLX test RThis paperPCR primers for screening genomic DNA of NCLX KO HCT116 cellsTCCAGCGAGACTGTGCAGAA
Sequence-based reagentpx77This paperPCR primers for genotyping NCLX -/- miceTACAGTCTGGCTCGTTCC CT
Sequence-based reagentpx78This paperPCR primers for genotyping NCLX -/- miceCGGTCCCAGACGCCG T
Sequence-based reagentpx79This paperPCR primers for genotyping NCLX -/- miceCGCTGGGGTCCATCT TTG AT
Sequence-based reagentpx80This paperPCR primers for genotyping NCLX -/- miceTGGGTCTCCGGTCCCAGT A
Commercial assay or kitcDNA Reverse Transcription KitApplied biosystemsCat# 4368814
Commercial assay or kitSeahorse XFp Mito Fuel Flex Test KitAgilent TechnologiesCat# 103270–100
Commercial assay or kitSeahorse XFp Glycolysis Stress Test KitAgilent TechnologiesCat# 103017–100
Commercial assay or kitSeahorse XFp Cell Mito Stress Test KitAgilent TechnologiesCat# 103010–100
Commercial assay or kitBCA assay kitThermo Fisher ScientificCat# A53225
Commercial assay or kitTMREThermo Fisher ScientificCat# T669
Commercial assay or kitCyQUANTThermo Fisher ScientificCat# C35006
Chemical compound, drugAntibiotic and AntimycoticThermo Fisher ScientificCat# 15240062
Chemical compound, drugMcCoy’s 5 ACorningCat# 10-050CV
Chemical compound, drugRPMI-1640CorningCat# 10-040CV
Chemical compound, drugLipofectamine 2000Thermo Fisher ScientificCat# 11668019
Chemical compound, drugTrypLEThermo Fisher ScientificCat# 12605028
Chemical compound, drugCoCl2Sigma-AldrichCat# 15862
Chemical compound, drug2-deoxy-D-glucose (2-DG)Sigma-AldrichCat# D8375
Chemical compound, drug5-FluorouracilSigma-AldrichCat# F6627
Chemical compound, drugGlucoseSigma-AldrichCat# D9434
Chemical compound, drugPuromycinMP BiomedicalCat# 02100552
Chemical compound, drugRIPA bufferSigmaCat# R0278
Chemical compound, drugATPSigmaCat# A9187
Chemical compound, drugDextroseFisher ScientificCat# D14
Chemical compound, drugTris BaseFisher ScientificCat# BP152-5
Chemical compound, drugNaClFisher ScientificCat# S671
Chemical compound, drugMOPS SDS running bufferThermo Fisher ScientificCat# NP0001
Chemical compound, drugTris-Glycine transfer bufferBio-radCat#161–0734
Chemical compound, drugKClFisher ScientificCat# P217
Chemical compound, drugMgCl2Fisher ScientificCat# M33
Chemical compound, drugCaCl2Fisher ScientificCat# C614
Chemical compound, drugHEPESFisher ScientificCat# BP310
Chemical compound, drugLDS sample bufferThermo Fisher ScientificCat# NP0007
Chemical compound, drugNuPAGE Bis-Tris precast gelsThermo Fisher ScientificCat# NP0321
Chemical compound, drugPolyvinylidene difluoride membraneLi-Core BiosciencesCat# 88518
Chemical compound, drugOdyssey Blocking Buffer (TBS)Li-Core BiosciencesCat# 937–50003
Chemical compound, drugDextran sulfate sodiumMP BiomedicalCat# 0216011080
Chemical compound, drugAzoxymethaneSigmaCat# A5486
Chemical compound, drugDNase IThermo Fisher ScientificCat# 18068–015
Chemical compound, drugTRIzolThermo Fisher ScientificCat# 15596018
Chemical compound, drugSeahorse XF DMEM Medium pH 7.4Agilent TechnologiesCat# 103575–100
Chemical compound, drugSeahorse XF 100 mM pyruvate solutionAgilent TechnologiesCat# 103578–100
Chemical compound, drugSeahorse XF 200 mM glutamine solutionAgilent TechnologiesCat# 103579–100
Chemical compound, drugSeahorse XF 1.0 M glucose solutionAgilent TechnologiesCat# 103577–100
Chemical compound, drugZymogram Developing Buffer (10 X)Thermo Fisher ScientificCat# LC2671
Chemical compound, drugZymogram Renaturing Buffer (10 X)Thermo Fisher ScientificCat# LC2670
Chemical compound, drugTris-Glycine SDS Running Buffer (10 X)Thermo Fisher ScientificCat# LC2675
Chemical compound, drugTween 20Fisher ScientificCat# BP337
Software, algorithmImage Jhttps://imagej.net/RRID:SCR_003070
OtherDAPISigma-AldrichCat# D95421 µg/ml
OtherHoechstThermo Fisher ScientificCat# H35701 µg/ml
OtherIRDye 800CW Goat anti-MouseLi-Core BiosciencesCat# 925–322101:10000
OtherIRDye 800CW Donkey anti-RabbitLi-Core BiosciencesCat# 925–322131:5000
OtherMitoSox RedThermo Fisher ScientificCat# M36008
OtherMito TEMPOThermo Fisher ScientificCat# SML0737
OtherMito Tracker Green FMThermo Fisher ScientificCat# M7514
OtherMito Tracker Deep red FMCell Signaling TechnologyCat# 8778 S
OtherFura-2 AMThermo Fisher ScientificCat# F1221
OtherFluoroBlokCorningCat# 351152
OtherBioCoat Tumor Invasion PlateCorningCat# 80774380
OtherSYBER select master mixThermo Fisher ScientificCat# 4472920
OtherNovex 10% Zymogram Plus (Gelatin) Protein Gels, 1.0 mm, 10-wellThermo Fisher ScientificCat# ZY00100
OtherSimplyBlue Safe StainThermo Fisher ScientificCat# LC6060

The originally published Appendix 1—key resources table is shown for reference:

Appendix 1—key resources table

Reagent type(species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Homo sapiens)SLC8B1/NCLXGenBankGene ID: 80024
Gene Mus musculusSlc8b1/NCLXGenBankGene ID: 170756
Genetic reagent Mus musculusNOD.CB17-Prkdcscid/JJackson LaboratoryStock No: 010636, RRID:IMSR_JAX:010636Male
Cell line (Homo-sapiens)HCT116 (colon, epithelial)ATCCATCC# CCL-247Male
Cell line (Homo-sapiens)HT29 (colon, epithelial)ATCCATCC# HTB-38Female
Cell line (Homo-sapiens)DLD1 (colon, epithelial)ATCCATCC# CCL-221Male
Cell line (Homo-sapiens)HCT116 NCLX KO (colon, epithelial)This paperNCLX Knockout clones of HCT116 cells were generated by the Trebak lab using CRISPR/Cas9 and are available upon request
Cell line (Homo-sapiens)DLD1 NCLX KO (colon, epithelial)This paperNCLX Knockout clones of DLD1 cells were generated in the Trebak lab using CRISPR/Cas9 and are available upon request
Cell line (Homo-sapiens)HCT116 shNCLX KO (colon, epithelial)This paperHCT116 cells with stable shRNA-mediated knockdown of NCLX (shNCLX) were generated by the Trebak Lab using shRNA sequences (listed below in this table) cloned in the lentiviral vector pLKO. These plasmids are available upon request
Cell line (Homo-sapiens)DLD1 shNCLX KO (colon, epithelial)This paperDLD1 cells with stable shRNA-mediated knockdown of NCLX (shNCLX) were generated by the Trebak Lab using shRNA sequences (listed below in this table) cloned in the lentiviral vector pLKO. These plasmids are available upon request
Antibodyanti-Hif1α (Rabbit polyclonal)Cell Signaling TechnologyCat# 14,179 s, RRID:AB_2622225WB (1:500)
Antibodyanti- ALDOA (Rabbit polyclonal)Cell Signaling TechnologyCat# 8060 S, RRID:AB_2797635WB (1:1000)
Antibodyanti- HK2 (Rabbit polyclonal)Cell Signaling TechnologyCat# 2867 S, RRID:AB_2232946WB (1:1000)
Antibodyanti- LDHA (Rabbit polyclonal)Cell Signaling TechnologyCat# 2012 S, RRID:AB_2137173WB (1:1000)
Antibodyanti- MMP1 (Rabbit polyclonal)AbcamCat# ab38929, RRID:AB_776395WB (1:1000)
Antibodyanti- MMP2 (Mouse monoclonal)Santa Cruz BiotechnologyCat# sc-13594, RRID:AB_627956WB (1:500)
Antibodyanti- MMP9 (Rabbit polyclonal)AbcamCat# ab73734, RRID:AB_1860201WB (1:1000)
Antibodyanti- LC3B (Rabbit polyclonal)AbcamCat# ab51520, RRID:AB_881429WB (1:1000)
Antibodyanti- OXPHOS (Mouse monoclonal)AbcamCat# ab110413, RRID:AB_2629281WB (1:5000)
Antibodyanti- GAPDH (Mouse monoclonal)Millipore SigmaCat# MAB374, RRID:AB_2107445WB (1:10000)
Antibodyanti- HSC70 (Mouse monoclonal)Santa Cruz BiotechnologyCat# sc-24, RRID:AB_627760WB (1:5000)
Antibodyanti- p62 (Rabbit polyclonal)AbcamCat# ab109012, RRID:AB_2810880WB (1:1000)
Antibodyanti- cleaved caspase-3 (Rabbit polyclonal)Cell Signaling TechnologyCat# 9661 S, RRID:AB_2341188WB (1:1000), IF (1:500)
Antibodyanti- pAMPK (Rabbit polyclonal)Cell Signaling TechnologyCat# 2535 S, RRID:AB_331250WB (1:1000)
Antibodyanti- AMPK (Rabbit polyclonal)Cell Signaling TechnologyCat# 5831 S, RRID:AB_10622186WB (1:1000)
Antibodyanti- pS6K (Rabbit polyclonal)Cell Signaling TechnologyCat# 9234 S, RRID:AB_2269803WB (1:1000)
Antibodyanti- S6K (Rabbit polyclonal)Cell Signaling TechnologyCat# 2708 S, RRID:AB_390722WB (1:1000)
Sequence-based reagentSLC7A11_FThis paperRT-PCR primersAGGGTCACCTTCCAGAAATC
Sequence-based reagentSLC7A11_RThis paperRT-PCR primersGAAGATAAATCAGCCCAGCA
Sequence-based reagentGCLM _FThis paperRT-PCR primersCATTTACAGCCTTACTGGGAGG
Sequence-based reagentGCLM _RThis paperRT-PCR primersATGCAGTCAAATCTGGTGGCA
Sequence-based reagentFOX3_FThis paperRT-PCR primersCGGCTTCGGCTCTTAGCAAA
Sequence-based reagentFOX3_RThis paperRT-PCR primersCGGACAAACGGCTCACTCT
Sequence-based reagentNANOG _FThis paperRT-PCR primersTTTGTGGGCCTGAAGAAAACT
Sequence-based reagentNANOG _RThis paperRT-PCR primersAGGGCTGTCCTGAATAAGCAG
Sequence-based reagentOCT4_FThis paperRT-PCR primersTTCAGCCAAACGACCATCTG
Sequence-based reagentOCT4_RThis paperRT-PCR primersCACGAGGGTTTCTGCTTTGC
Sequence-based reagentSOX2_FThis paperRT-PCR primersGCCGAGTGGAAACTTTTGTCG
Sequence-based reagentSOX2_RThis paperRT-PCR primersGGCAGCGTGTACTTATCCTTCT
Sequence-based reagentGLUT1_FThis paperRT-PCR primersTATCGTCAACACGGCCTTCACT
Sequence-based reagentGLUT1_RThis paperRT-PCR primersAACAGCTCCTCGGGTGTCTTAT
Sequence-based reagentHK2_FThis paperRT-PCR primersGCCATCCTGCAACACTTAGGG
Sequence-based reagentHK2_RThis paperRT-PCR primersGTGAGGATGTAGCTTGTAGAGGGT
Sequence-based reagentGPI_FThis paperRT-PCR primersTGTGTTCACCAAGCTCACAC
Sequence-based reagentGPI_RThis paperRT-PCR primersGTAGAAGCGTCGTGAGAGGT
Sequence-based reagentALDOA_FThis paperRT-PCR primersAGGCCATGCTTGCACTCAG
Sequence-based reagentALDOA_RThis paperRT-PCR primersAGGGCCCAGGGCTTCAG
Sequence-based reagentENO1_FThis paperRT-PCR primersGACTTGGCTGGCAACTCTG
Sequence-based reagentENO1_RThis paperRT-PCR primersGGTCATCGGGAGACTTGAAG
Sequence-based reagentLDHA_FThis paperRT-PCR primersGGTTGGTGCTGTTGGCATGG
Sequence-based reagentLDHA_RThis paperRT-PCR primersTGCCCCAGCCGTGATAATGA
Sequence-based reagentMMP1_FThis paperRT-PCR primersATGCTGAAACCCTGAAGGTG
Sequence-based reagentMMP1_RThis paperRT-PCR primersGAGCATCCCCTCCAATACCT
Sequence-based reagentMMP2_FThis paperRT-PCR primersACCAGCTGGCCTAGTGATGATG
Sequence-based reagentMMP2_RThis paperRT-PCR primersGGCTTCCGCATGGTCTCGATG
Sequence-based reagentMMP9_FThis paperRT-PCR primersACGCACGACGTCTTCCAGTA
Sequence-based reagentMMP9_RThis paperRT-PCR primersCCACCTGGTTCAACTCACTCC
Sequence-based reagentqNCLX_1_FThis paperRT-PCR primersGCCAGCATTTGTGTCCATTT
Sequence-based reagentqNCLX_1_RThis paperRT-PCR primersAATTCGTCTCGGCCACTTAC
Sequence-based reagentqNCLX_2_FThis paperRT-PCR primersCCGGCAGAAGGCTGAATCTG
Sequence-based reagentqNCLX_2_RThis paperRT-PCR primersACCTTGCGGCAGTCTACCAC
Sequence-based reagentGAPDH_FThis paperRT-PCR primersGGGAAACCCATCACCATCTT
Sequence-based reagentGAPDH_RThis paperRT-PCR primersCCAGTAGACTCCACGACATACT
Sequence-based reagentG6PD_FThis paperRT-PCR primersCGAGGCCGTCACCAAGAAC
Sequence-based reagentG6PD_RThis paperRT-PCR primersGTAGTGGTCGATGCGGTAGA
Sequence-based reagentPGD_FThis paperRT-PCR primersATGGCCCAAGCTGACATCG
Sequence-based reagentPGD_RThis paperRT-PCR primersAAAGCCGTGGTCATTCATGTT
Sequence-based reagentTKT_FThis paperRT-PCR primersTCCACACCATGCGCTACAAG
Sequence-based reagentTKT_RThis paperRT-PCR primersCAAGTCGGAGCTGATCTTCCT
Sequence-based reagentg1This paperGuide RNA sequences (Figure 2A and Figure 3—figure supplement 1A)GCGCAGATTCAGCCTTCTGC
Sequence-based reagentg2This paperGuide RNA sequences (Figure 3—figure supplement 1B and C)GGGATACTCACGTCTACCAC
Sequence-based reagentg3This paperGuide RNA sequences (Figure 3—figure supplement 1E)GTAGACGTGAGTATCCCGGT
Sequence-based reagentg4This paperGuide RNA sequences (Figure 3—figure supplement 1E)ACCCACACCAGCAGTCCGTC
Sequence-based reagentshRNA (shNCLX#2)This paperFigure 3—figure supplement 1IGCCTTCTTGCTGTCATGCAAT
Sequence-based reagentshRNA (shNCLX#3)This paperFigure 3—figure supplement 1IGCTCCTCTTCTACCTGAACTT
Sequence-based reagentsiRNA (siNCLX)This paperFigure 4—figure supplement 1MAACGGCCCCUCAACUGUCUT
Sequence-based reagentNCLX_1This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)GCGTGCTGGTTACCACAG T
Sequence-based reagentNCLX_2This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)CCACGGAAGAGCATGAGGAA
Sequence-based reagentNCLX_3This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)ACTTAGCACATCGCCACCTG
Sequence-based reagentNCLX_4This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)CTGATCTGCACGCTGAATGG
Sequence-based reagentNCLX_5This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)GAGGTACACAGCAGTTCT CCC
Sequence-based reagentNCLX_6This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)CAGCTGGTGCCCTCAAACAC
Sequence-based reagentpx77This paperPCR primers for genotyping NCLX -/- miceTACAGTCTGGCTCGTTCC CT
Sequence-based reagentpx78This paperPCR primers for genotyping NCLX -/- miceCGGTCCCAGACGCCG T
Sequence-based reagentpx79This paperPCR primers for genotyping NCLX -/- miceCGCTGGGGTCCATCT TTG AT
Sequence-based reagentpx80This paperPCR primers for genotyping NCLX -/- miceTGGGTCTCCGGTCCCAGT A
Commercial assay or kitcDNA Reverse Transcription KitApplied biosystemsCat# 4368814
Commercial assay or kitSeahorse XFp Mito Fuel Flex Test KitAgilent TechnologiesCat# 103270–100
Commercial assay or kitSeahorse XFp Glycolysis Stress Test KitAgilent TechnologiesCat# 103017–100
Commercial assay or kitSeahorse XFp Cell Mito Stress Test KitAgilent TechnologiesCat# 103010–100
Commercial assay or kitBCA assay kitThermo Fisher ScientificCat# A53225
Commercial assay or kitTMREThermo Fisher ScientificCat# T669
Commercial assay or kitCyQUANTThermo Fisher ScientificCat# C35006
Chemical compound, drugAntibiotic and AntimycoticThermo Fisher ScientificCat# 15240062
Chemical compound, drugMcCoy’s 5 ACorningCat# 10-050CV
Chemical compound, drugRPMI-1640CorningCat# 10-040CV
Chemical compound, drugLipofectamine 2000Thermo Fisher ScientificCat# 11668019
Chemical compound, drugTrypLEThermo Fisher ScientificCat# 12605028
Chemical compound, drugCoCl2Sigma-AldrichCat# 15862
Chemical compound, drug2-deoxy-D-glucose (2-DG)Sigma-AldrichCat# D8375
Chemical compound, drug5-FluorouracilSigma-AldrichCat# F6627
Chemical compound, drugGlucoseSigma-AldrichCat# D9434
Chemical compound, drugPuromycinMP BiomedicalCat# 02100552
Chemical compound, drugRIPA bufferSigmaCat# R0278
Chemical compound, drugATPSigmaCat# A9187
Chemical compound, drugDextroseFisher ScientificCat# D14
Chemical compound, drugTris BaseFisher ScientificCat# BP152-5
Chemical compound, drugNaClFisher ScientificCat# S671
Chemical compound, drugMOPS SDS running bufferThermo Fisher ScientificCat# NP0001
Chemical compound, drugTris-Glycine transfer bufferBio-radCat#161–0734
Chemical compound, drugKClFisher ScientificCat# P217
Chemical compound, drugMgCl2Fisher ScientificCat# M33
Chemical compound, drugCaCl2Fisher ScientificCat# C614
Chemical compound, drugHEPESFisher ScientificCat# BP310
Chemical compound, drugLDS sample bufferThermo Fisher ScientificCat# NP0007
Chemical compound, drugNuPAGE Bis-Tris precast gelsThermo Fisher ScientificCat# NP0321
Chemical compound, drugPolyvinylidene difluoride membraneLi-Core BiosciencesCat# 88518
Chemical compound, drugOdyssey Blocking Buffer (TBS)Li-Core BiosciencesCat# 937–50003
Chemical compound, drugDextran sulfate sodiumMP BiomedicalCat# 0216011080
Chemical compound, drugAzoxymethaneSigmaCat# A5486
Chemical compound, drugDNase IThermo Fisher ScientificCat# 18068–015
Chemical compound, drugTRIzolThermo Fisher ScientificCat# 15596018
Chemical compound, drugSeahorse XF DMEM Medium pH 7.4Agilent TechnologiesCat# 103575–100
Chemical compound, drugSeahorse XF 100 mM pyruvate solutionAgilent TechnologiesCat# 103578–100
Chemical compound, drugSeahorse XF 200 mM glutamine solutionAgilent TechnologiesCat# 103579–100
Chemical compound, drugSeahorse XF 1.0 M glucose solutionAgilent TechnologiesCat# 103577–100
Chemical compound, drugZymogram Developing Buffer (10 X)Thermo Fisher ScientificCat# LC2671
Chemical compound, drugZymogram Renaturing Buffer (10 X)Thermo Fisher ScientificCat# LC2670
Chemical compound, drugTris-Glycine SDS Running Buffer (10 X)Thermo Fisher ScientificCat# LC2675
Chemical compound, drugTween 20Fisher ScientificCat# BP337
Software, algorithmImage Jhttps://imagej.net/RRID:SCR_003070
OtherDAPISigma-AldrichCat# D95421 µg/ml
OtherHoechstThermo Fisher ScientificCat# H35701 µg/ml
OtherIRDye 800CW Goat anti-MouseLi-Core BiosciencesCat# 925–322101:10000
OtherIRDye 800CW Donkey anti-RabbitLi-Core BiosciencesCat# 925–322131:5000
OtherMitoSox RedThermo Fisher ScientificCat# M36008
OtherMito TEMPOThermo Fisher ScientificCat# SML0737
OtherMito Tracker Green FMThermo Fisher ScientificCat# M7514
OtherMito Tracker Deep red FMCell Signaling TechnologyCat# 8778 S
OtherFura-2 AMThermo Fisher ScientificCat# F1221
OtherFluoroBlokCorningCat# 351152
OtherBioCoat Tumor Invasion PlateCorningCat# 80774380
OtherSYBER select master mixThermo Fisher ScientificCat# 4472920
OtherNovex 10% Zymogram Plus (Gelatin) Protein Gels, 1.0 mm, 10-wellThermo Fisher ScientificCat# ZY00100
OtherSimplyBlue Safe StainThermo Fisher ScientificCat# LC6060

Supplementary file 1: Genomic sequencing of NCLX KO clones of HCT116 and DLD1 cells.

Description: This file shows the genome sequencing of NCLX KO clones #33, #37, and #59 of HCT116 and #06, #24, and #32 of DLD1 cells. For genomic sequencing, PCR was performed to amplify specific parts of the NCLX gene using primers listed in the key resources table. The primers used for cloning genomic DNA from HCT116 cells were PX75 NCLX test F and PX76 NCLX test R. The primers used for cloning genomic DNA from DLD1 cells were NCLX_4 and NCLX_5. PCR products were cloned using StrataClone Blunt PCR Cloning Kit and sent to Genewiz for sanger sequencing. The genome sequencing data for the HCT116 NCLX KO clones confirm the introduction of STOP codons in coding sequences of HCT116 NCLX KO #33 at predicted positions 181–183 bp and 184–186 bp, in HCT116 NCLX KO #37 at 16–18 bp and 46–48 bp, and in HCT116 NCLX KO #59 at 31–33 bp, and 52–54 bp. Furthermore, the genomic sequencing of NCLX KO clones of DLD1 cells showed that the middle ~32 kb portion of the NCLX gene was deleted in all clones. Therefore, providing decisive evidence that these cells are indeed NCLX KO.

The corrections do not change any of the scientific conclusions of the figures or the manuscript. We sincerely apologize for the mistakes and the confusion it may have caused.

The article has been corrected accordingly.

Article and author information

Author details

  1. Trayambak Pathak

  2. Maxime Gueguinou

  3. Celine Delierneux

  4. Martin T Johnson

  5. Xuexin Zhang

  6. Ping Xin

  7. Ryan E Yoast

  8. Scott M Emrich

  9. Gregory S Yochum

  10. Walter A Koltun

  11. Donald L Gill

  12. Nadine Hempel

Version history

  1. Version of Record published:

Copyright

© 2023, Pathak et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 296
    views
  • 1
    citation

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Citations by DOI

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Trayambak Pathak
  2. Maxime Gueguinou
  3. Vonn Walter
  4. Celine Delierneux
  5. Martin T Johnson
  6. Xuexin Zhang
  7. Ping Xin
  8. Ryan E Yoast
  9. Scott M Emrich
  10. Gregory S Yochum
  11. Israel Sekler
  12. Walter A Koltun
  13. Donald L Gill
  14. Nadine Hempel
  15. Mohamed Trebak
(2023)
Correction: Dichotomous role of the human mitochondrial Na+/Ca2+/Li+ exchanger NCLX in colorectal cancer growth and metastasis
eLife 12:e86471.
https://doi.org/10.7554/eLife.86471

Share this article

https://doi.org/10.7554/eLife.86471