A simple mechanism for integration of quorum sensing and cAMP signalling in Vibrio cholerae
- School of Biosciences, University of Birmingham, United Kingdom
- Department of Biology, Indiana University, United States
Figures
Figure 1 with 2 supplements
Genome-wide distribution of HapR and LuxO in Vibrio cholerae.
(a) Simplified schematic overview of quorum sensing in Vibrio cholerae. At low cell density, expression of HapR is repressed by the Qrr sRNAs that depend on phosphorylated LuxO for activation of their transcription. Arrows indicate activation and bar ended lines indicate repression. For clarity, not all protein factors involved in the cascade have been included. (b) Binding of LuxO and HapR across both Vibrio cholerae chromosomes. In each plot the outer two tracks (blue) are genes orientated in the forward or reverse direction. The LuxO and HapR ChIP-seq binding signals are shown in red and green. LuxO binding peaks corresponding to the qrr1-4 loci are indicated. Tick marks are 0.25 Mbp apart. (c) Example LuxO and HapR ChIP-seq binding peaks. ChIP-seq coverage plots are shown for individual experimental replicates. Data for LuxO and HapR are in green and red respectively. Signals above or below the horizontal line correspond to reads mapping to the top or bottom strand respectively. Gene are show as block arrows. (d) Sequence motifs derived from LuxO and HapR binding peaks using MEME. (e) Positions of LuxO and HapR binding peaks with respect to genes. The histograms show the distribution of binding peak centres with respect to the start codon of the nearest gene. (f) Pie charts showing gene classes targeted by LuxO and HapR.
Figure 1—figure supplement 1
Binding of LuxO and the qrr1 and VC1142 loci.
(a) ChIP-seq coverage plots for individual experimental replicates. Signals above or below the horizontal line correspond to reads mapping to the top or bottom strand respectively. (b) Sequence of the intergenic region between VC1142 and VC1143. The LuxO target site is shown in red. Start codons for the divergent genes VC1142 and VC1143 are in green. Transcription start sites identified by Papenfort et al., 2015 are in uppercase with arrows indicating the direction of transcription. Underlined sequences are potential promoter –10 elements for the housekeeping RNA polymerase assuming a minimal requirement for the sequence 5'-TANNNT-3'.
Figure 1—figure supplement 2
Example HapR binding signals.
(a) Binding peaks for HapR that fall above our cut-off for peak selection. The HapR ChIP-seq binding profiles are shown in green and genes are shown as blue arrows. (b) Binding peaks for HapR, at known targets, that fall below our cut-off for peak selection. Binding signals for HapR are shown at known target genes. These peaks for not selected by our analysis because the signal was too weak and/or insufficiently reproducible.
Figure 2
HapR is a direct repressor of transcription at many target promoters.
(a) Activity of HapR targeted promoters in the presence and absence of HapR in vivo. The promoter regions of HapR targeted genes were fused to lacZ in plasmid pRW50T and constructs used to transform required bacterial strains. β-galactosidase activity was measured in cell lysates taken from Vibrio cholerae E7946 (bars) or the ΔhapR derivative (open bars). containing the VC0857 promoter cloned upstream of lacZ. Standard deviation is shown for three independent biological replicates. Cells were grown in LB-Lennox medium at 37 °C to an OD650 of ~1.1. Promoters were classified as inactive if, in both the presence and absence of HapR, β-galactosidase activity was <2 fold higher than the equivalent no insert control. We have labelled promoters with gene names or locus tags as most appropriate. Note that the Table 1 footnote can be used to cross reference between locus tags and gene names where relevant. (b) Activity of HapR targeted promoters in the presence and absence of HapR in vitro. The gel images show results of in vitro transcription experiments. The DNA templates were plasmid pSR derivatives containing the indicated regulatory regions. Experiments were done with 0.4 µM RNA polymerase in the presence (0.25, 0.75, 1.0, 3.0, or 5.0 µM) and absence of HapR. Except for the VC1375 promoter, where the maximum HapR concentration was 3.0 µM. The RNAI transcript is plasmid-derived and acts as an internal control. Expected transcript sizes, based on results from global transcription start site mapping experiments (Papenfort et al., 2015), are indicated. Note that no VC1403 transcript was detected in this prior study (Papenfort et al., 2015).
-
Figure 2—source data 1
Gel image TIFF file, Figure 2b.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig2-data1-v1.pdf
-
Figure 2—source data 2
Gel image TIFF file, Figure 2b.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig2-data2-v1.pdf
-
Figure 2—source data 3
Gel image TIFF file, Figure 2b.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig2-data3-v1.pdf
-
Figure 2—source data 4
Gel image TIFF file, Figure 2b.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig2-data4-v1.pdf
-
Figure 2—source data 5
Gel image TIFF file, Figure 2b.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig2-data5-v1.pdf
-
Figure 2—source data 6
Gel image TIFF file, Figure 2b.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig2-data6-v1.pdf
-
Figure 2—source data 7
Original gel images.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig2-data7-v1.pdf
Figure 3
Transcription from the murQP promoter requires CRP in vivo and in vitro.
(a) HapR binding to the murQP regulatory region. Genes are shown as block arrows. ChIP-seq coverage plots are shown for individual experimental replicates. Signals above or below the horizontal line correspond to reads mapping to the top or bottom strand respectively. (b) DNA sequence of the intergenic region upstream of murQP. For clarity, numbering is with respect to the murQP transcription start site (TSS,+1). The TSS and promoter –10 element are in bold. The murQ start codon is in blue. The HapR binding site, predicted by MEME analysis of our ChIP-seq data for HapR, is in green. A potential CRP site is embedded within the HapR binding sequence (orange). Sequences in red indicate point mutations used in this work. Triangles show sites of truncation. (c) Binding of CRP to the murQP regulatory region and derivatives. Electrophoretic mobility shift assays showing migration of the murQP regulatory region, or indicated derivatives, with or without 0.1 µM CRP. The DNA fragment used is shown above each pair of lanes and correspond to the truncations or point mutations indicated in panel b. (d) The murQP promoter is activated by CRP in vitro. The gel image shows the result of an in vitro transcription assay. The DNA template was plasmid pSR carrying the murQP regulatory region. Experiments were done with 0.4 µM RNA polymerase with or without 0.125, 0.25, or 0.5 µM CRP. The RNAI transcript is plasmid-derived and acts as an internal control. (e) The murQP promoter is activated by CRP in vivo. The bar chart shows results of β-galactosidase activity assays. Cell lysates were obtained from wild type V. cholerae E7946 (solid green) or the Δcrp derivative, transformed with pRW50T derivatives containing the indicated promoter derivatives fused to lacZ. Standard deviation is shown for three independent biological replicates. Cells were grown in LB-Lennox medium at 37 °C to an OD650 of ~1.1.
-
Figure 3—source data 1
Gel image TIFF file, Figure 3c.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig3-data1-v1.pdf
-
Figure 3—source data 2
Gel image TIFF file, Figure 3c.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig3-data2-v1.pdf
-
Figure 3—source data 3
Gel image TIFF file, Figure 3d.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig3-data3-v1.pdf
Figure 4 with 1 supplement
HapR and CRP co-operatively bind the same section of murQP regulatory DNA.
(a) Binding locations of HapR and CRP upstream of murQP. The gel shows the result of DNase I footprinting experiment. The gel is calibrated with Sanger sequencing reactions. The pattern of DNase I cleavage in the absence of any proteins is in lane 1. Protection of DNA from DNase I cleavage in the presence of 0.11, 0.23 or 0.45 µM CRP is shown in lanes 2–4. Sites of DNAse I hypersensitivity due to CRP binding are indicated by orange triangles. Protection from DNase I cleavage in the presence of 0.5, 1.0, 2.0 or 3.0 µM HapR is shown in lanes 5–8. Protection from DNase I cleavage, dependent on HapR, is shown by a green bar. A DNAse I hypersensitive band, unique to reactions with HapR, is shown by a green triangle. In the presence of 0.45 µM CRP, increasing concentrations of HapR result in a different DNAse I cleavage pattern, including the appearance of a different site of hypersensitivity (black triangle). (b) Binding of HapR and CRP upstream of murQP is co-operative. Electrophoretic mobility shift assays showing migration of the murQP regulatory region with different combinations of CRP (0.025, 0.05, 0.1 or 0.2 µM) and HapR (0.5, 1.0, 2.0, 3.0 or 4.0 µM). For incubations with both factors, the same range of HapR concentrations was used with 0.2 µM CRP. (c) Co-operative binding of CRP requires the shared HapR and CRP binding site. Results of an electrophoretic mobility shift assay, using the wild type murQP regulatory region or a derivative with two point mutations in the shared recognition sequence, for HapR (4.0 µM) and CRP (0.1 µM). Positions of mutations are shown in Figure 3b. (d) HapR blocks CRP mediated activation of the murQP promoter in vitro. The gel image shows the result of an in vitro transcription assay. The DNA template was plasmid pSR carrying the murQP regulatory region. Experiments were done with 0.4 µM RNA polymerase, with or without 0.05, 0.1, 0.2 or 0.5 µM CRP 0.5, 1.0, 2.0 or 3.0 µM HapR, as indicated. The RNAI transcript is plasmid-derived and acts as an internal control. (e) HapR represses CRP mediated activation of the murQP promoter in vivo. β-galactosidase activity was measured in cell lysates taken from Vibrio cholerae E7946 (solid green bars), ΔhapR derivative (open green bars), Δcrp variant (open orange bars), or cells lacking both factors (orange outline with green patterned fill). Standard deviation is shown for three independent biological replicates. Cells were grown in LB-Lennox medium to an OD650 of ~1.0 at 37 °C.
-
Figure 4—source data 1
Gel image TIFF file, Figure 4a.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig4-data1-v1.pdf
-
Figure 4—source data 2
Gel image TIFF file, Figure 4b.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig4-data2-v1.pdf
-
Figure 4—source data 3
Gel image TIFF file, Figure 4c.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig4-data3-v1.pdf
-
Figure 4—source data 4
Gel image TIFF file, Figure 4c.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig4-data4-v1.pdf
-
Figure 4—source data 5
Gel image TIFF file, Figure 4d.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig4-data5-v1.pdf
Figure 4—figure supplement 1
Binding of HapR to the hapR promoter region in the presence and absence of CRP.
Electrophoretic mobility shift assay showing migration of the hapR regulatory region with different combinations of CRP (0.0125, 0.025, 0.05, or 0.1 µM) and HapR (0.0625, 0.125, 0.25, or 0.5 µM). For incubations with both factors, the same range of HapR concentrations was used with 0.1 µM CRP.
-
Figure 4—figure supplement 1—source data 1
Gel image TIFF file.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig4-figsupp1-data1-v1.pdf
Figure 5 with 4 supplements
HapR contacts Activation Region 3 of CRP.
(a) Binding sites for CRP and HapR are optimally aligned when offset by one base pair. The panel shows DNA sequences logos generated by aligning binding sites identified by ChIP-seq analysis for CRP (top) and HapR (bottom). The centre of each motif is indicated by a dashed line. (b) Global overlap of CRP and HapR binding sites. A position weight matrix (PWM), corresponding to each DNA sequence logo shown in panel a, was created. The PWMs were used to search the V. cholerae genome sequence using FIMO. Distances between the identified CRP and HapR sites were calculated. Proximal sites were always overlapping and offset by one base pair (top panel). Overlap was greatly reduced when the analysis was applied to a randomised version of the same genome sequence (bottom panel). (c) Model of the DNA-CRP-HapR complex. The model was generated using PDB submissions 6pb6 (E. coli CRP in complex with a class II CRP dependent promoter) and 1jt0 (S. aureus QacR bound to its DNA target). Note that QacR is closely related to V. cholerae HapR. The structures were aligned so that the CRP and HapR binding centres were offset by one base pair. Residue E55 of CRP (blue) is within Activating Region 3 of CRP that can interact with the RNA polymerase sigma subunit at class II promoters. HapR residue R123 (red) participates in HapR dimerisation and is proximal to E55 of CRP. (d) Side chain E55 of CRP is required for stability of the DNA-CRP-HapR complex. Electrophoretic mobility shift assays showing migration of the murQP regulatory region with different combinations of CRP or CRPE55A (0.15, 0.3, or 0.6 µM) and HapR (0.083, 0.125, 0.166, 0.208, or 0.25 µM). (e) HapR cannot repress transcription activated by CRPE55A. Result of an in vitro transcription assay. The DNA template was plasmid pSR carrying the murQP regulatory region. Experiments were done with 0.4 µM RNA polymerase, with or without 0.05, 0.1, 0.2, or 0.5 µM CRP or CRPE55A and 0.5, 1.0, 2.0, or 3.0 µM HapR, in the presence of 0.2 µM CRP, as indicated. The RNAI transcript is plasmid-derived and acts as an internal control.
-
Figure 5—source data 1
Gel image TIFF file, Figure 5c.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig5-data1-v1.pdf
-
Figure 5—source data 2
Gel image TIFF file, Figure 5e.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig5-data2-v1.pdf
Figure 5—figure supplement 1
Global overlap of CRP and HapR binding sites in Vibrio harveyi.
A position weight matrix (PWM), corresponding to each DNA sequence logo shown in Figure 5a, was created. The PWMs were used to search the V. harveyi genome sequence (strain ATCC 33843) using FIMO. Distances between the identified CRP and HapR sites were calculated. Proximal sites were always overlapping and offset by one base pair (top panel). Overlap was greatly reduced when the analysis was applied to a randomised version of the same genome sequence (bottom panel).
Figure 5—figure supplement 2
Models of the DNA-CRP and DNA-CRP-HapR complexes.
The models were generated using PDB submissions 6pb6 (E. coli CRP in complex with a class II CRPdependent promoter) and 1jt0 (S. aureus QacR bound to its DNA target). The DNA is shown in grey and positions hypersensitive to DNAse I cleave, in the context of the DNA-CRP complex, are highlighted red (Figure 4a). DNA position –34 is not cleaved by DNAse I in the context of the ternary DNA-CRP-HapR complex (Figure 4a). Consistent with this, position –34 is obscured by HapR binding.
Figure 5—figure supplement 3
Binding of CRP and HapR derivatives to PmurQP.
The figures shows results of electrophoretic mobility shift assays with CRP and derivatives (0.1, 0.2, 0.4, or 0.8 µM) or HapR and derivatives (0.25, 0.5, 1.0, 2.0, or 4.0 µM).
-
Figure 5—figure supplement 3—source data 1
Gel image TIFF file.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig5-figsupp3-data1-v1.pdf
-
Figure 5—figure supplement 3—source data 2
Gel image TIFF file.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig5-figsupp3-data2-v1.pdf
Figure 5—figure supplement 4
Co-operative DNA binding of HapR and CRP is common.
Electrophoretic mobility shift assays showing migration of the indicated regulatory regions with different combinations of CRP (1 µM) and HapR (0.19 µM). For VCA0691 the concentration of HapR was 0.57 µM.
-
Figure 5—figure supplement 4—source data 1
Gel image TIFF file.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig5-figsupp4-data1-v1.pdf
-
Figure 5—figure supplement 4—source data 2
Gel image TIFF file.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig5-figsupp4-data2-v1.pdf
-
Figure 5—figure supplement 4—source data 3
Gel image TIFF file.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig5-figsupp4-data3-v1.pdf
-
Figure 5—figure supplement 4—source data 4
Gel image TIFF file.
- https://cdn.elifesciences.org/articles/86699/elife-86699-fig5-figsupp4-data4-v1.pdf
Figure 6
Control of murQP expression by CRP and HapR at low and high cell density.
(a) V. cholerae locked at high cell density are defective for growth using MurNAc as the sole carbon source. Each panel illustrates the optical density of V. cholerae cultures at different timepoints after inoculation. Cells were grown at 32 °C in M9 minimal media supplemented with the indicated carbon source (0.25 % w/v) or LB-Miller medium. Cells lacking luxO, but not luxO and hapR, mimic the high cell density state. Error bars show standard deviation from three separate experimental replicates. (b) Model for coordination of MurNAc catabolism by CRP and HapR. In low V. cholerae population density conditions (left panel) cell division necessitates cell wall turnover. Expression of MurQP facilitates cell wall recycling and conversion of MurNAc to GlcNAc 6 P for glycolysis (insert). At high cell density conditions (right panel) V. cholerae form biofilms on chitinous surfaces. Reduced cell division, and the availability of chitin derived GlcNAc 6 P, reduces the need for MurQP.
Tables
Table 1
Locations of binding peaks from ChIP-seq experiments.
| peak centre | gene(s)* | site location | site sequence | TSS† |
|---|---|---|---|---|
| HapR ChIP-seq peaks | ||||
| chromosome I | ||||
| 99874 | VC0102<(VC0103) | 99863.5 | aaattaataaaactgtcattta | 99906 (+) |
| 213457 | (VC0205)>VC0206 | 213452.5 | taattgtgattcttatcaccaa | 213494 (+) |
| 246366 ‡ | VC0240<>VC0241 | 246349.5 | taattaagatggctataaacta | 246430 (-) |
| 463584 | VC0433 | |||
| 514422 | VC0484 | 514430.5 | ctactgaccttttcatcaataa | 514427 (+) |
| 516570 | (VC0486) | 516601.5 | caactgagaaggcacacaatag | 516545 (+) |
| 534714 | (VC0502) | 534691.5 | ctattataagctctatcagtgt | 534805 (-) |
| 547108 | VC0515 | 547135.5 | atagtaatattattgttaatag | 549431 (-) |
| 613328 § | VC0583A | 613357.5 | ttattgagtgggtacataacaa | 613427 (+) |
| 716707 | VC0668 | 716625.5 | ctattgatgaggttatccacag | 716537 (-) |
| 735309 | VC0687<>VC0688 | |||
| 882854 | (VC0822) | 882825.5 | taattatccactttatcaattg | 883072 (-) |
| 941187 | VC0880 | 941164.5 | cttttgacatttctgtcacaaa | 941152 (+) |
| 978577 | VC0916R | 978540.5 | taattaatatccagctcaatta | 978581 (+) |
| 1356743 | VC1280<>VC1281A | 1356736.5 | atattgatagaaataacaagtc | 1356896 (+) |
| 1379202 | VC1298<>VC1299 | 1379180.5 | ttcatgatagttttgtaattat | 1379189 (+) |
| 1469384 | VC1375<>VC1376 | 1469377.5 | atattgatatatcacacatctt | 1469374 (+) |
| 1496023 | VC1403A<>VC1405 | 1496025.5 | tagttgatatttttataattgt | 1495942 (+) |
| 1533842 | (VC1437) | 1533854.5 | tttgtgagtctcctgtcaataa | 1533703 (-) |
| 1990133 ¶ | VC1851 | 1990076.5 | atattgagtaatcaattagtaa | 1990031 (+) |
| 2364721 | (VC2212) | 2364680.5 | ctattaacagttttatttataa | 2364774 (+) |
| 2509878 | VC2352 | 2509882.5 | ttagtgacagatgcgtcattaa | 2509790 (-) |
| 2667349 | VC2486 | 2667368.5 | taattattaatttgaacaatag | 2667206 (-) |
| chromosome II | ||||
| 163808 | VCA0148 | 163810.5 | taattgattattgtgtaactat | 163852 (-) |
| 214589 | (VCA0198) | 214582.5 | taattgataactttgacagtat | 213494 (+) |
| 237008 | VCA0218<>VCA0219R | 237019.5 | taaataatatgaatatcagtaa | 237053 (+) |
| 247286 | VCA0224<>VCA0225 | 247241.5 | taaatgactaataagacaatta | 247165 (-) |
| 598444 | VCA0691A | 598403.5 | tttgtaataaatttgtcattaa | 598413 (+) |
| 630517 | VCA0691A | 630559.5 | ctattaacaggactgacattaa | 631303 (+) |
| 862737 | VCA0906 | |||
| 910196 | VCA0960R<>VCA0961 | 910181.5 | ctgattataaatttgtaaatat | 910330 (+) |
| 1021174 | VCA1070 | 1021117.5 | ctcctatccgattggtcactat | 1021326 (+) |
| LuxO ChIP-seq peaks chromosome I | ||||
| 1090129 | qrr1<>VC1021 | 1090154 | ttgcaaaatgcaa | 1090182 (+) |
| 1212442 | VC1142<>VC1143 | 1212435 | ttgcaaatcgcga | 1212403 (-) |
| chromosome II | ||||
| 48415 | qrr2 | 48347 | ttgcaatttgcaa | 48851 (-) |
| 772208 | qrr3 | 772149 | ttgcattttgcaa | 772227 (+) |
| 908445 | qrr4 | 908436 | ttgcaatttgcaa | 908475 (+) |
-
*
Identified as activated (A) or repressed (R) by Nielsen et al., 2006, VC0206, VC0240, VC0241, VC0583, VC0668, VC0916, VC1021, VC1142, VC1143, VCA0219 correspond to murQ, rfaD, rfbA, hapR, mutH, vpsU, luxO, cspD, clpS, hlyA respectively.
-
†
Nearest transcription start site (TSS) identified by Papenfort et al., 2015 with the symbol in parenthesis indicating the direction of transcription. Note that these are not necessarily those TSSs subject to regulation by HarR or LuxO, particularly if the regulators are acting as repressors, or if the gene subject to regulation is switched off for another reason in the conditions of Papenfort et al.
-
‡
Identified by Tsou and co-workers (Tsou et al., 2009).
-
§
Identified by Lin and co-workers (Lin et al., 2005).
-
¶
Identified by Waters and co-workers (Waters et al., 2008).
Additional files
-
Supplementary file 1
HapR binding targets identified by previous studies.
- https://cdn.elifesciences.org/articles/86699/elife-86699-supp1-v1.pdf
-
Supplementary file 2
Strains, plasmids, and oligonucleotides.
- https://cdn.elifesciences.org/articles/86699/elife-86699-supp2-v1.pdf
-
MDAR checklist
- https://cdn.elifesciences.org/articles/86699/elife-86699-mdarchecklist1-v1.pdf
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
A simple mechanism for integration of quorum sensing and cAMP signalling in Vibrio cholerae
eLife 12:RP86699.
https://doi.org/10.7554/eLife.86699.3
