A generic binding pocket for small molecule IKs activators at the extracellular inter-subunit interface of KCNQ1 and KCNE1 channel complexes
- Department of Anesthesiology, Pharmacology and Therapeutics, University of British Columbia, Canada
- Laboratory of Computational Modeling of Biological Processes, Institute of Molecular Biology, Armenia
- Molecular Neuroscience Group, Institute of Molecular Biology, Armenia
Figures
Figure 1
K41C-KCNE1 mutants prevent the agonist effect of mefenamic acid.
(A) Current traces of WT EQ (top) and K41C-EQ (bottom) in the presence of 100 µM mefenamic acid (Mef). A 4 s protocol was used with pulses from –150 mV or higher to +100 mV, in 10 mV steps, followed …
Figure 2 with 4 supplements
MD prediction of mefenamic acid binding site in the ps-IKs model.
(A) Pseudo-KCNE1 (ps-KCNE1) used to predict Mef binding site. Extracellular residues of KCNE1 (top), ps-KCNE1 (middle) and KCNE3 (bottom). Below, cartoon topology of the single transmembrane …
Figure 2—figure supplement 1
Drug docking and MD simulation workflow.
Schematic representation of the general workflow for construction of ps-IKs, Mef docking to the model ps-IKs channel complex, and MD simulations (See Materials and methods).
Figure 2—figure supplement 2
Energy decomposition per amino acid for mefenamic acid binding to ps-IKs.
Poisson-Boltzmann Surface Area (MM/PBSA; blue) and Generalized Born Surface Area (MM/GBSA; orange) methods were used to estimate the interaction free energy contribution of each residue in the …
Figure 2—figure supplement 3
Clustering of MD trajectories based on mefenamic acid conformations.
(A) The clustering dendrogram based on Mef RMSD illustrates the similarity of Mef conformations in MD trajectories. (B) Centroids from each cluster with the lowest RMSD compared to all other …
Figure 2—figure supplement 4
H-bonds formed between mefenamic acid and protein residues in its binding site during MD simulations.
MEF-N1 indicates the nitrogen of aminobenzoic acid; MEF:O1 and O2 are the oxygens of the aminobenzoic acid. Red lines indicate at which time point and between which atoms H-bond were formed.
Figure 3 with 2 supplements
Current waveform and G-V changes induced by mefenamic acid in binding site mutants.
(A) Current traces from WT EQ and key residue mutants in control (black) and 100 µM Mef (colors). (B) EQ-W323A and (C) EQ-Y148C current traces in control (top) and presence of 100 μM Mef (below). …
Figure 3—figure supplement 1
Current waveform and G-V changes induced by mefenamic acid for all binding site mutants.
(A)-(H) current traces in control (above) and presence of 100 μM Mef (below) and G-V plots for binding site mutants, as indicated. Cells were held at –80 mV, then pulsed from –90 mV to +100 mV for 4 …
Figure 3—figure supplement 2
Augmented activation of EQ-L142C in the absence of mefenamic acid.
(A) EQ-L142C current traces in control solutions. Voltage steps were from –130 mV or higher in 10 mV steps to +100 mV for 4 s, followed by a repolarization step to –40 mV for 1 s. Holding potential …
Figure 4 with 2 supplements
K41C, Y46C, and W323A mutant impact on mefenamic acid binding energy and flexibility of external KCNE1 residues.
(A) Average free interaction energy of Mef-bound ps-IKs complexes calculated using MM/GBSA methods from three independent MD simulation runs. For K41C and W323A mutations, calculations correspond to …
Figure 4—figure supplement 1
Root-mean-square deviations (RMSD) of mefenamic acid from its initial position during MD simulations.
(A) ps-IKs, (B) K41C, (C) W323A, and (D) Y46C-IKs mutants in the presence of mefenamic acid. Each color represents an individual simulation run, five in each case. Note that time scale in (A) is 2.5 …
Figure 4—figure supplement 2
Result of loss of mefenamic acid from the binding site.
The binding pocket viewed from above (left) and the side (right) during a 1250 ns MD simulation before drug detachment (grey superimposed structure) and after (red superimposed structure). Mefenamic …
Figure 5
Effect of DIDS on IKs.
(A) Molecular structure of mefenamic acid and DIDS. (B) WT EQ current in control (black) and exposed to 100 µM DIDS over time (grey). Pulses were from –80 to +60 mV every 15 s, and current traces …
Figure 6 with 3 supplements
Ligand interaction and energy decomposition per amino acid for DIDS binding to ps-IKs.
(A) Binding pose of DIDS (yellow) in the external region of the ps-IKs channel complex obtained with molecular docking (side view). The residues of the pore domain are colored in blue, ps-KCNE1 …
Figure 6—figure supplement 1
H-bonds formed between DIDS and protein residues in its binding site during MD simulations.
DDS:O1-O6 are the oxygens of the sulfonic acids; DDS:N1 and N2 are nitrogens of the isothiocyanates. Red lines indicate at which time point and between which atom H-bonds were formed.
Figure 6—figure supplement 2
Clustering of MD trajectories based on DIDS conformations.
(A) The clustering dendrogram based on RMSD illustrates the similarity of DIDS conformations in MD trajectories. (B) Centroids from each cluster with the lowest RMSD compared to all other …
Figure 6—figure supplement 3
Root-mean-square deviations (RMSD) of DIDS from its initial position during MD simulations.
(A) ps-IKs, and mutations, (B) K41C, (C) W323A, and (D) Y46C complexes. Individual runs are shown in separate colors, n=5 for each.
Figure 7 with 1 supplement
Binding site mutants important for the action of DIDS.
(A) Current traces from WT EQ and key mutants in the absence (control; black) and presence (colors) of 100 µM DIDS. (B) Data and G-V plots in control (black) and DIDS (teal). Boltzmann fits were: …
Figure 7—figure supplement 1
Current waveform and G-V changes induced by DIDS for all binding site mutants.
(A-E) current traces in control (top) and presence of 100 μM DIDS (bottom). For binding site mutants, cells were held at –80 mV, then pulsed to between –90 mV and +100 mV for 4 s followed by –40 mV …
Figure 8
Subtle differences in activator binding to Y46C- and A44C-ps-IKs mutant channels.
(A) Mefenamic acid bound to the ps-IKs channel. Residues that are part of the binding site are shown in stick format colored green, except those residues that were important in the WT channel that …
-
Figure 8—source data 1
Source data for Figure 8A.
- https://cdn.elifesciences.org/articles/87038/elife-87038-fig8-data1-v1.zip
-
Figure 8—source data 2
Source data for Figure 8B.
- https://cdn.elifesciences.org/articles/87038/elife-87038-fig8-data2-v1.zip
Author response image 1
Videos
Video 1
MD simulations at the molecular level of binding of mefenamic acid to ps-IKs, and K41C-, W323A-, Y46C- ps-IKs mutants.
Note that videos may be shorter than the actual 500 ns simulations if drugs do not remain bound. Mefenamic acid binding to ps-IKs. W323, and K41 side chains are shown.
Video 2
Mefenamic acid binding to K41C ps-IKs.
K41C, W323, and Y46 side chains are shown.
Video 3
Mefenamic acid binding to W323A ps-IKs.
K41, W323A, and Y46 side chains are shown.
Video 4
Mefenamic acid binding to Y46C ps-IKs.
K41, W323, and Y46C side chains are shown.
Video 5
MD simulations at the molecular level of binding of DIDS to ps-IKs, and K41C-, W323A-, Y46C- ps-IKs mutants.
DIDS binding to ps-IKs. K41, W323, and Y46 side chains are shown.
Video 6
DIDS binding to K41C ps-IKs.
K41C, W323, and Y46 side chains are shown.
Video 7
DIDS binding to W323A ps-IKs.
K41, W323A, and Y46 side chains are shown.
Video 8
DIDS binding to Y46C ps-IKs.
K41, W323, and Y46C side chains are shown.
Video 9
Binding pocket fluctuations before and after exit of mefenamic acid.
W323A and the backbone of ps-KCNE1 (residues 41–44) gradually appear ~100 ns. Frames before mefenamic acid detachment are white, and after detachment red.
Tables
Table 1
Mean V1/2 of activation (mV) and slope values (k-factor, mV) in the absence and presence of mefenamic acid for fully saturated IKs channel complexes.
A statistical difference in V1/2 compared to control is shown as p-value, determined using an unpaired t-test. NS denotes not significant. Values are shown ± SEM.
| Control | 100 µM or 1 mM mefenamic Acid* | p-value | |||||
|---|---|---|---|---|---|---|---|
| V1/2 | k-factor | n | V1/2 | k-factor | n | ||
| WT EQ | 25.4±2.4 | 19.4±1.2 | 6 | -80.3±4.1 | 41.3±8.4 | 3 | <0.0001 |
| K41C-EQ | 15.2±1.1 | 18.4±1.7 | 4 | 11.4±1.0 | 19.4±0.8 | 4 | <0.05 |
| 16.7±2.0 | 19.8±1.4 | 3 | NS | ||||
| L42C-EQ | 68.9±1.5 | 21.5±3.7 | 3 | 31.8±0.4 | 14.8±4.27 | 3 | <0.01 |
| E43C-EQ | 18.3±10.0 | 25.7±1.5 | 6 | 14.4±5.6 | 22.8±1.3 | 6 | NS |
| A44C-EQ | 4.1±1.8 | 17.6±1.4 | 4 | -5.6±2.7 | 18.3±2.0 | 4 | <0.05 |
| Y46A-EQ† | 76.4±1.5 | 57.3±1.6 | 3 | -29.8±4.1 | 18.9±3.1 | 3 | <0.05 |
| EQ-W323A | 47.8±2.7 | 23.7±2.2 | 4 | 33.7±1.2 | 28.5±3.1 | 3 | <0.05 |
| EQ-W323C | 54.0±2.1 | 22.2±2.1 | 4 | 27.5±3.3 | 25.6±1.8 | 4 | <0.05 |
| EQ-V324A | 34.4±2.3 | 20.7±1.1 | 6 | 15.5±2.3 | 27.9±1.6 | 5 | <0.05 |
| EQ-V324W | 41.0±2.4 | 18.4±0.3 | 4 | 27.3±6.0 | 25.5±1.3 | 4 | NS |
| EQ-Q147C | 63.9±5.8 | 25.4±2.0 | 4 | 26.3±5.7 | 32.7±1.7 | 4 | <0.05 |
| EQ-Y148C | 36.8±0.3 | 20.3±0.4 | 4 | 17.5±4.0 | 36.7±3.7 | 4 | <0.05 |
-
*
For K41C-EQ, the concentration of mefenamic acid used was either 100 µM (upper row values) or 1 mM (lower row values). For all other constructs, 100 µM mefenamic acid was used.
-
†
An estimation of the activation V1/2 was calculated from a right shifted, non-saturating GV curve.
Table 2
Mean frequency of H-bonds between MEF or DIDS and residues in ps- IKs during 500 ns MD simulations or until drug unbound.
MEF357-N1 indicates the nitrogen of aminobenzoic acid; MEF357:O1 and O2 are the oxygens of the aminobenzoic acid; DDS357:O1-O6 are the oxygens of the sulfonic acids; DDS357:N1 and N2 are nitrogens …
| Donor | Hydrogen | Acceptor | % Frames with H-Bonds | SEM | |
|---|---|---|---|---|---|
| MEF | MEF-N1 | MEF-H1 | GLU43-O | 22.5 | 10.2 |
| TYR46-N | TYR46-HN | MEF-O2 | 79.7 | 4.2 | |
| ILE47-N | ILE47-HN | MEF-O2 | 7.9 | 2.7 | |
| DIDS | DIDS-O2 | DDS357-H10 | TRP323-NE1 | 12.9 | 2.1 |
| DIDS-O1 | DDS357-H9 | GLU43-OE2 | 25.1 | 4.0 | |
| DIDS-O1 | DDS357-H9 | GLU43-OE1 | 25.2 | 4.6 | |
| ILE47N | ILE47-HN | DIDS-O5 | 22.0 | 3.2 | |
| TYR46-N | TYR46-HN | DIDS-O6 | 56.8 | 10.4 | |
| TYR46-N | TYR46-HN | DIDS-O5 | 7.1 | 1.8 | |
| TYR299N | TYR299-HN | DIDS-N2 | 11.9 | 0.6 | |
| SER298-OG | SER298-HG1 | DIDS-N2 | 26.0 | 10.6 |
Table 3
Mean V1/2 of activation (mV) and slope values (k-factor, mV) for WT EQ treated with 100 µM mefenamic acid, and untreated mutant EQ-L142C.
Interpulse interval used is as indicated. Values are shown ± SEM. An interpulse interval of 7 s created such a dramatic change in the shape of the EQ-L142C G-V plot (see Figure 3—figure supplement 2)…
| V1/2 | k-factor | n | |
|---|---|---|---|
| WT EQ +100 µM mefenamic acid: Interpulse interval 15 s | -80.3±4.1 | 41.3±8.4 | 3 |
| WT EQ +100 µM mefenamic acid: Interpulse interval 30 s | 26.7±10.5 | 66.6±28 | 8 |
| EQ-L142C control: Interpulse interval 15 s | -80.3±4.5 | 30.0±2.9 | 6 |
| EQ-L142C control: Interpulse interval 30 s | -28.7±19 | 62.5±9.6 | 3 |
Table 4
Average free interaction energies of MEF-bound ps-IKs complexes calculated according to MM/GBSA methods from three independent MD simulation runs using the AMBER force field.
Mean values are in kcal/mol, ± SD. For W323A and K41C mutations, calculations correspond to interval of simulations before the detachment of ligand from the molecular complex. Note that unbinding …
| Run | Method | ps-IKs | W323A | Y46C | K41C |
|---|---|---|---|---|---|
| I | GBSA | -39.3±4.1 | -13.0±5.1 | -31.2±2.9 | -10.5±3.8 |
| - | Unbinding after ~75 ns | Unbinding after ~25 ns | |||
| II | GBSA | -39.0±3.3 | -23.1±3.1 | -32.2±3.8 | -17.0±2.6 |
| - | Unbinding after ~120 ns | - | Unbinding after ~70 ns | ||
| III | GBSA | -35.5±2.6 | -22.6±4.1 | -28.8±5.7 | -17.2±2.5 |
| - | Unbinding after ~85 ns | - | Unbinding after ~20 ns |
Table 5
Mean V1/2 of activation (mV) and slope values (k-factor, mV) in the absence and presence of 100 µM DIDS for fully saturated IKs channel complexes.
A statistical difference in V1/2 compared to control is shown as p-value determined using an unpaired t-test. NS denotes not significant. Values are shown ± SEM.
| Control | 100 µM DIDS | p-value | |||||
|---|---|---|---|---|---|---|---|
| V1/2 | k-factor | n | V1/2 | k-factor | n | ||
| WT EQ | 30.5±4.3 | 20.3±0.9 | 8 | -16.1±2.8 | 25.3±1.9 | 5 | <0.001 |
| K41C-EQ | 23.1±3.0 | 20.2±1.8 | 3 | -1.6±3.7 | 24.0±3.6 | 3 | <0.01 |
| L42C-EQ | 55.4±3.3 | 19.9±1.5 | 3 | 21.4±10.7 | 28.5±2.6 | 4 | <0.05 |
| A44C-EQ | 24.1±1.7 | 29.6±3.3 | 4 | 5.6±2.4 | 17.6±1.8 | 3 | <0.05 |
| *Y46A-EQ | 75.2±2.1 | 59.1±5.3 | 5 | 25.8±0.9 | 39.2±1.4 | 5 | <0.0001 |
| EQ-Y148C | 51.8±4.6 | 23.5±1.7 | 4 | 40.0±3.1 | 26.3±1.5 | 5 | NS |
| EQ-W323A | 50.7±3.6 | 23.9±1.6 | 4 | 23.4±4.9 | 24.1±1.3 | 4 | <0.05 |
-
*
An estimation of the activation V1/2 was calculated from a right shifted, non-saturating GV curve.
Table 6
Average free interaction energies of DIDS-bound ps-IKs complexes calculated according to MM/PBSA and MM/GBSA methods from three independent MD simulation runs of 300 ns duration using the AMBER force field.
Mean values are in kcal/mol, ± SD. For W323A and Y46C mutations, calculations correspond to interval of simulations before the detachment of ligand from the molecular complex. Note that unbinding …
| Run | Method | ps-IKs | W323A | Y46C | K41C | A44C | Y148C |
|---|---|---|---|---|---|---|---|
| I | PBSA | -32.3±6.7 | -25.7±4.9 | -35.5±6.3 | -33.5±4.4 | -29.2±4.2 | -34.1±4.6 |
| GBSA | -35.5±4.6 | -30.2±4.5 | -42.7±5.4 | -41.5±5.8 | -36.8±2.9 | -40.7±4.0 | |
| unbinding after 240 ns | changed binding pose after ~140 –150 ns | ||||||
| II | PBSA | -32.6±4.8 | -25.3±5.5 | -25.7±6.5 | -36.4±4.2 | -29.0±4.0 | -29.3±3.7 |
| GBSA | -36.0±4.8 | -30.0±4.8 | -32.4±6.4 | -31.6±4.0 | -34.0±5.7 | -31.8±4.7 | |
| unbinding after ~100 –132 ns | |||||||
| III | PBSA | -29.2±8.1 | -27.1±3.9 | -38.3±4.8 | -35.1±4.3 | -31.2±45.0 | -35.7±5.8 |
| GBSA | -34.0±8.9 | -35.1±4.8 | -42.5±4.7 | -30.8±3.9 | -35.6±5.6 | -40.3±5.9 | |
| unbinding after ~240 ns |
Table 7
Average free energy of mefenamic acid and DIDS-bound ps-IKs and mutant complexes.
Values are calculated according to the MM/GBSA method from three independent MD simulation runs using the AMBER force field, and further broken down by residue and channel region. For K41C and …
| Residue | ps-IKs MEF | K41C MEF | Y46C MEF | W323A MEF | ps-IKs DIDS | A44C DIDS | Y46C DIDS | Y148C DIDS | W323A DIDS | |
|---|---|---|---|---|---|---|---|---|---|---|
| Total | -38.02 | -16.39 | -31.40 | -20.31 | -34.29 | -35.40 | -39.16 | -37.60 | -34.33 | |
| Drug | -19.69 | -8.79 | -15.25 | -11.65 | -17.42 | -17.52 | -21.21 | -18.18 | -19.17 | |
| Channel | -17.91 | -6.52 | -16.61 | -7.55 | -19.21 | -18.40 | -16.94 | -19.21 | -15.10 | |
| Ch +Drug | -37.60 | -15.31 | -31.86 | -19.20 | -36.63 | -35.92 | -38.15 | -37.39 | -34.27 | |
| Difference | -0.42 | -1.08 | 0.46 | -1.11 | 2.34 | 0.52 | -1.01 | -0.21 | -0.06 | |
| E1/E3 | K41 | -1.548 | -0.349 | -1.411 | -0.954 | -0.639 | -0.439 | -1.148 | -0.283 | -0.083 |
| L42 | -0.970 | -0.895 | -0.943 | -1.193 | -1.061 | -0.798 | -0.165 | -0.320 | -0.587 | |
| E43 | -2.681 | -0.472 | -2.257 | -0.309 | -1.312 | -0.660 | -0.014 | -2.264 | -0.705 | |
| A44 | -1.906 | -0.886 | -2.035 | -1.102 | -1.778 | -2.062 | -1.027 | -1.061 | -1.780 | |
| M45 | -1.744 | -0.163 | -1.913 | -0.064 | -1.756 | -2.154 | -1.222 | -2.810 | -1.633 | |
| Y46 | -2.391 | -0.121 | -2.702 | -0.083 | -1.985 | -1.797 | -1.245 | -2.377 | -1.603 | |
| I47 | -0.771 | -0.136 | -0.412 | -0.203 | -2.036 | -1.993 | -1.004 | -0.621 | -1.528 | |
| L48 | -0.010 | -0.003 | -0.025 | 0.005 | -0.045 | -0.100 | -0.233 | -0.081 | -0.035 | |
| Sum | -12.02 | -3.03 | -11.70 | -3.90 | -10.61 | -10.00 | -6.06 | -9.82 | -7.79 | |
| Pore | T322 | -0.125 | -0.047 | -0.091 | -0.968 | -0.200 | -0.213 | -0.127 | -0.152 | -0.410 |
| W323 | -2.159 | -0.736 | -2.226 | -0.932 | -3.312 | -3.395 | -2.279 | -3.566 | -1.590 | |
| V324 | -0.644 | -0.037 | -0.123 | -0.047 | -0.172 | -0.210 | -0.111 | -2.016 | -0.063 | |
| G325 | -0.038 | -0.006 | -0.006 | 0.017 | -0.004 | 0.000 | 0.003 | -0.048 | 0.032 | |
| K326 | -0.185 | -0.015 | -0.024 | 0.008 | 0.038 | 0.058 | 0.091 | 0.000 | 0.118 | |
| T327 | -0.130 | -0.015 | 0.020 | 0.027 | -0.040 | -0.022 | -0.018 | -1.298 | -0.014 | |
| Sum | -3.28 | -0.86 | -2.49 | -1.89 | -3.69 | -3.78 | -2.44 | -7.08 | -1.93 | |
| S1 | V141 | -0.061 | -0.014 | -0.247 | -0.006 | -0.569 | -0.411 | -0.660 | -0.076 | -0.504 |
| L142 | -0.861 | -0.434 | -1.052 | -0.267 | -1.525 | -0.822 | -1.285 | -0.460 | -1.036 | |
| S143 | -0.028 | -0.004 | -0.014 | -0.063 | -0.008 | -0.006 | -0.104 | -0.026 | -0.017 | |
| T144 | -0.091 | -0.006 | -0.242 | -0.526 | -0.015 | -0.122 | -0.982 | -0.002 | -0.001 | |
| I145 | 0.004 | 0.005 | 0.002 | 0.009 | 0.003 | -0.329 | -0.067 | -0.009 | -0.001 | |
| E146 | 0.000 | 0.048 | 0.056 | 0.114 | 0.028 | -0.014 | -1.601 | 0.113 | 0.013 | |
| Q147 | -0.230 | -0.365 | 0.006 | -0.244 | 0.012 | -0.143 | -1.061 | -0.974 | -0.054 | |
| Y148 | -0.565 | -1.556 | 0.006 | -0.128 | -0.428 | -0.336 | 0.002 | -0.022 | -0.223 | |
| Sum | -1.83 | -2.32 | -1.49 | -1.11 | -2.50 | -2.18 | -5.76 | -1.40 | -1.82 | |
| Turret | G297 | -0.024 | -0.001 | -0.010 | -0.027 | -0.016 | -0.027 | -0.089 | -0.001 | -0.076 |
| S298 | -0.320 | -0.163 | -0.419 | -0.427 | -0.791 | -0.848 | -1.107 | -0.216 | -1.026 | |
| Y299 | -0.103 | -0.046 | -0.104 | -0.052 | 0.718 | -0.598 | -0.563 | -0.167 | -0.673 | |
| A300 | -0.618 | -0.183 | -0.636 | -0.431 | -1.130 | -1.112 | -0.751 | -0.652 | -1.093 | |
| D301 | 0.311 | 0.075 | 0.248 | 0.299 | 0.231 | 0.172 | -0.181 | -0.136 | -0.683 | |
| A302 | -0.024 | -0.003 | -0.011 | -0.007 | -0.011 | -0.020 | 0.009 | -0.008 | -0.015 | |
| Sum | -0.78 | -0.32 | -0.93 | -0.65 | -2.40 | -2.43 | -2.68 | -0.91 | -3.57 |
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | KCNQ1 | GenBank | HGNC:HGNC:6294 | Gene ID: 3784 |
| Gene (Homo sapiens) | KCNE1 | GenBank | HGNC:HGNC:6240 | Gene ID: 3753 |
| Strain, strain background (include species and sex here) | n/a | n/a | n/a | n/a |
| Genetic reagent (include species here) | n/a | n/a | n/a | n/a |
| Cell line (Homo-sapiens) | tsa201 | Sigma-Aldrich | Cat # CB_96121229 | Transformed human embryonic kidney 293 cells. The cells have been eradicated from mycoplasma at ECACC. The identity of tsA201 and 293 has been confirmed by STR profiling. |
| Transfected construct (synthetic) | KCNQ1 in pcDNA3 | This paper | KCNQ1 DNA in pcDNA3 vector. | |
| Transfected construct (synthetic) | KCNE1 in pcDNA3 | This paper | KCNE1 DNA in pcDNA3 vector. | |
| Biological sample (include species here) | n/a | n/a | n/a | n/a |
| Antibody | n/a | n/a | n/a | n/a |
| Recombinant DNA reagent | pcDNA3 | Invitrogen | Cat # V79020 | pcDNA3.1 (+) Mammalian Expression Vector |
| Sequence-based reagent | K41C_F | This paper | PCR primers | CCGCAGCGGTGACGGCTGCCTGGAGGC |
| Sequence-based reagent | K41C_R | This paper | PCR primers | GTAGAGGGCCTCCAGGCAGCCGTCACCG |
| Sequence-based reagent | L42C_F | This paper | PCR primers | CAGCGGTGACGGCAAGTGCGAGGCCCT |
| Sequence-based reagent | L42C_R | This paper | PCR primers | GACGTAGAGGGCCTCGCACTTGCCGTCA |
| Sequence-based reagent | E43C_F | This paper | PCR primers | GCGGTGACGGCAAGCTGTGCGCCCTCTA |
| Sequence-based reagent | E43C_R | This paper | PCR primers | GGACGTAGAGGGCGCACAGCTTGCCGTC |
| Sequence-based reagent | A44C_F | This paper | PCR primers | CGGCAAGCTGGAGTGCCTCTACGTCCTC |
| Sequence-based reagent | A44C_R | This paper | PCR primers | GAGGACGTAGAGGCACTCCAGCTTGCCG |
| Sequence-based reagent | Y46A_F | This paper | PCR primers | GGAGGCCCTCTGCGTCCTCATGGTAC |
| Sequence-based reagent | Y46A_R | This paper | PCR primers | GTACCATGAGGACGGCGAGGGCCTCC |
| Sequence-based reagent | W323A_F | This paper | PCR primers | GGTCTTCCCGACCGCCGTCTGGGGCAC |
| Sequence-based reagent | W323A_R | This paper | PCR primers | GTGCCCCAGACGGCGGTCGGGAAGACC |
| Sequence-based reagent | W323C_F | This paper | PCR primers | GGTCTTCCCGACACACGTCTGGGGCAC |
| Sequence-based reagent | W323C_R | This paper | PCR primers | GTGCCCCAGACGTGTGTCGGGAAGACC |
| Sequence-based reagent | V324A_F | This paper | PCR primers | CCCCAGACGTGGGCCGGGAAGACCATC |
| Sequence-based reagent | V324A_R | This paper | PCR primers | GATGGTCTTCCCGGCCCACGTCTGGGG |
| Sequence-based reagent | V324W_F | This paper | PCR primers | CCCCAGACGTGGTGGGGGAAGACCATC |
| Sequence-based reagent | V324W_R | This paper | PCR primers | GATGGTCTTCCCCCACCACGTCTGGGG |
| Sequence-based reagent | Q147C_F | This paper | PCR primers | CAGGGCGGCATAGCACTCGATGGTGGAC |
| Sequence-based reagent | Q147C_R | This paper | PCR primers | GTCCACCATCGAGTGCTATGCCGCCCTG |
| Sequence-based reagent | Y148C_F | This paper | PCR primers | GCCAGGGCGGCACACTGCTCGATGGTG |
| Sequence-based reagent | Y148C_R | This paper | PCR primers | CACCATCGAGCAGTGTGCCGCCCTGGC |
| Peptide, recombinant protein | eGFP in pcDNA3 | Gift | Enhanced Green Fluorescent Protein | |
| Commercial assay or kit | Midiprep | ThermoFisher Scientific | Cat# K210004 | DNA extraction kit |
| Chemical compound, drug | DIDS | Sigma-Aldrich | CAS # 53005-05-3 | 4,4'-diisothiocyano-2,2'-stilbenedisulfonic acid (stock 50 mM) |
| Chemical compound, drug | Mef | Sigma-Aldrich | CAS # 61-68-7 | mefenamic Acid (stock 50 mM) |
| Software, algorithm | pCLAMP 11 | Molecular Devices | pCLAMP 11 software | |
| Software, algorithm | GraphPad Prism 9 | GraphPad Software | GraphPad Prism 9 software | |
| Software, algorithm | ICM-pro | MolSoft LLC | ICM-pro 3.8 software | |
| Software, algorithm | GROMACS | Royal Institute of Technology and Uppsala University, Sweden | GROMACS 2021.4 | |
| Software, algorithm | TTClust | Thibault Tubiana, PhD | TTClust, a molecular simulation clustering program | |
| Other | Axopatch 200B amplifier | Molecular Devices | Axopatch 200B amplifier | |
| Other | Digidata 1440 A digitizer | Molecular Devices | Digidata 1440 A digitizer | |
| Other | Lipofectamine 2000 | ThermoFisher Scientific | Cat # 11668019 | Lipofectamine 2000 transfection reagent |
