Styxl2 regulates de novo sarcomere assembly by binding to non-muscle myosin IIs and promoting their degradation
- Division of Life Science, Hong Kong University of Science & Technology, China
- School of Life Sciences, Chinese University of Hong Kong, China
- Department of Applied Biology and Chemical Technology, Hong Kong Polytechnic University, China
- Department of Orthopaedics and Traumatology, Li Ka Shing Institute of Health Sciences, Chinese University of Hong Kong, China
Figures
Figure 1 with 1 supplement
Styxl2 regulates sarcomere integrity during zebrafish muscle development.
(A) A schematic of mouse Styxl2 protein. DSPc (red): dual-specificity phosphatase, catalytic domain. The numbers denote the positions of various amino acids in mouse Styxl2 including Ser (S) –225. (B…
-
Figure 1—source data 1
Original scans for the Western blot analysis in Figure 1B (anti-Styxl2 and anti-GAPDH).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig1-data1-v1.zip
-
Figure 1—source data 2
A PDF file showing original scans of the relevant Western blot analysis in Figure 1B (anti-Styxl2 and anti-GAPDH) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig1-data2-v1.zip
-
Figure 1—source data 3
Original scans for the Western blot analysis in Figure 1C (anti-MHC, anti-Styxl2, and anti-Tubulin).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig1-data3-v1.zip
-
Figure 1—source data 4
A PDF file showing original scans of the relevant Western blot analysis in Figure 1C (anti-MHC, anti-Styxl2, and anti-Tubulin) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig1-data4-v1.zip
Figure 1—figure supplement 1
Styxl2 was downstream target of Jak1-Stat1 pathway.
(A) Multiple sequence alignment of the region surrounding the active motif of the dual-specificity phosphatase catalytic (DSPc) domain among mouse dual-specificity phosphatases and Styxl2. The …
-
Figure 1—figure supplement 1—source data 1
Original scans for the Western blot analysis in Figure 1—figure supplement 1C (anti-Jak1, anti-Stat1, anti-Styxl2, and anti-Tubulin).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig1-figsupp1-data1-v1.zip
-
Figure 1—figure supplement 1—source data 2
A PDF file showing original scans of the relevant Western blot analysis in Figure 1—figure supplement 1C (anti-Jak1, anti-Stat1, anti-Styxl2, and anti-Tubulin) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig1-figsupp1-data2-v1.zip
-
Figure 1—figure supplement 1—source data 3
Original scans for the Western blot analysis in Figure 1—figure supplement 1D (anti-Styxl2).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig1-figsupp1-data3-v1.zip
-
Figure 1—figure supplement 1—source data 4
Original scans for the Western blot analysis in Figure 1—figure supplement 1D and E (anti-Tubulin in D, anti-Styxl2, and anti-Tubulin in E).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig1-figsupp1-data4-v1.zip
-
Figure 1—figure supplement 1—source data 5
A PDF file showing original scans of the relevant Western blot analysis in Figure 1—figure supplement 1D and E (anti-Styxl2 and anti-Tubulin in D, anti-Styxl2, and anti-Tubulin in E) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig1-figsupp1-data5-v1.zip
Figure 2 with 1 supplement
Conditional deletion of mouse Styxl2 leads to defective sarcomeres in striated muscles.
(A) The expression of Styxl2 protein in skeletal muscles of wild-type (+/+), heterozygous (+/−), and Styxl2 knockout (KO) (−/−) (driven by EIIA-Cre) mice. Soluble tissue lysates from limbs of E14.5 …
-
Figure 2—source data 1
Original scans for the Western blot analysis in Figure 2A (anti-Styxl2 and N.S.).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig2-data1-v1.zip
-
Figure 2—source data 2
A PDF file showing original scans of the relevant Western blot analysis in Figure 2A (anti-Styxl2 and N.S.) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig2-data2-v1.zip
-
Figure 2—source data 3
Original scans for the Western blot analysis in Figure 2D (anti-Styxl2 and anti-Tubulin).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig2-data3-v1.zip
-
Figure 2—source data 4
A PDF file showing original scans of the relevant Western blot analysis in Figure 2D (anti-Styxl2 and anti-Tubulin) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig2-data4-v1.zip
Figure 2—figure supplement 1
Both germline and conditional deletion of Styxl2 caused lethality.
(A) The schematic of the genomic locus of mouse Styxl2 and the targeting strategy. The probes used for Southern blot are indicated by black bars. (B, C) The schematic of the mating strategy to …
Figure 3
Styxl2 is not required for sarcomere maintenance but involved in de novo sarcomere assembly in adult muscles.
(A) The schematic to assess the role of Styxl2 in sarcomere maintenance in adult muscles. TMX: tamoxifen. (B) Styxl2 protein levels in control (Ctrl) and myofiber-specific Styxl2 knockout (MF-iKO) …
-
Figure 3—source data 1
Original scans for the Western blot analysis in Figure 3B (anti-Styxl2 and Loading).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig3-data1-v1.zip
-
Figure 3—source data 2
A PDF file showing original scans of the relevant Western blot analysis in Figure 3B (anti-Styxl2 and Loading) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig3-data2-v1.zip
-
Figure 3—source data 3
Original scans for the Western blot analysis in Figure 3F (anti-Styxl2 and N.S.).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig3-data3-v1.zip
-
Figure 3—source data 4
A PDF file showing original scans of the relevant Western blot analysis in Figure 3F (anti-Styxl2 and N.S.) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig3-data4-v1.zip
Figure 4 with 1 supplement
Styxl2 binds to non-muscle myosin IIs.
(A) The schematic of the fusion protein Styxl2-BirA*-HA. (B) The workflow of sample preparation for BioID. (C) Enriched (with Enrichment score >1) biotinylated proteins in cells expressing …
-
Figure 4—source data 1
Original scans for the Western blot analysis of input and IP in Figure 4D (anti-Styxl2, anti-Myh9, and anti-Myh10).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig4-data1-v1.zip
-
Figure 4—source data 2
A PDF file showing original scans of the relevant Western blot analysis in Figure 4D (anti-Styxl2, anti-Myh9, and anti-Myh10) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig4-data2-v1.zip
-
Figure 4—source data 3
Original scans for the Western blot analysis of input and IP in Figure 4F (anti-Flag and anti-HA).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig4-data3-v1.zip
-
Figure 4—source data 4
A PDF file showing original scans of the relevant Western blot analysis in Figure 4F (anti-Flag and anti-HA) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig4-data4-v1.zip
Figure 4—figure supplement 1
Identification of Styxl2-interacting partners by BioID.
(A) A representative gel of samples from BioID before mass spectrometry analysis. Whole cell lysates from control (Ctrl) and Doxycycline-treated (Dox) cells were subjected to Western blot using …
-
Figure 4—figure supplement 1—source data 1
Original scans for the Western blot analysis in Figure 4—figure supplement 1A (Streptavidin-HRP, anti-Styxl2, and Loading).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig4-figsupp1-data1-v1.zip
-
Figure 4—figure supplement 1—source data 2
A PDF file showing original scans of the relevant Western blot analysis in Figure 4—figure supplement 1A (Streptavidin-HRP, anti-Styxl2, and Loading) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig4-figsupp1-data2-v1.zip
-
Figure 4—figure supplement 1—source data 3
An Excel file showing raw data of iTRAQ-based mass spectrometry analysis for potential Styxl2 interactors in Figure 4—figure supplement 1B.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig4-figsupp1-data3-v1.zip
Figure 5 with 1 supplement
Styxl2 protein levels inversely correlates with that of non-muscle myosin IIs.
(A) Protein levels of Styxl2 and non-muscle myosin IIs in skeletal muscles of wild-type mice of different ages were determined by Western blot. (B) Protein levels of Styxl2 and non-muscle myosin IIs …
-
Figure 5—source data 1
Original scans for the Western blot analysis in Figure 5A (anti-Styxl2, anti-Myh9, anti-Myh10 and anti-Tubulin).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig5-data1-v1.zip
-
Figure 5—source data 2
A PDF file showing original scans of the relevant Western blot analysis in Figure 5A (anti-Styxl2, anti-Myh9, anti-Myh10, and anti-Tubulin) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig5-data2-v1.zip
-
Figure 5—source data 3
Original scans for the Western blot analysis in Figure 5B (anti-Styxl2, anti-Myh9, anti-Myh10, and anti-Tubulin).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig5-data3-v1.zip
-
Figure 5—source data 4
A PDF file showing original scans of the relevant Western blot analysis in Figure 5B (anti-Styxl2, anti-Myh9, anti-Myh10, and anti-Tubulin) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig5-data4-v1.zip
-
Figure 5—source data 5
Original scans for the Western blot analysis in Figure 5D (anti-Styxl2, anti-Myh9, anti-Myh10, and Loading).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig5-data5-v1.zip
-
Figure 5—source data 6
A PDF file showing original scans of the relevant Western blot analysis in Figure 5D (anti-Styxl2, anti-Myh9, anti-Myh10, and Loading) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig5-data6-v1.zip
Figure 5—figure supplement 1
The protein levels of NM IIs in differentiating C2C12 cells and the knockdown efficiency of Myh10-MO.
(A) Confluent C2C12 cells were induced to differentiate in differentiation medium (DM) and harvested at different time points. Soluble whole cell lysates were subjected to Western blot analysis. (B) …
-
Figure 5—figure supplement 1—source data 1
Original scans for the Western blot analysis in Figure 5—figure supplement 1A (anti-MHC, anti-Myh9, anti-Myh10, anti-Styxl2, and anti-Tubulin).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig5-figsupp1-data1-v1.zip
-
Figure 5—figure supplement 1—source data 2
A PDF file showing original scans of the relevant Western blot analysis in Figure 5—figure supplement 1A (anti-MHC, anti-Myh9, anti-Myh10, anti-Styxl2, and anti-Tubulin) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig5-figsupp1-data2-v1.zip
-
Figure 5—figure supplement 1—source data 3
Original scans for the Western blot analysis in Figure 5—figure supplement 1B (anti-Myh10 and anti-Tubulin).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig5-figsupp1-data3-v1.zip
-
Figure 5—figure supplement 1—source data 4
A PDF file showing original scans of the relevant Western blot analysis in Figure 5—figure supplement 1B (anti-Myh10 and anti-Tubulin) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig5-figsupp1-data4-v1.zip
Figure 6 with 1 supplement
The dual-specificity phosphatase catalytic (DSPc) domain of Styxl2 is dispensable for degradation of non-muscle myosin IIs.
(A) DNA constructs encoding Myh9, Styxl2, or Mst1 (negative control) were co-expressed in C2C12 cells. Soluble whole cell extracts were subjected to Western blot analysis. OE: overexpression. (B) …
-
Figure 6—source data 1
Original scans for the Western blot analysis in Figure 6A (anti-Flag, anti-HA, and N.S.).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig6-data1-v1.zip
-
Figure 6—source data 2
A PDF file showing original scans of the relevant Western blot analysis in Figure 6A (anti-Flag, anti-HA, and N.S.) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig6-data2-v1.zip
-
Figure 6—source data 3
Original scans for the Western blot analysis in Figure 6B (anti-Flag, anti-HA, and N.S.).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig6-data3-v1.zip
-
Figure 6—source data 4
A PDF file showing original scans of the relevant Western blot analysis in Figure 6B (anti-Flag, anti-HA, and N.S.) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig6-data4-v1.zip
Figure 6—figure supplement 1
Styxl2 regulates the protein levels of NM IIs without affecting their mRNA.
(A) Control (Ctrl) or Styxl2 DNA constructs were transfected into C2C12 cells. 24 hr later, the mRNA levels of different genes were determined by qPCR. **p-value <0.01. n.s.: not significant. (B) …
Figure 7 with 1 supplement
The Styxl2-mediated degradation of non-muscle myosin IIs is autophagy dependent.
(A) Plasmids encoding Myh9, Styxl2, or Mst1 (negative control) were co-expressed in C2C12 cells together with various siRNAs as indicated. Soluble whole cell extracts were subjected to Western blot …
-
Figure 7—source data 1
Original scans for the Western blot analysis in Figure 7A (anti-Styxl2, anti-Myh9, and N.S.).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig7-data1-v1.zip
-
Figure 7—source data 2
A PDF file showing original scans of the relevant Western blot analysis in Figure 7A (anti-Styxl2, anti-Myh9, and N.S.) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig7-data2-v1.zip
-
Figure 7—source data 3
Original scans for the Western blot analysis in Figure 7B (anti-Myh9, anti-Styxl2ΔN509, anti-Mst1, and anti-Tubulin).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig7-data3-v1.zip
-
Figure 7—source data 4
A PDF file showing original scans of the relevant Western blot analysis in Figure 7B (anti-Myh9, anti-Styxl2ΔN509, anti-Mst1, and anti-Tubulin) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig7-data4-v1.zip
-
Figure 7—source data 5
Original scans for the Western blot analysis of input and IP in Figure 7C (anti-Flag and anti-HA).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig7-data5-v1.zip
-
Figure 7—source data 6
A PDF file showing original scans of the relevant Western blot analysis in Figure 7C (anti-Flag and anti-HA) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig7-data6-v1.zip
Figure 7—figure supplement 1
Proteasome is not involved in Styxl2-mediated degradation of NM IIs.
C2C12 cells were transfected with a Styxl2-expressing plasmid. 12 hr later, MG132 (4 μM) or DMSO was added into the medium. After another 12 hr, the cells were harvested for Western blot analysis. …
-
Figure 7—figure supplement 1—source data 1
Original scans for the Western blot analysis in Figure 7—figure supplement 1 (anti-Myh9, anti-Myh10, anti-Styxl2, and Loading).
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig7-figsupp1-data1-v1.zip
-
Figure 7—figure supplement 1—source data 2
A PDF file showing original scans of the relevant Western blot analysis in Figure 7—figure supplement 1 (anti-Myh9, anti-Myh10, anti-Styxl2, and Loading) with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87434/elife-87434-fig7-figsupp1-data2-v1.zip
Author response image 1
The fish zygotes were injected with Atg5 or Ctrl MO.
48 hpf, the fish were stained with an anti-Actinin antibody. Some fast muscle fibers were disrupted when Atg5 was knocked down. The number in numerator at the bottom of each image represents fish …
Author response image 2
C2C12 cells were transfected with negative control siRNA (NC), siNek9#2 or siNek9#3.
18 h later, the cells were transfected with plasmids HA-Myh9 and Flag-Styxl2 or Flag-Stk24. After another 24 h, the cells were harvested for RT-qPCR (left panel) or western blot (right panel).
Author response image 3
The TA muscles were collected from male and female P1 mice.
The muscles were sectioned and co-stained for a-actinin (Actn) and Myh9. The majority of myofibrils is mature without the NM II signal. Scale bar, 10 µm.
Tables
Table 1
Candidate genes regulated by both Jak1 and Stat1.
Selected candidate genes targeted by both si-Jak1 and si-Stat1 were shown. The fold change was determined by the relative levels of a gene in cells treated with si-Jak1 or si-Stat1 over that in …
| Probe set ID | Gene | Fold change | |||
|---|---|---|---|---|---|
| P Stage | D Stage | ||||
| siJak1 | siStat1 | siJak1 | siStat1 | ||
| 1417889_at | apolipoprotein B editing complex 2 | 1.53 | 4.43 | 2.43 | 4.07 |
| 1419391_at | myogenin | 4.29 | 9.99 | 2.62 | 4.26 |
| 1422088_at | v-myc myelocytomatosis viral oncogene homolog 1 | 2.12 | 3.9 | 1.88 | 3.68 |
| 1422606_at | C1q and tumor necrosis factor related protein 3 | 2.23 | 13.4 | 1.68 | 5.45 |
| 1426971_at | ubiquitin-activating enzyme E1-like | 3.53 | 7.05 | 2.42 | 3.03 |
| 1427306_at | ryanodine receptor 1 | 2.11 | 6 | 2.71 | 4.52 |
| 1449178_at | PDZ and LIM domain 3 | 3.45 | 12.3 | 2.94 | 7 |
| 1451453_at | death-associated kinase 2 | 1.52 | 3.14 | 1.96 | 3.81 |
| 1452520_a_at | cholinergic receptor | 6.76 | 15.5 | 2.6 | 4.13 |
| 1429223_a_at | hemochromatosis type 2 (juvenile) (human homolog) | 2.16 | 28.8 | 2 | 7.66 |
| 1429459_at | sema domain | 2.77 | 4.43 | 2.27 | 5.58 |
| 1435828_at | avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog | 1.96 | 3.38 | 1.63 | 3.27 |
| 1439658_at | leiomodin 3 (fetal) | 1.91 | 17.9 | 2.83 | 18.8 |
| 1439746_at | dual specificity phosphatase 27 (putative) (dusp27) | 1.82 | 4.78 | 1.73 | 2.36 |
| 1444494_at | kelch repeat and BTB (POZ) domain containing 10 | 2.46 | 9.63 | 2.79 | 6.38 |
| 1421426_at | Hedgehog-interacting protein | –2.04 | –3.55 | –1.62 | –6.65 |
| 1435438_at | SRY-box containing gene 8 (sox8) | 1.85 | 4.01 | 1.51 | 5.7 |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (M. musculus) | Styxl2 | GenBank | MGI:MGI:2685055 | |
| Gene (D. rerio) | zStyxl2 (dusp27) | GenBank | ZFIN:ZDB-GENE-140513–1 | |
| Genetic reagent (M. musculus) | Styxl2flox/flox | This paper | See Materials and methods, Section 1. | |
| Genetic reagent (M. musculus) | EIIA-Cre | The Jackson Laboratory | Strain #:003724 | |
| Genetic reagent (M. musculus) | Pax7CreERT2/+ | The Jackson Laboratory | Strain #:017763 | |
| Genetic reagent (M. musculus) | Myf5Cre/+ | Tallquist et al., 2000 | ||
| Genetic reagent (M. musculus) | Pax7Cre/+ | Keller et al., 2004 | ||
| Genetic reagent (M. musculus) | Tg (HSA-MerCreMer) | McCarthy et al., 2012 | ||
| Strain, strain background (D. rerio) | ABSR wild type fish | Prof. Zilong Wen (HKUST) | ||
| Cell line (M. musculus) | C2C12 | ATCC | CRL-1772 | |
| Cell line (Homo-sapiens) | HEK 293T | ATCC | CRL-3216 | |
| Transfected construct (M. musculus) | Flag-Styxl2 | This paper | See Materials and methods, Section 2. | |
| Transfected construct (M. musculus) | Flag-Styxl2ΔN509 | This paper | See Materials and methods, Section 2. | |
| Transfected construct (M. musculus) | Flag-Styxl2N513 | This paper | See Materials and methods, Section 2. | |
| Transfected construct (M. musculus) | Myosin-IIA-GFP | addgenen | #38297 | |
| Transfected construct (M. musculus) | HA-Myh9 | This paper | See Materials and methods, Section 2. | |
| Transfected construct (M. musculus) | HA-Myh9-head | This paper | See Materials and methods, Section 2. | |
| Transfected construct (M. musculus) | HA-Myh9-tail | This paper | See Materials and methods, Section 2. | |
| Transfected construct (M. musculus) | HA-Myh10-head | This paper | See Materials and methods, Section 2. | |
| Transfected construct (M. musculus) | HA-Myh10-tail | This paper | See Materials and methods, Section 2. | |
| Transfected construct (E. coli) | pcDNA3.1 mycBioID | addgene | #35700 | Re-cloned into pcDNA3.0. |
| Transfected construct (D. rerio) | zStyxl2 | This paper | See Materials and methods, Section 2. | |
| Transfected construct (D. rerio) | zStyxl2ΔN493 | This paper | See Materials and methods, Section 2. | |
| Antibody | anti-Jak1 (Rabbit Polyclonal) | Upstate | Cat#: 06–272 | IB(1:2000) |
| Antibody | anti-Stat1 (Rabbit Polyclonal) | Upstate | Cat#: 06–501 | IB(1:2000) |
| Antibody | anti-β-Tubulin (Mouse monoclonal) | Sigma | Cat#: T4026 | IB(1:5000) |
| Antibody | anti-sarcomere MHC (Mouse monoclonal) | DSHB | MF20 | IB(1:1000) IF(1:200) |
| Antibody | anti-GAPDH (Mouse Monoclonal) | Ambion | Cat#: AM4300 | IB(1:10000) |
| Antibody | anti-Myh9 (Rabbit Polyclonal) | Cell Signaling | Cat#: 3403 | IB(1:2000) IF(1:200) |
| Antibody | anti-Myh10 (Mouse monoclonal) | Santa Cruz | Cat#: sc-376942 | IB(1:1000) |
| Antibody | anti-Flag (Mouse monoclonal) | Sigma | F3165 | IF(1:5000) |
| Antibody | anti-HA (Mouse monoclonal) | Roche | 12CA5 | IB(1:5000) |
| Antibody | anti-Styxl2 (Rabbit Polyclonal) | This paper | See Materials and methods, Section 7. IB(1:500) | |
| Antibody | anti-MEF2A (Rabbit Polyclonal) | This paper | Immunize rabbits with mouse MEF2A. | |
| Antibody | anti-Flag (Rabbit Polyclonal) | Sigma | F7425 | IF(1:200) |
| Antibody | anti-HA (Rabbit polyclonal) | Santa Cruz | Cat#: sc-805 | IF(1:200) |
| Antibody | anti-Myc (Mouse monoclonal) | Santa Cruz | Cat#: sc-40 | IB(1:1000) |
| Antibody | anti-α-Actinin (Mouse monoclonal) | Sigma | Cat#: A7732 | IF(1:200) |
| Antibody | anti-Prox1 (Rabbit polyclonal) | Angiobio | Cat#: 11–002 P | IF(1:200) |
| Antibody | anti-slow myosin heavy chain (Mouse monoclonal) | DSHB | F59 | IF(1:200) |
| Antibody | anti-myosin heavy chain (Mouse monoclonal) | DSHB | A4.1025 | IF(1:200) |
| Recombinant DNA reagent | pRetroX-Tet-On Advanced (plasmid) | Dr. Yusong Guo (HKUST) | ||
| Sequence-based reagent | Styxl2-F | This paper | PCR primers | GCCCATCCACCTCTCCTC |
| Sequence-based reagent | Styxl2-R | This paper | PCR primers | GCTCCTGTCATCCATCTTCTC |
| Sequence-based reagent | Myh9-F | This paper | PCR primers | GGCCCTGCTAGATGAGGAGT |
| Sequence-based reagent | Myh9-R | This paper | PCR primers | CTTGGGCTTCTGGAACTTGG |
| Sequence-based reagent | Myh10-F | This paper | PCR primers | GGAATCCTTTGGAAATGCGAAGA |
| Sequence-based reagent | Myh10-R | This paper | PCR primers | GCCCCAACAATATAGCCAGTTAC |
| Sequence-based reagent | Gapdh-F | This paper | PCR primers | CCCACTCTTCCACCTTCG |
| Sequence-based reagent | Gapdh-R | This paper | PCR primers | TCCTTGGAGGCCATGTAG |
| Sequence-based reagent | siGFP (negative control) | This paper | siRNA | GCTGACCCTGAAGTTCATC |
| Sequence-based reagent | siJak1 | This paper | siRNA | GCCTGAGAGTGGAGGTAAC |
| Sequence-based reagent | siStat1 | This paper | siRNA | GGATCAAGTCATGTGCATA |
| Sequence-based reagent | siATG5 | This paper | siRNA | GGCTCCTGGATTATGTCAT |
| Sequence-based reagent | Ctrl (negative control) | This paper | morpholino | AGCACACAAAGGCGAAGGTCAACAT |
| Sequence-based reagent | Styxl2 | This paper | morpholino | GCTGATCCTCCACAGACGACGCCAT |
| Sequence-based reagent | Myh10 | This paper | morpholino | CTTCACAAATGTGGTCTTACCTTGA |
| Sequence-based reagent | Atg5 | This paper | morpholino | CACATCCTTGTCATCTGCCATTATC |
| Chemical compound, drug | Cardiotoxin | Sigma Aldrich | Cat#: 217503 | |
| Software, algorithm | ImageJ | National Institutes of Health |
