Delayed postglacial colonization of Betula in Iceland and the circum North Atlantic
- Institute of Arctic and Alpine Research, University of Colorado Boulder, United States
- Department of Ecology and Evolutionary Biology, University of California Santa Cruz, United States
- Institute of Life and Environmental Sciences, University of Iceland, Iceland
- Faculty of Earth Sciences, University of Iceland, Iceland
- Department of Geological Sciences, University of Colorado Boulder, United States
Figures
Figure 1
Overview map of the North Atlantic.
Lake sedimentary ancient DNA (sedaDNA) sites with vascular plant histories since local deglaciation shown in yellow (see Table 1 for site information). The extent of the Last Glacial Maximum (LGM) …
Figure 2
Lake sediment age models used in this study.
(A) Stóra Viðarvatn’s age model (this study), (B) Torfdalsvatn’s pollen and macrofossil age model modified from Rundgren, 1995; Rundgren, 1998 (see Geirsdóttir et al., 2020), and (C) Torfdalsvatn’s …
-
Figure 2—source data 1
Major oxide composition of tephra layers (mean and standard deviation) used for age control in the Stóra Viðarvatn lake sediment record.
- https://cdn.elifesciences.org/articles/87749/elife-87749-fig2-data1-v1.xlsx
Figure 3
DNA quality assessment for Stóra Viðarvatn’s entire Holocene record plotted against depth (cm).
Total raw DNA reads, CT values, proportion raw terrestrial reads, metabarcoding technical quality (MTQ), metabarcoding analytical quality (MAQ), and species richness.
Figure 4
Comparison of paleoclimate and lake sedimentary ancient DNA (sedaDNA) records from Iceland.
(A) Presence/absence sedaDNA record from Stóra Viðarvatn (green) and Torfdalsvatn (red) for Betulaceae and Salicaceae, where light gray markers denote that no taxa was detected. For Stóra Viðarvatn s…
-
Figure 4—source data 1
Processed sedimentary ancient DNA (sedaDNA) data (number of replicates and reads) for all taxa identified in the Stóra Viðarvatn lake sediment record.
- https://cdn.elifesciences.org/articles/87749/elife-87749-fig4-data1-v1.xlsx
Figure 5
Simplified paleovegetation records from Torfdalsvatn for two taxa: Salix spp. and Betula spp.
Shown are pollen counts (bold red lines), where shaded regions indicate values above the mean (Rundgren, 1995), first occurrence of taxa macrofossils (black leaves, Rundgren, 1998), and DNA presence …
Figure 6
Simplified paleovegetation records from northeast Iceland for two taxa: Salix spp. and Betula spp.
Shown are Ytra-Áland pollen counts (bold green lines), where shaded regions indicate values above the mean (Karlsdóttir et al., 2014) and DNA presence from Stóra Viðarvatn (green bubbles, this …
Figure 7
Timing of postglacial Salicaceae and Betulaceae colonization in the circum North Atlantic at 10 locations (see Figure 1 and Table 1).
(A) GISP2 δ18O values reflective of regional North Atlantic temperature variability (Seierstad et al., 2014) and (B) lake sedaDNA records of vascular plants, where the brown boxes reflect the extent …
Figure 8
Colonization time after deglaciation (years) versus lake distance from the closest possible source south of the Last Glacial Maximum (LGM) ice sheet margin (km).
For all circum North Atlantic sites, Salicaceae is shown in red and Betulaceae in blue. Data point for Langfjordvannet is open for Betulaceae.
Tables
Table 1
Lake site information.
| Site # | Lake name | Region | Latitude (°) | Longitude (°) | Reference |
|---|---|---|---|---|---|
| 1 | Lake Qaupat | Baffin Island | 63.68 | –68.20 | Crump et al., 2019 |
| 2 | Bliss Lake | Greenland | 83.52 | –28.35 | Epp et al., 2015 |
| 3 | Torfdalsvatn | Iceland | 66.06 | –20.38 | Alsos et al., 2021 |
| 4 | Stóra Viðarvatn | Iceland | 66.24 | –15.84 | This study |
| 5 | Jodavannet | Svalbard | 77.34 | 16.02 | Voldstad et al., 2020 |
| 6 | Lake Skartjørna | Svalbard | 77.96 | 13.82 | Alsos et al., 2016b |
| 7 | Langfjordvannet | Norway | 70.15 | 20.54 | Alsos et al., 2022 |
| 8 | Eaštorjávri South | Norway | 70.43 | 27.33 | Alsos et al., 2022 |
| 9 | Nordvivatnet | Norway | 70.13 | 29.01 | Alsos et al., 2022 |
| 10 | Lake Ljøgottjern | Norway | 60.15 | 11.14 | ter Schure et al., 2021 |
Table 2
Primer sequences used in metabarcoding and qPCR experiments.
| Primer | Sequence 5′–3′ |
|---|---|
| truseq_trnL_g | ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGGCAATCCTGAGCCAA |
| truseq_trnL_h | GTGACTGGAGTTCAGACGTGTGCTCTTCGATCT TTGAGTCTCTGCACCTATC |
Table 3
ASV (amplicon sequence variant) sequences identified in our samples for Salicaceae and Betulaceae.
| Taxon | ASV sequence |
|---|---|
| Salicaceae | ATCCTATTTTTCGAAAACAAACAAAGGTTCATAAAGACAGAATAAGAATACAAAAG |
| Betulaceae | ATCCTGTTTTCCGAAAACAAATAAAACAAATTTAAGGGTTCATAAAGTGAGAATAAAAAAG |
Table 4
Total read data remaining after each data filtering step.
| Step | Total read data remaining |
|---|---|
| Raw | 18,653,132 |
| Minimum 10 reads per PCR replicate, occurred in 2 out of 5 PCR replicates, and minimum 100 reads across PCR replicates | 17,303,887 |
| Non-native taxa and blank contaminants | 15,909,615 |
