Ca2+ channel and active zone protein abundance intersects with input-specific synapse organization to shape functional synaptic diversity

eLife assessment

Calcium channels are key regulators of synaptic strength and plasticity. The authors generate new endogenous tags of the Drosophila channel Cac as well as auxiliary subunits to investigate distinct calcium channel functions at the fly NMJ, Is and Ib. They demonstrate functions for voltage-gated calcium channel subunits in promoting synaptic strength, diversity, and plasticity with a series of convincing analyses. The work is important and has broad implications. In addition, the newly developed tools should be quite beneficial for fly biologists.

https://doi.org/10.7554/eLife.88412.3.sa0

Significance of the findings:

Important: Findings that have theoretical or practical implications beyond a single subfield

Landmark
Fundamental
Important
Valuable
Useful

Strength of evidence:

Convincing: Appropriate and validated methodology in line with current state-of-the-art

Exceptional
Compelling
Convincing
Solid
Incomplete
Inadequate

During the peer-review process the editor and reviewers write an eLife Assessment that summarises the significance of the findings reported in the article (on a scale ranging from landmark to useful) and the strength of the evidence (on a scale ranging from exceptional to inadequate). Learn more about eLife Assessments

Abstract
Introduction
Results
Discussion
Materials and methods
Data availability
References
Article and author information
Metrics

Abstract

Synaptic heterogeneity is a hallmark of nervous systems that enables complex and adaptable communication in neural circuits. To understand circuit function, it is thus critical to determine the factors that contribute to the functional diversity of synapses. We investigated the contributions of voltage-gated calcium channel (VGCC) abundance, spatial organization, and subunit composition to synapse diversity among and between synapses formed by two closely related Drosophila glutamatergic motor neurons with distinct neurotransmitter release probabilities (P_r). Surprisingly, VGCC levels are highly predictive of heterogeneous P_r among individual synapses of either low- or high-P_r inputs, but not between inputs. We find that the same number of VGCCs are more densely organized at high-P_r synapses, consistent with tighter VGCC-synaptic vesicle coupling. We generated endogenously tagged lines to investigate VGCC subunits in vivo and found that the α2δ–3 subunit Straightjacket along with the CAST/ELKS active zone (AZ) protein Bruchpilot, both key regulators of VGCCs, are less abundant at high-P_r inputs, yet positively correlate with P_r among synapses formed by either input. Consistently, both Straightjacket and Bruchpilot levels are dynamically increased across AZs of both inputs when neurotransmitter release is potentiated to maintain stable communication following glutamate receptor inhibition. Together, these findings suggest a model in which VGCC and AZ protein abundance intersects with input-specific spatial and molecular organization to shape the functional diversity of synapses.

Introduction

The broad and complex functions of neural circuits depend on diverse neuronal subtypes communicating through synapses with distinct properties. Thus, understanding how synaptic diversity is established is critical for understanding neural circuit function. Neurotransmission occurs at specialized membranes called active zones (AZs) where action potentials drive the opening of voltage-gated Ca²⁺ channels (VGCCs) to trigger Ca²⁺-dependent synaptic vesicle (SV) fusion and neurotransmitter release. Neurotransmitter release properties are determined locally at individual synapses and vary considerably between neuronal subtypes and within homogeneous populations of neurons (Ariel et al., 2012; Atwood and Karunanithi, 2002; Branco and Staras, 2009; Hatt and Smith, 1976). In fact, functional imaging studies in Drosophila demonstrate that even single neurons forming synapses with the same postsynaptic partner display heterogeneous synaptic strength among individual AZs (Guerrero et al., 2005; Melom et al., 2013; Peled and Isacoff, 2011).

Presynaptic strength is defined as the likelihood of neurotransmitter release following an action potential (probability of release, P_r). This probabilistic process is determined by the number of functional SV release sites and their individual probability of vesicle release. The probability of SV release is highly dependent on transient increases in intracellular Ca²⁺ levels at vesicular sensors. Accordingly, SV release sites and VGCCs are key substrates for generating diversity of synaptic function (Akbergenova et al., 2018; Aldahabi et al., 2022; Chen et al., 2015; Fedchyshyn and Wang, 2005; Fekete et al., 2019; Gratz et al., 2019; Holderith et al., 2012; Laghaei et al., 2018; Miki et al., 2017; Nakamura et al., 2015; Newman et al., 2022; Rebola et al., 2019; Reddy-Alla et al., 2017; Sauvola et al., 2021; Sheng et al., 2012). Numerous studies have demonstrated that VGCC abundance is highly correlated with P_r across species (Akbergenova et al., 2018; Gratz et al., 2019; Holderith et al., 2012; Miki et al., 2017; Nakamura et al., 2015; Sheng et al., 2012). Paradoxically, this is not always the case. For example, a recent study investigated two cerebellar synaptic subtypes, one high-P_r formed by inhibitory stellate cells and one low-P_r formed by excitatory granule cells, and found higher VGCC levels at low-P_r granule synapses (Rebola et al., 2019). Since VGCCs in closer proximity to release sites are expected to have a greater impact on vesicular release probability than those positioned farther away, the spatial coupling of VGCCs and SVs at AZs is a critical determinant of P_r (Chen et al., 2015; Eggermann et al., 2011; Fedchyshyn and Wang, 2005; Nakamura et al., 2015; Rebola et al., 2019). Indeed, at high-P_r stellate synapses, a ‘perimeter release’ AZ organization places VGCCs ~40 nm closer to SVs than at low-P_r granular synapses (Rebola et al., 2019). Another recent study investigated two functionally distinct connections formed by CA1 pyramidal cells (Aldahabi et al., 2022). While Ca²⁺ influx was higher at the high-P_r synapse, raising Ca²⁺ influx at the low-P_r synapse to match the high-P_r synapse did not equalize P_r.

To further investigate this paradox, we sought a system where we could investigate the relationship between VGCCs and P_r both within and between two closely related neurons that form synapses with distinct release probabilities. Drosophila muscles are innervated by two glutamatergic motor neurons, one tonic and one phasic, that form type Ib and type Is synapses, respectively. Type Ib synapses have relatively low P_r and facilitate, whereas type Is synapses have higher P_r and depress in response to high-frequency stimulation (Aponte-Santiago et al., 2020; Lnenicka and Keshishian, 2000). In this study, we investigated how VGCC abundance, spatial organization, and subunit composition contribute to synaptic heterogeneity at AZs of low-P_r type Ib and high-P_r type Is inputs to the same postsynaptic targets. We find that individual synapses formed by both low- and high-P_r inputs exhibit heterogeneous release properties that can be predicted by VGCC abundance alone. However, VGCC abundance does not correspond to differences in P_r between the two inputs. We identify underlying molecular and organizational differences that may alter the relationship between VGCC abundance and P_r at low- vs. high-P_r inputs. We further find that the homeostatic potentiation of neurotransmitter release triggered by glutamate receptor inhibition involves dynamic increases in VGCCs, the α2δ–3 subunit Straightjacket (Stj), and the AZ cytomatrix protein Bruchpilot (Brp) across AZs of both inputs. These findings provide insight into how VGCC and AZ protein abundance intersects with underlying molecular and organizational differences between inputs to contribute to greater synaptic diversity.

Results

VGCC levels predict P_r within, but not between, inputs

To investigate the relationship between VGCC levels and neurotransmitter release properties at functionally distinct synapses, we took advantage of the two motor neuron subtypes with low and high release probabilities that innervate most Drosophila muscles (Aponte-Santiago and Littleton, 2020; Kurdyak et al., 1994). These glutamatergic neuromuscular junctions (NMJs) contain hundreds of individual synapses that are accessible to single AZ functional imaging using genetically encoded Ca²⁺ indicators.

In Drosophila, Cacophony (Cac) is the sole Ca_v2 pore-forming subunit and is the VGCC responsible for triggering synaptic transmission (Kawasaki et al., 2000; Macleod et al., 2006; Peng and Wu, 2007; Smith et al., 1996). To simultaneously monitor neurotransmitter release and VGCC levels, we swapped the N-terminal sfGFP tag in our well-characterized cac^sfGFP-N line for a Td-Tomato tag (cac^Td-Tomato-N) and confirmed that the tag does not impair synaptic function (Figure 1—figure supplement 1; Figure 1A–F; Ghelani et al., 2023; Gratz et al., 2019). We then expressed postsynaptically targeted GCaMP6f (SynapGCaMP6f; Newman et al., 2017), which reports Ca²⁺ influx through glutamate receptors in response to neurotransmitter release, in cac^Td-Tomato-N animals for a plus/minus readout. We and others have previously shown that Cac levels are highly predictive of P_r at individual type Ib AZs (Akbergenova et al., 2018; Gratz et al., 2019). To determine if VGCC levels are similarly predictive at high-P_r type Is AZs, we measured Cac^Td-Tomato-N fluorescence intensity and monitored neurotransmitter release in response to 0.2 Hz stimulus at individual synapses. To enable direct comparisons between the two inputs, we simultaneously imaged type Ib and Is synapses at NMJ 6/7 (Figure 1A). We quantified the number of times a vesicle was released over 120 stimuli to determine single-synapse P_r. As has been previously reported, we found that type Is synapses exhibited significant heterogeneity and higher average P_r than type Ib synapses (Figure 1B and C; Lu et al., 2016; Newman et al., 2022). Consistent with their higher P_r, type Is connections contain relatively fewer low-P_r and more high-P_r AZs (Figure 1D). We next investigated the correlation between P_r and VGCC levels and found that at type Is inputs, single-AZ Cac intensity positively correlates with P_r (Figure 1E). We also observe a strong positive correlation between VGCC levels and P_r at type Ib inputs to the same muscles (Figure 1F), consistent with our and others’ prior findings (Akbergenova et al., 2018; Gratz et al., 2019; Newman et al., 2022).

Figure 1 with 1 supplement see all

Download asset Open asset

VGCC levels predict P_r within, but not between, inputs.

(A) Representative confocal Z-projection of Cac^Td-Tomato-N (magenta) with type Ib (blue) and type Is (red) terminals outlined. (B) AZ heat map of terminals in A with color indicating P_r and size representing sum Cac intensity levels in arbitrary units (AU). (C) Average single-AZ probability of release at type Ib and Is terminals. N=6 animals, 6 NMJs. (D) Quintile distribution of single-AZ P_r frequency at type Ib and Is inputs. (**E, F**) Correlation between normalized Cac^Td-Tomato-N intensity and P_r at type Is and Ib AZs of the same 6 NMJs. Each dot represents a single AZ and each color corresponds to an individual NMJ with linear regression lines indicated for each. (G) Top, representative confocal Z-projection of Cac^sfGFP-N. Bottom, Cac^sfGFP-N in green with HRP marking neuronal membranes in gray. Type Ib (blue) and type Is (red) terminals are outlined. (H) Quantification of Cac^sfGFP-N AZ intensity at type Ib and Is terminals. Each data point represents the average normalized single AZ sum intensity for an individual NMJ. (I) Distribution of normalized Cac^sfGFP-N intensity from single type Ib and Is AZs in H (X-axis cutoff at 5.0). (J) Comparison between normalized Cac^Td-Tomato-N and P_r of type Ib and Is AZs combined from E-F with linear regression lines (blue and red, respectively) and 95% confidence intervals (black lines) indicated. All scale bars = 5 µm, all error bars indicate S.E.M, ****p<0.0001; ns, not significant. N’s, absolute values, and statistical information is detailed in Supplementary file 1a.

A simple prediction of the observation that VGCC levels correlate highly with P_r at individual AZs of both low- and high-P_r inputs is that Cac levels will be higher at synapses of type Is inputs than type Ib. We analyzed Cac^sfGFP-N levels at individual type Ib and Is synapses and found that average Cac levels are the same at type Ib and Is AZs (Figure 1G and H). Cac levels are also similarly distributed across AZs of the two inputs (Figure 1I). Together, these findings indicate that the relationship between VGCC levels and P_r differs between the two inputs. Consistently, when we directly compare the best-fit lines for the relationship between Cac levels and P_r at type Ib and Is inputs from our correlative functional imaging data (Figure 1E and F), we find that the slopes are significantly different (Figure 1J). Across type Is AZs, a similar range of VGCC levels supports a higher range of release probabilities. Thus, VGCCs can predict P_r within synaptic subtypes, but not between AZs of different synaptic subtypes, providing a framework for understanding seemingly contradictory findings on the role of VGCCs in determining P_r.

VGCC clusters are more compact at AZs of high-P_r type Is inputs

Many differences between low-P_r type Ib and high-P_r type Is AZs have been described (Aponte-Santiago and Littleton, 2020; Aponte-Santiago et al., 2020; Atwood et al., 1993; He et al., 2023; Jetti et al., 2023; Kurdyak et al., 1994; Lu et al., 2016; Medeiros and O’Connor-Giles, 2023). Perhaps most notably, type Is AZs experience ~twofold greater Ca²⁺ influx than type Ib (He et al., 2023; Lu et al., 2016). While this alone could explain the estimated 3-fold greater P_r at type Is AZs and is certainly a key factor, several lines of evidence argue for additional contributors. A recent study using a botulinum transgene to isolate type Ib and Is synapses for electrophysiological analysis found that increasing external [Ca²⁺] from physiological levels (1.8 mM) to 3 mM or even 6 mM does not result in a 3-fold increase in EPSCs or quantal content at type Ib synapses and type Ib synapses continue to facilitate at 3 mM external [Ca²⁺] (He et al., 2023). Using this approach, they further found that type Ib synapses are more sensitive to the slow Ca²⁺ chelator EGTA, indicating looser VGCC-SV coupling.

We investigated the spatial distribution of VGCCs at type Ib and Is AZs using 3D dSTORM single-molecule localization microscopy (SMLM). An individual VGCC complex is estimated to be ~10 nm in diameter with the most common immunolabeling techniques adding significantly to their size and creating a linkage error of ~20 nm between the target molecule and fluorescent reporter (Früh et al., 2021; Liu et al., 2022; Thomas, 2000). For following VGCC dynamics using single-particle tracking via photoactivation localization microscopy (sptPALM), we recently incorporated mEOS4b (Paez-Segala et al., 2015) at the same N-terminal site we previously used to endogenously tag Cac, achieving a linkage error of less of than 5 nm (Ghelani et al., 2023; Gratz et al., 2019). To gain more flexibility in labeling Cac without adding to the linkage error, we swapped the mEOS tag for a similarly sized HaloTag (cac^HaloTag-N). cac^HaloTag-N flies are fully viable, do not display significant defects in synaptic function, and exhibit normal Cac localization at AZs as observed in super-resolution optical reassignment images, where Brp is arranged in rings surrounding puncta of VGCCs (Figure 1—figure supplement 1; Figure 2A–C, Ghelani et al., 2023). HaloTag, which covalently binds synthetic ligands, is 3.3 nm in diameter (Los et al., 2008; Yazaki et al., 2020), yielding a linkage error well under 5 nm. cac^HaloTag-N larvae were stained with JaneliaFluor646 HaloTag ligand (Grimm et al., 2015) and horseradish peroxidase (HRP) to distinguish between type Ib and Is branches and enable simultaneous imaging of the two inputs at a single NMJ. We then used density-based spatial clustering of applications with noise (DBSCAN) analysis to identify Cac clusters at type Ib and Is AZs (Figure 2D and E; Ehmann et al., 2014). We find that the average size of Cac^HaloTag-N clusters is similar at low- and high-P_r AZs (Figure 2F), with mean diameters of approximately 102 nm and 105 nm, respectively. This is similar to the Cac^mEOS4b-N type Ib cluster size observed by sptPALM imaging (Ghelani et al., 2023). In agreement with our confocal level data, the number of localizations per cluster was similar at low- and high-P_r AZs (Figure 2G). We then calculated the average Cac density per AZ and found that VGCCs are significantly more densely organized at high-P_r type Is AZs than low-P_r type Ib AZs (Figure 2H, I). Greater VGCC AZ density at type Is AZs is consistent with a recent SMLM study using antibodies to label Cac, indicating these results are robust to different labeling approaches (Newman et al., 2022). Together, these findings suggest that more compact organization of VGCCs increases their coupling to SVs and contributes to the steeper relationship between VGCC levels and P_r at high-P_r type Is AZs.

Figure 2

Download asset Open asset

VGCC clusters are more compact at AZs of high-P_r type Is inputs.

(**A–C**) Representative SoRa Z-projection of Cac^HaloTag-N (green), Brp (magenta), and merge. (**D, E**) Representative boutons of STORM Cac^HaloTag-N clusters as identified by DBSCAN at type Ib and Is boutons as indicated. Each color represents an individual identified cluster with purple scattered dots identifying excluded background signal. (**F–H**) Analysis of STORM-acquired Cac^HaloTag-N clusters where each data point represents the respective single-cluster measurement averaged over individual boutons. (F) Quantification of Cac^HaloTag-N cluster area at type Ib and Is AZs. (G) Quantification of localizations per cluster at type Ib and Is boutons. (H) Calculated Cac^HaloTag-N cluster density at type Ib and Is AZs. (I) Paired analysis of calculated AZ cluster density averaged over individual type Ib and Is inputs to the same muscle. All scale bars = 1 µm, all error bars indicate S.E.M. **p<0.01; *p<0.05; ns, not significant. N’s, absolute values, and statistical information is detailed in Supplementary file 1a.

Differences in Bruchpilot levels and function at low- and high-P_r inputs

To understand how these nanoscale differences in VGCC organization might be established, we investigated the AZ scaffolding protein Brp. Brp/CAST/ELKS family proteins function as central organizers of both VGCCs and SV release sites at developing synapses (Dai et al., 2006; Dong et al., 2018; Hallermann et al., 2010; Held et al., 2016; Kittel et al., 2006; Liu et al., 2014; McDonald et al., 2020; Radulovic et al., 2020). Like Cac, Brp is more densely arranged at type Is AZs as measured through SMLM and stimulated emission depletion (STED) imaging studies (He et al., 2023; Jetti et al., 2023; Mrestani et al., 2021). We simultaneously imaged type Ib and Is inputs and found lower Brp levels at type Is AZs (Figure 3A and B). Since Cac levels are similar at AZs of the two inputs, lower Brp levels result in a significantly higher Cac:Brp ratio at type Is synapses, which we hypothesize promotes compact organization of VGCCs (Figure 3C). In contrast, we and others have previously shown that Brp levels positively correlate with P_r among AZs of low-P_r type Ib inputs (Gratz et al., 2019; Muhammad et al., 2015; Newman et al., 2017; Peled et al., 2014; Reddy-Alla et al., 2017). Consistently, Brp and Cac levels strongly correlate at type Ib AZs (Gratz et al., 2019) and we observe a similarly strong correlation across individual type Is AZs (Figure 3D). Thus, like VGCCs, Brp levels contribute in distinct ways to synaptic heterogeneity within vs. between low- and high-P_r inputs, likely due to differences in AZ organization between the two synaptic subtypes.

Figure 3

Download asset Open asset

Differences in Bruchpilot (Brp) levels and function at low-and high-P_r inputs.

(A) Representative confocal Z-projection of Brp expression at type Ib (blue outline) and type Is (red outline) terminals. (B) Quantification of Brp AZ intensity at type Ib and Is terminals. (C) Ratio of normalized Cac^sfGFP-N:Brp levels at type Ib and Is inputs to the same muscles. (D) Correlation of Cac^sfGFP-N and Brp at type Ib and Is single AZs with linear regression lines (blue and red, respectively) and 95% confidence intervals (black dotted lines) indicated. (**E, F**) Representative confocal Z-projections of Cac^sfGFP-N (green), Brp (magenta), HRP (white), and merge at type Ib (blue outline) and Is (red outline) terminals of *cac^sfGFP-N* (control) or *cac^sfGFP-N;brp^-/-* (*brp^-/-*) animals. (G) Quantification of Cac^sfGFP-N normalized fluorescence intensity at type Ib and Is AZs of control vs *brp^-/-* NMJs. (H) Ratio of Cac^sfGFP-N fluorescence intensity at type Ib and Is AZs between *brp^-/-*and control NMJs. For B and G, each data point represents the average normalized single AZ sum intensity for an individual NMJ. All scale bars = 5 µm, all error bars indicate S.E.M., ****p<0.0001. N’s, absolute values, and statistical information is detailed in Supplementary file 1a.

We next investigated the requirement for Brp in promoting VGCC accumulation at low- and high-P_r inputs by analyzing Cac^sfGFP-N levels in brp null mutants (brp^-/-; Figure 3E and F). Cac^sfGFP-N levels are diminished at both type Ib and Is AZs, demonstrating a conserved role for Brp in promoting Cac accumulation at both inputs (Figure 3G). The relative decrease in Cac levels at type Ib AZs is significantly greater than at type Is AZs, indicating a greater requirement for Brp in regulating VGCC levels at low-P_r type Ib synapses (Figure 3H). This suggests that an additional factor or factors function with or upstream of Brp to establish differences in Brp dependence at low- and high-P_r AZs.

Brp differentially regulates VGCC dynamics at low- and high-P_r synapses during presynaptic homeostatic potentiation

In response to acute or chronic inhibition of glutamate receptors at NMJs, Drosophila motor neurons homeostatically increase neurotransmitter release to maintain synaptic communication (Davis and Müller, 2015; Frank, 2014; James et al., 2019). Pharmacological inhibition of glutamate receptors with the wasp toxin Philanthotoxin-433 (PhTx) induces acute presynaptic homeostatic potentiation of release (PHP) within minutes (Frank et al., 2006). We and others have demonstrated that acute PHP involves rapid changes in VGCC and other AZ protein levels at type Ib AZs (Böhme et al., 2019; Gratz et al., 2019; Weyhersmüller et al., 2011). Recent studies have revealed significant differences in the induction of PHP at low- and high-P_r synaptic inputs under different conditions (Genç and Davis, 2019; Newman et al., 2017; Sauvola et al., 2021). PhTx induces acute PHP at both type Ib and Is synapses (Genç and Davis, 2019), but the molecular changes underlying PHP at high-P_r type Is AZs remain unknown. To compare the dynamic modulation of VGCCs at low- and high-P_r AZs, we treated cac^sfGFP-N larvae with non-saturating concentrations of PhTx for 10 min, then quantified Cac and Brp levels at type Ib and Is AZs (Figure 4A and B). We observe a significant PhTx-induced increase in Brp and Cac^sfGFP-N levels at type Is AZs similar to type Ib (Figure 4C and D; Gratz et al., 2019). Thus, despite their distinct baseline transmission and organizational properties, PhTx-induced potentiation of neurotransmitter release involves the rapid accumulation of VGCCs at both low- and high-P_r AZs.

Figure 4

Download asset Open asset

Brp differentially regulates VGCC dynamics at low-and high-P_r inputs during *presynaptic homeostatic potentiation*.

(**A, B**) Representative confocal Z-projections of Cac^sfGFP-N (top, green), Brp (middle, magenta), and both merged with HRP (bottom, gray) at untreated and PhTx-treated *cac^sfGFP-N* NMJs showing type Ib (blue) and type Is (red) terminals. (C) Quantification of Brp fluorescence intensity at untreated and PhTx-treated type Ib and Is terminals. (D) Quantification of Cac^sfGFP-N fluorescence intensity at untreated and PhTx-treated type Ib and Is terminals. (**E, F**) Representative confocal Z-projections of Cac^sfGFP-N (top, green), Brp (middle, magenta), and both merged with HRP (bottom, gray) at untreated and PhTx-treated *cac^sfGFP-N;brp^-/-* NMJs showing type Ib (blue) and type Is (red) terminals. (G) Quantification of Cac^sfGFP-N fluorescence intensity at untreated and PhTx-treated *cac^sfGFP-N;brp^-/-* type Ib and Is terminals. For all quantifications, each data point represents the average normalized single AZ sum intensity for an individual NMJ. All scale bars = 5 µm, all error bars indicate S.E.M. ****p<0.0001; ***p<0.001; **p<0.01; ns, not significant. N’s, absolute values, and statistical information is detailed in Supplementary file 1a.

At low-P_r type Ib AZs, Brp is a critical regulator of PHP-induced accumulation of proteins associated with SV priming and release, specifically Unc13A and Syntaxin-1A (Böhme et al., 2019). At type Ib AZs, PhTx also induces a Brp-dependent increase in Cac density and decrease in channel mobility (Ghelani et al., 2023). Notably, Brp itself becomes more densely organized during PHP (Ghelani et al., 2023), consistent with its denser organization at high-P_r type Is AZs (Mrestani et al., 2021). Since baseline accumulation of VGCCs depends less on Brp at high-P_r type Is AZs, we investigated the role of Brp in promoting dynamic increases in VGCC levels at type Ib and Is AZs by treating cac^sfGFP-N; brp^-/- larvae with PhTx followed by quantification of Cac^sfGFP-N levels (Figure 4E and F). We find that PhTx failed to induce accumulation of Cac at either type Ib or Is AZs in brp^-/- mutants, demonstrating a shared requirement for Brp in regulating VGCC dynamics at both inputs (Figure 4G). In contrast to no change at type Ib AZs, Cac^sfGFP-N levels are significantly decreased at type Is AZs (Figure 4G), revealing an input-specific role for Brp in maintaining VGCC levels during the dynamic reorganization of AZs. Consistently, Ghelani et al., 2023 found that whereas PhTx induces a decrease in Cac mobility at wild-type type Ib AZs, in brp^-/- mutants Cac mobility increases (Ghelani et al., 2023). Together, these findings suggest potentiating synapses must coordinate the accumulation of new VGCCs with the stabilization of existing channels, and that meeting this challenge is more dependent upon Brp at high-P_r AZs.

Endogenous tagging of VGCC auxiliary subunits reveals distinct synaptic expression patterns

In addition to the pore-forming α subunits, VGCCs comprise auxiliary α2δ and β subunits that regulate forward channel trafficking, membrane insertion, and function (Figure 5A; Campiglio and Flucher, 2015; Dolphin and Lee, 2020; Weiss and Zamponi, 2017). β subunits interact with pore-forming α subunits intracellularly, whereas GPI-anchored α2δ subunits are largely extracellular. Beyond their interaction with α subunits, α2δs have been shown to interact with a growing number of extracellular proteins to promote synaptogenesis (Bauer et al., 2010; Dolphin, 2018; Risher et al., 2018). The Drosophila genome encodes one synaptic Ca_v2 α subunit (Cac), one β subunit, and three α2δ subunits (Littleton and Ganetzky, 2000). Auxiliary subunits are both spatially and temporally regulated and broadly able to interact with α subunits. Thus, the subunit composition of channel complexes is a potential source of significant diversity in both the spatial and functional regulation of VGCCs.

Figure 5

Download asset Open asset

Endogenous tagging of VGCC auxiliary subunits reveals distinct synaptic expression patterns.

(A) Schematic of a Ca²⁺ channel complex with tagged auxiliary subunits (created with BioRender). (B) Schematic of Ca-β (isoform PL shown), Stj (isoform PC), and Stolid (isoform H/I) indicating endogenous tag locations. (**C–E**) Quantification of EJPs, mEJPs, and quantal content for each endogenously tagged line. (**F–H**) Representative confocal Z-projections of auxiliary subunit expression (green) at the larval ventral ganglion (VG, top, scale bars = 100 µm) and NMJs co-labeled with anti-HRP (magenta, bottom, scale bars = 5 µm). All error bars indicate S.E.M., ns, not significant. N’s, absolute values, and statistical information is detailed in Supplementary file 1a.

© 2024, BioRender Inc. Figure 5A was created using BioRender, and is published under a CC BY-NC-ND license. Further reproductions must adhere to the terms of this license.

Ca-β encodes the sole Drosophila β subunit and has been shown to enhance Ca²⁺ transients in sensory neurons (Kanamori et al., 2013). Drosophila α2δ–3, also known as Straightjacket (Stj), has well-characterized roles at the NMJ in promoting Ca²⁺ channel clustering, homeostatic plasticity, and, independently of Cac, synapse formation and organization (Dickman et al., 2008; Hoover et al., 2019; Kurshan et al., 2009; Ly et al., 2008; Schöpf et al., 2021; Wang et al., 2016). While low sequence homology between α2δ subunits within and across species makes 1:1 mapping difficult, the remaining two Drosophila α2δs map more closely to mammalian α2δ–3 and –4 than α2δ–1 and –2. Stolid was recently shown to promote dendritic Cac expression in motor neurons, whereas Ma2d is known to function in muscle where it is broadly expressed (Heinrich and Ryglewski, 2020; Reuveny et al., 2018). The synaptic localization of endogenous auxiliary subunits with VGCCs remains unknown in Drosophila.

To explore potential differences in VGCC subunit composition at type Ib and Is synapses, we used CRISPR gene editing to incorporate endogenous V5 tags in sequence common to all isoforms of stj, stolid, and Ca-β (Bruckner et al., 2017; Gratz et al., 2014). We inserted V5 after the N-terminal signal peptides of Stj and Stolid and near the C-terminus of Ca-β (see Materials and methods for details), and confirmed that the incorporation of the peptide tags did not impair neurotransmission (Figure 5B–E). We investigated the expression of each endogenously tagged subunit in the larval ventral ganglion and found that all subunits are expressed in the synaptic neuropil in a pattern similar to the α subunit Cac (Figure 5F–H; Gratz et al., 2019). Similar to Cac, Ca-β^V5-C is highly enriched in the mushroom bodies of the larval brain. We next investigated expression at the larval NMJ where Cac localizes in a single punctum at each AZ and found that only Ca-β^V5-C and Stj^V5-N are present (Figure 5F–H). This aligns with the recent finding that Stolid does not play a role in regulating Ca²⁺ transients at the larval NMJ (Heinrich and Ryglewski, 2020). We also observe Ca-β^V5-C expression in muscle as expected for the sole Drosophila β subunit (Figure 5F and see Figure 6C).

Figure 6

Download asset Open asset

Stj/α2δ-3 levels are lower at AZs of high-P_r type Is inputs

To investigate Ca-β^V5-C and Stj^V5-N localization at type Ib and Is AZs, we used super-resolution optical reassignment microscopy. Both subunits localize to AZs labeled with Cac or the CAST/ELKS AZ cytomatrix protein Brp (Figure 6A and B). We observe Brp rings surrounding puncta of VGCCs including Ca-β^V5-C (Figure 6A). The tight localization of both subunits to central AZ puncta suggests they are associated with α subunits and predicts that Ca-β^V5-C and Stj^V5-N levels, like Cac, will be similar at the low- and high-P_r synapses. To test this, we imaged Ca-β^V5-C and Stj^V5-N levels at both inputs simultaneously using confocal microscopy and measured fluorescence intensity (Figure 6C and D). As predicted, we found that Ca-β^V5-C levels are similar at type Ib and Is AZs (Figure 6E). In contrast, Stj^V5-N levels are significantly lower at high-P_r type Is AZs (Figure 6F). Thus, while Cac and Ca-β are present in similar ratios at AZs of both inputs, surprisingly, the same is not true of Stj/α2δ–3 with high-P_r type Is AZs exhibiting lower levels of Stj. This unexpected finding indicates that α:α2δ–3 stoichiometry is not always 1:1 in vivo and differs at low- and high-P_r synapses. This is consistent with studies of mammalian subunits indicating that in contrast to β subunits, α2δ interactions with α subunits may be transient, leading to a pool of VGCCs lacking α2δ (Müller et al., 2010; Voigt et al., 2016). Our results indicate this pool may be present in vivo and larger at high-P_r type Is inputs.

To further investigate the contribution of Stj to synaptic heterogeneity, we analyzed the relationship between Cac and Stj levels at individual AZs of type Is inputs. Stj^V5-N and Cac^sfGFP-N levels are highly positively correlated at type Is AZs (Figure 6G). We observe the same relationship between Stj^V5-N and Cac^sfGFP-N levels at type Ib AZs (Figure 6H). Because P_r is highly positively correlated with Cac levels within synaptic subtypes, this indicates that Stj levels are also positively correlated with P_r within, but not between, inputs.

Stj/α2δ–3 levels are modulated at AZs of both low- and high-P_r inputs during presynaptic homeostatic potentiation

α2δ subunits are critical regulators of α subunit forward trafficking. In flies and mammals, overexpression of α2δ subunits increases α subunit abundance, whereas overexpression of the α subunit alone does not (Cao et al., 2004; Cunningham et al., 2022; Hoppa et al., 2012). These findings suggest that α2δ may be dynamically regulated together with Cac during PHP, a prediction we can now test with our endogenously tagged line. Following PhTx exposure, we find that Stj^V5-N is recruited on a rapid timescale to both low- and high-P_r AZs, increasing by a similar percentage at both type Ib and Is AZs (27% and 26%, respectively) as predicted (Figure 7A-C). Cac levels are similarly increased (33% at type Ib and 30% at type Is; See Figure 4D), suggesting coordinated regulation. We have previously shown that Cac abundance is also increased in chronic PHP, which is induced by genetic loss of the GluRIIA receptor subunit (Gratz et al., 2019; Li et al., 2018; Petersen et al., 1997). We investigated Stj dynamics in GluRIIA^-/- null animals and observed elevated Stj^V5-N levels at AZs of both type Ib and Is inputs (18% and 17%, respectively; Figure 7D–F), indicating similar dynamics during chronic PHP. These data are consistent with the recent finding that in addition to its previously uncovered role in promoting an increase in the readily releasable pool of SVs (Wang et al., 2016), Stj is required for the accumulation of Cac at type Ib AZs during both acute and chronic PHP (Zhang et al., 2023). Thus, the abundance of multiple key AZ proteins distinguishes low- and high-P_r synapses within, but not between, inputs at baseline and during homeostatic plasticity.

Figure 7

Download asset Open asset

Stj/α2δ–3 levels are modulated at AZs of both low- and high-P_r inputs during presynaptic homeostatic potentiation.

(**A, B**) Representative confocal Z-projections of Stj^V5-N (top, green), HRP (middle, gray), and merge (bottom) at untreated and PhTx-treated *stj^V5-N* NMJs showing type Ib (blue) and type Is (red) terminals. (C) Quantification of Stj^V5-N fluorescence intensity at untreated and PhTx-treated type Ib and Is terminals. (**D–E**) Representative confocal Z-projections of Stj^V5-N (top, green), HRP (middle, gray), and merge (bottom) at *stj^V5-N* and *stj^V5-N;GluRIIA^-/-* NMJs showing type Ib (blue) and type Is (red) terminals. (F) Quantification of Stj^V5-N fluorescence intensity levels at *stj^V5-N* and *stj^V5-N;GluRIIA^-/-* type Ib and Is terminals. For all quantifications, each data point represents the average normalized single AZ sum intensity for an individual NMJ. All scale bars = 5 µm, all error bars indicate S.E.M. ****p<0.0001. N’s, absolute values, and statistical information is detailed in Supplementary file 1a.

Discussion

Complex nervous system function depends on communication at synapses with heterogeneous and plastic properties. Paradoxical findings in the field have raised questions about the role of VGCCs in establishing neurotransmitter release properties. Our findings suggest a model in which two broad intersecting mechanisms contribute to synaptic diversity in the nervous system: (1) nanoscale spatial organization and relative molecular content establish distinct average basal release probabilities that differ between inputs and (2) coordinated modulation of VGCC and active zone protein abundance independently tunes P_r among individual synapses of distinct inputs. This model provides a framework for integrating diverse findings in the field and understanding how multiple levels of molecular and organizational diversity can intersect to generate extensive synaptic heterogeneity. Investigations at diverse synapses using approaches ranging from cell-attached patch recordings to freeze-fracture immuno-electron microscopy to correlative functional imaging have revealed a strong positive correlation between VGCC number and P_r (Akbergenova et al., 2018; Gratz et al., 2019; Holderith et al., 2012; Miki et al., 2017; Nakamura et al., 2015; Newman et al., 2022; Sheng et al., 2012). This holds true among mature synapses in the hippocampus or immature synapses of the calyx of Held (Holderith et al., 2012; Sheng et al., 2012) and at the developing Drosophila NMJ where the differences in P_r and channel number between AZs of a single input also correlate with synapse maturity (Akbergenova et al., 2018; Gratz et al., 2019; Newman et al., 2022). While this conclusion corresponds neatly with the dependence of neurotransmitter release on Ca²⁺ influx, counterintuitively, a disconnect between VGCC and P_r is observed in some studies. Although the number of functional VGCCs positively correlates with P_r among synapses in the immature calyx of Held, the mature calyx has higher P_r yet recruits fewer Ca²⁺ channels (Fedchyshyn and Wang, 2005; Sheng et al., 2012; Wang and Augustine, 2014). Similarly, in the cerebellum, inhibitory stellate cells form high-P_r synapses with lower VGCC levels than low-P_r synapses formed by excitatory granular cells (Rebola et al., 2019). Adding to these paradoxical examples, we find that VGCC levels positively correlate with P_r among the heterogeneous synapses formed by either low-P_r type Ib or high-P_r type Is motor neurons, but overall VGCC abundance is similar at the two inputs (Figures 1 and 2) despite an ~threefold difference in P_r (Lu et al., 2016; Newman et al., 2017). Accordingly, our correlative functional imaging confirms that the same number of channels can support greater release at these high-P_r AZs (Figure 1). While two-fold greater Ca²⁺ influx at high-P_r type Is AZs can explain much of this difference (He et al., 2023; Lu et al., 2016), mounting evidence suggests that here and in other systems differences in P_r are separable from Ca²⁺ influx. At distinct inputs formed by CA1 pyramidal neurons, Ca²⁺ influx is greater at high-P_r synapses, but doesn’t explain differences in synaptic strength as raising Ca²⁺ entry at low-P_r synapses to high-P_r synapse levels was not sufficient to increase synaptic strength to high-P_r input levels (Aldahabi et al., 2022). Similar findings have been reported at tonic and phasic synapses of the Crayfish NMJ (Msghina et al., 1999).

The separability of VGCC abundance, Ca²⁺ influx, and P_r appears to be due to molecular and spatial differences between synaptic subtypes. In CA1 pyramidal neurons, differences in Munc-13-dependent SV priming are proposed to establish synapse-specific release properties, possibly due to the presence of distinct isoforms at low- vs. high-P_r connections. In the cerebellum, fewer VGCC are more tightly coupled to SVs at high-P_r stellate synapses (Rebola et al., 2019). More densely organized VGCCs at the mature vs. developing calyx of Held also exhibit greater coupling with SVs (Chen et al., 2015; Fedchyshyn and Wang, 2005; Fekete et al., 2019; Nakamura et al., 2015; Sheng et al., 2012). We find that Cac clusters are denser at high-P_r AZs formed by Drosophila phasic motor neurons (Figure 2). Brp, which organizes both VGCCs and SVs, is also more densely organized at type Is synapses (He et al., 2023; Jetti et al., 2023; Mrestani et al., 2021), consistent with an overall more compact organization of high-P_r AZs. A straightforward prediction is that a more compact AZ organization will decrease the distance between VGCCs and SVs. Indeed, a recent electrophysiological study using new tools for genetically isolating type Ib and Is inputs demonstrated that neurotransmitter release at denser type Is synapses is less impacted by the slow Ca²⁺ chelator EGTA than type Ib synapses, indicating tighter VGCC-SV coupling (He et al., 2023). Together, these findings suggest that more compact AZs may be a common organizing principle of high-P_r synapses. Consistent with this model, Brp and Unc-13 density increase during PHP when P_r is increased (Dannhäuser et al., 2022; Ghelani et al., 2023; Mrestani et al., 2021).

We also observe molecular differences between Drosophila motor inputs that may contribute to distinct P_r. Somewhat counterintuitively, high-P_r type Is AZs have lower levels of both Brp and Stj/α2δ–3 (Figures 3 and 6). Brp/CAST/ELKS AZ cytomatrix proteins are central regulators of synapse organization across species (Dai et al., 2006; Dong et al., 2018; Hallermann et al., 2010; Held et al., 2016; Kittel et al., 2006; Liu et al., 2014; McDonald et al., 2020; Radulovic et al., 2020). Brp interacts broadly with AZ proteins to promote Cac clustering, organize SVs, and recruit Unc13A, which defines SV release sites (Böhme et al., 2016; Fulterer et al., 2018; Ghelani et al., 2023; Liu et al., 2011). While Brp clearly plays a central role in AZ organization and reorganization, we also find that type Ib and Is synapses have distinct requirements for Brp during synapse formation and homeostatic potentiation (Figures 3 and 4). Synapse-specific roles for Brp are supported by a recent functional imaging study in Drosophila (Jetti et al., 2023) and studies of ELKS at mammalian inhibitory and excitatory synapses (Held et al., 2016), and suggest additional factors establish neuron-specific differences in Brp dependence. A recent single-cell transcriptomic study of type Ib and Is motor neurons provides an unbiased starting point for identifying candidate regulators of molecular differences at low- and high-P_r AZs (Jetti et al., 2023). Differentially expressed genes encode cytoskeletal and motor-related proteins, regulators of proteostasis, and post-translational modifying enzymes/pathway components – all of which could potentially contribute to establishing the observed molecular and/or spatial differences between type Ib and Is AZs. The VGCC complex itself provides an additional potential mechanism for diversifying synaptic function. Both β and α2δ subunits can influence the membrane localization and function of VGCCs (Campiglio and Flucher, 2015; Dolphin and Lee, 2020; Weiss and Zamponi, 2017). In addition to the ability to mix and match subunits, many of the genes encoding VGCC subunits across species are extensively alternatively spliced to generate additional functional diversity (Cingolani et al., 2023; Lipscombe et al., 2013; Lipscombe and Lopez Soto, 2019) – an area of great interest for further investigation at the Drosophila NMJ. Because both β and α2δ subunits are generally considered positive regulators of channel trafficking and function, we were surprised to find upon endogenously tagging Stj/α2δ–3 that its levels are lower at high-P_r AZs (Figures 5 and 6). Since AZ levels of α subunit Cac are similar at the two inputs, lower levels of Stj at type Is synapses indicates a difference in α:α2δ–3 stoichiometry between low- and high-P_r synaptic subtypes. While some previous studies have observed a tight association between the two subunits, a single-molecule tracking and modeling study of mammalian VGCCs found that α2δ subunits have a relatively low affinity for α subunits and predicted a population of α subunits not associated with an α2δ subunit (Cassidy et al., 2014; Voigt et al., 2016). Consistently, whereas α and β subunits were isolated at near equimolar ratios following affinity purification of Ca_v2 channels, molar levels of α2δ were a surprising 90% lower (Müller et al., 2010). Our findings suggest there may be a pool of VGCCs lacking an α2δ subunit at endogenous synapses, and further suggest that this pool is specific to or enriched at high-P_r type Is AZs. Stj is both required (Dickman et al., 2008; Kurshan et al., 2009; Ly et al., 2008) and rate limiting (Cunningham et al., 2022) for Cac accumulation at AZs. Stj does not appear to function in the stabilization of channels at the AZ membrane, but rather at an upstream step in the progression from ER to plasma membrane (Cunningham et al., 2022), so complexes may not need to be maintained. However, a recent study in C. elegans suggested that auxiliary subunits to promote stabilization in the membrane, raising the possibility that the difference observed in α2δ levels could translate to a difference in α subunit mobility within Ib vs. Is AZs (Oh et al., 2023). Tools for following Stj dynamics in developing neurons will help clarify its precise role in Cac delivery at type Ib and Is AZs.

How might a higher α:α2δ–3 ratio result in higher P_r? One possibility involves α2δ–3 interactions with cell adhesion molecules. In mammals, α-Neurexin specifically inhibits Ca²⁺ currents in Ca_v2.2 channels containing α2δ–3 (Tong et al., 2017), which, if similar at the Drosophila NMJ, could result in greater inhibition of channel function at type Ib AZs and contribute to the observed difference in Ca²⁺ influx. Loss of Drosophila Neurexin reduces neurotransmitter release at the NMJ, but it also leads to reduced synaptogenesis so whether this is a direct effect remains unknown (He et al., 2007). Another possibility is that Stj isoforms with different functions are differentially expressed at type Ib and Is AZs. A recent transcriptomic study observed no significant differences in mRNA splice isoforms, but transcript levels do not always reflect protein levels (Jetti et al., 2023). Notably, we find that among synapses of either low- or high-P_r AZs, Stj levels correlate with P_r and Stj levels are increased across AZs of both inputs during acute and chronic PHP (Figure 7). Cac and Stj levels increase by similar amounts at the two inputs, suggesting the difference in stoichiometry is maintained following homeostatic potentiation. α2δ–3 is an important drug target for treating epilepsy, neuropathic pain, and anxiety, so understanding its cell-specific roles and how α:α2δ–3 stoichiometry impacts channel function and contributes to synaptic diversity is of great interest.

Materials and methods

Drosophila genetics and gene editing

Request a detailed protocol

The following fly lines used in this study were obtained from the Bloomington Drosophila Stock Center (BDSC, NIH P40OD018537): w¹¹¹⁸ (RRID:BDSC_5905), vasa-Cas9 (RRID:BDSC_51324), piggyBac transposase (RRID:BDSC_8283), and Df(2 R)brp^6.1 (Gratz et al., 2014; Horn et al., 2003). brp⁶⁹ and GluRIIA^sp16 (GluRIIA^-/-) alleles were generously provided by Stephan Sigrist (Freie Universität Berlin; Fouquet et al., 2009; Kittel et al., 2006) and Aaron DiAntonio (Petersen et al., 1997) respectively. brp loss-of-function experiments were performed in brp⁶⁹/Df(2 R)brp^6.1. Drosophila melanogaster stocks were raised on molasses food (Lab Express, Type R) in a 25 °C incubator with controlled humidity and 12 hr light/dark cycle. Endogenously tagged cac, Ca-β, stolid, and straightjacket (stj) alleles were generated using our piggyBac-based CRISPR approach as previously detailed (https://flycrispr.org/; Bruckner et al., 2017; Gratz et al., 2019). We used FlyBase (release FB2024_01) to obtain genomic sequences (doi.org/10.1093/genetics/iyad211). Td-Tomato and Halo tags were incorporated at the N-terminus of Cac, where we have previously incorporated fluorescent tags (Ghelani et al., 2023; Gratz et al., 2019). V5 tags were incorporated at the N-terminus of Stj and Stolid after their signal peptide sequences, immediately after Asparagine 34 of Stj and after Isoleucine 34 of Stolid. For Ca-β, V5 was inserted immediately after Proline 446 of isoform Ca-β-PN. All endogenously tagged lines are fully viable in homozygous males and females and were molecularly confirmed by Sanger sequencing. All genetic reagents generated in this study are available upon request. gRNAs sequences used:

cac^HaloTag-N / cac^Td-Tomato-N: CATCGCTTAGCTGATAGAATGG
stj^V5-N: GCTGGCTGCAGATTGACGCACGG
stolid^V5-N: ATTTGTTGCATTCGCCGATCAGG
Ca-β ^V5-C: CTCCGCAGATCCCGCGCGTCTGG

Immunostaining

Request a detailed protocol

All antibodies used, associated fixation methods, and incubation times can be found in Supplementary file 1b. Male wandering third-instar larvae were dissected in ice-cold saline and fixed either for 6 min at room temperature with Bouin’s fixative, 5 min on ice with 100% methanol, or 30 min at room temperature (RT) in 4% PFA. Dissections were permeabilized with PTX (PBS with 0.1% Triton-X 100) and blocked for 1 hr at RT using 5% goat serum and 1% bovine serum albumin. Stained larvae were mounted in Vectashield (Vector Laboratories, #H-1000) under Fisherbrand coverglass (Fisher Scientific, #12541B) for confocal microscopy, with Prolong glass mounting medium (Thermo Fisher Scientific, #P36980) under Zeiss High Performance Coverglass (Zeiss, #474030-9000-000) for super-resolution optical reassignment microscopy, or buffer (see STORM imaging and analysis section) under Zeiss coverglass with edges sealed using vacuum grease for STORM microscopy.

Ca²⁺ imaging and analysis

Request a detailed protocol

Functional imaging was performed on a Nikon A1R resonant scanning confocal mounted on a FN1 microscope using a Nikon Apo LWD 25x1.1 NA objective and a Mad City Labs piezo drive nosepiece. Dissections and data collection were performed as previously described in Gratz et al., 2019. Briefly, cac^Td-Tomato-N; Mhc-GCaMP6f male 3rd instar larvae were dissected in HL3 containing 0.2 mM Ca²⁺ and 25 mM Mg²⁺ with motor axons severed and the larval brain removed. Larval filets were placed in HL3 containing 1.5 mM Ca²⁺ and 25 mM Mg²⁺ for recording. Nerves were suctioned into 1.5 mm pipettes and stimulus amplitude was adjusted to recruit both type Ib and Is inputs. Motor terminals from segments A2-4 at NMJ 6/7 were imaged for Cac^Td-Tomato-N levels first using a galvanometer scanner, then a resonant scanner to collect GCaMP6f events in a single focal plane continuously for 120 stimulations at a 0.2 Hz stimulation frequency.

Z-stacks and movies were loaded into Nikon Elements Software (NIS) where movies were motion corrected, background subtracted, and denoised. Change in fluorescence (ΔF) movies were then created by subtracting the average of the previous 10 frames from each frame. A substack of only stimulation frames was further processed using a gaussian filter followed by the Bright Spots detection module in the Nikon GA3 software to identify the location of each postsynaptic event. Cac^Td-Tomato-N fluorescence intensity levels and coordinate locations were measured for 531 AZs for type Ib and 365 AZs for type Is terminals across six animals. X-Y coordinate positions of fluorescent signals from GCaMP6f postsynaptic events were aligned to Cac^Td-Tomato-N puncta locations and each post synaptic event assigned to a Cac punctum using nearest neighbor analysis. Postsynaptic events that did not map within 960 nm of a Cac^Td-Tomato-N punctum were discarded from the analysis. Pearson’s correlation was used to determine the correlation between P_r and Cac levels normalized to average to account for variability between imaging sessions. Cac intensity-P_r heat maps were generated using Python matplotlib and seaborn plotting packages.

STORM imaging and analysis

Request a detailed protocol

STORM imaging was performed on a Nikon Eclipse Ti2 3D NSTORM with an Andor iXon Ultra camera, Nikon LUN-F 405/488/640 nm lasers, and a Nikon 100x1.49 NA objective. STORM buffer (10 mM MEA (pH 8.0), 3 U/mL pyranose oxidase, and 90 U/mL catalase, 10% (w/v) glucose, 10 mM sodium chloride, and 50 mM Tris hydrochloride) was made fresh each imaging day and pH adjusted to between 7.0–8.0 using acetic acid. cac^HaloTag-N NMJs were labeled as detailed in Supplementary file 1b and immediately imaged for HRP in 488 channel to identify type Ib and Is terminals. Cac^HaloTag-N was then imaged using the 640 nm laser line at 33 Hz for 5000 frames. 405 nm laser power was gradually increased over the course of imaging to compensate for run-down of blinking rates. A back aperture camera was used to ensure beam focus and position for each imaging session to ensure high signal to noise. Data were binned with a CCD minimum threshold of 100 and drift correction was applied using the NIS Software STORM package. ROIs of single boutons were drawn in NIS using HRP in the 488 nm channel followed by a DBSCAN analysis with criteria of 10 molecules within 50 nm to determine clusters. Positional coordinates of localizations within clusters from DBSCAN were exported from NIS and run through a Python script published with this manuscript. Using the implementation developed in Mrestani et al., 2021 as a starting point, we wrote custom code to use the alpha shapes component of the CGAL package (https://www.cgal.org), via a python wrapper (https://anaconda.org/conda-forge/cgal), to measure the area of Ca²⁺ channel clusters, the number of localizations, and calculate cluster density. To achieve an average lateral localization accuracy of ~30 nm, all localizations with >50 nm localization accuracy were removed prior to analysis. Using this custom code, Cac^HaloTag-N area was analyzed using an alpha value of 0.015, which controls the complexity of cluster boundaries (not restricted to be convex).

Confocal imaging and analysis

Request a detailed protocol

For quantitative AZ analysis of larval NMJs, dissections stained in the same dish were imaged on a Nikon Eclipse Ni A1R+confocal microscope using an Apo TIRF 60x1.49 NA oil-immersion objective for larval NMJs. NMJs containing both type Is and type Ib branches from muscles 6/7 in segments A2-4 were collected. ROIs were drawn using HRP staining to differentiate between type Ib and Is branches. To analyze individual AZs, Nikon Elements GA3 Software was used to process images with Gaussian and rolling ball filters and measure fluorescence intensity levels at individual puncta identified by the Bright Spots module. When experimental design allowed, Brp fluorescence signal was used to create a binary mask to aid in the identification of AZ ROIs for analysis. Otherwise, binary masks were created based on the fluorescence signal of the channel analyzed. Quantifications were conducted masked to genotype and/or treatment. Confocal fluorescence intensity level data are reported as the sum fluorescence intensity per AZ averaged over individual NMJs. For Figure 5, larvae were stained separately and imaged using a Nikon Plan-Apo 20x0.75 NA objective (ventral ganglia) or Apo TIRF 60x1.49 NA oil-immersion objective (NMJs). Super-resolution optical reassignment images were obtained on a Nikon CSU-W1 SoRa (Spinning Disk Super Resolution by Optical Pixel Reassignment) with a Photometrics Prime BSI sCMOS camera and a 60x1.49 NA oil-immersion objective. Images were acquired using Nikon NIS and deconvolved using Richardson-Lucy deconvolution with 15–20 iterations.

Electrophysiology

Request a detailed protocol

Current-clamp recordings were performed as previously described (Bruckner et al., 2017). Male third-instar larvae were dissected in HL3 (70 mM NaCl, 5 mM KCl, 15 mM MgCl2, 10 mM NaHCO3, 115 mM sucrose, 5 mM trehalose, 5 mM HEPES, pH 7.2) with 0.25 mM Ca²⁺. Recordings were performed in HL3 at the external Ca²⁺ concentration indicated. Sharp borosilicate electrodes filled with 3 M KCl were used to record from muscle 6 of abdominal segments A3 and A4. Recordings were conducted on a Nikon FN1 microscope using a 40x0.80 NA water-dipping objective and acquired using an Axoclamp 900 A amplifier, Digidata 1550B acquisition system, and pClamp 11.0.3 software (Molecular Devices). For each cell with an initial resting potential between −60 and −80 mV and input resistance ≥5 MΩ, mean miniature excitatory junctional potentials (mEJPs) were collected for 1 min in the absence of stimulation and analyzed using Mini Analysis (Synaptosoft). EJPs were generated by applying a stimulus to severed segmental nerves at a frequency of 0.2 Hz using an isolated pulse stimulator 2100 (A-M Systems). Stimulus amplitude was adjusted to consistently elicit compound responses from both type Ib and Is motor neurons. At least 25 consecutive EJPs were recorded for each cell and analyzed in pClamp to obtain mean amplitude. Quantal content was calculated for each recording as mean EJP amplitude divided by mean mEJP amplitude.

Acute homeostatic challenge

Request a detailed protocol

Acute PHP was induced by incubating semi-intact preparations in 20 µM Philanthotoxin-433 (Figure 4: PhTx; Santa Cruz, sc-255421, Lot B1417 and Figure 7: PhTx; Sigma Aldrich, P207-2, Lot MKCK7405) diluted in HL3 containing 0.4 mM Ca²⁺ for 10 min at room temperature (Frank et al., 2006). Control preparations were given a mock treatment. Following control and experimental treatment, dissections were completed, fixed in 4% PFA for 30 min (cac^sfGFP-N) or 100% ice-cold methanol on ice for 5 min (stj^V5-N), and stained in the same dish. Analyses of fluorescent intensity levels were performed as previously described in the Confocal imaging and analysis section.

Experimental design and statistical analysis

Request a detailed protocol

Statistical analyses were conducted in GraphPad Prism 9. Normality was determined by the D’Agostino–Pearson omnibus test. Comparisons of normally distributed data were conducted by Student’s t test (with Welch’s correction in the case of unequal variance) for single comparisons and ANOVA followed by Tukey’s test for multiple comparisons. For non-normally distributed data, the Mann–Whitney U test and Kruskal-Wallis test followed by Dunn’s multiple comparisons tests were used for single and multiple comparisons, respectively. Paired analysis of non-normally distributed data was conducted using Wilcoxon’s matched-pairs signed rank test. One-dimensional Pearson correlation coefficients (r) were used to compare intensity levels and neurotransmitter release probability. ANCOVA test was performed on all regression lines to determine if slopes were significantly different. Reported values are mean ± SEM. Sample size, statistical test, and p values for each comparison are reported in Supplementary file 1a. All source data, including statistical tests and raw images, can be found in the following Harvard Dataverse dataset https://doi.org/10.7910/DVN/GGP3UM.

Data availability

All source data, including statistical tests and raw images, can be found in the following Harvard Dataverse dataset https://doi.org/10.7910/DVN/GGP3UM.

The following data sets were generated

1. Audrey M
(2024) Harvard Dataverse
Source data for Medeiros et al., eLife Version of Record.

https://doi.org/10.7910/DVN/GGP3UM

References

(2018) Characterization of developmental and molecular factors underlying release heterogeneity at Drosophila synapses
eLife 7:e38268.

https://doi.org/10.7554/eLife.38268
- PubMed
- Google Scholar
1. Aldahabi M
2. Balint F
3. Holderith N
4. Lorincz A
5. Reva M
6. Nusser Z
(2022) Different priming states of synaptic vesicles underlie distinct release probabilities at hippocampal excitatory synapses
Neuron 110:4144–4161.

https://doi.org/10.1016/j.neuron.2022.09.035
- PubMed
- Google Scholar
1. Aponte-Santiago NA
2. Littleton JT
(2020) Synaptic properties and plasticity mechanisms of invertebrate tonic and phasic neurons
Frontiers in Physiology 11:611982.

https://doi.org/10.3389/fphys.2020.611982
- PubMed
- Google Scholar
(2020) Synaptic plasticity induced by differential manipulation of tonic and phasic motoneurons in Drosophila
The Journal of Neuroscience 40:6270–6288.

https://doi.org/10.1523/JNEUROSCI.0925-20.2020
- PubMed
- Google Scholar
1. Ariel P
2. Hoppa MB
3. Ryan TA
(2012) Intrinsic variability in Pv, RRP size, Ca(2+) channel repertoire, and presynaptic potentiation in individual synaptic boutons
Frontiers in Synaptic Neuroscience 4:9.

https://doi.org/10.3389/fnsyn.2012.00009
- PubMed
- Google Scholar
(1993) Differential ultrastructure of synaptic terminals on ventral longitudinal abdominal muscles in Drosophila larvae
Journal of Neurobiology 24:1008–1024.

https://doi.org/10.1002/neu.480240803
- PubMed
- Google Scholar
1. Atwood HL
2. Karunanithi S
(2002) Diversification of synaptic strength: presynaptic elements
Nature Reviews. Neuroscience 3:497–516.

https://doi.org/10.1038/nrn876
- PubMed
- Google Scholar
(2010) A new look at calcium channel alpha2delta subunits
Current Opinion in Neurobiology 20:563–571.

https://doi.org/10.1016/j.conb.2010.05.007
- Google Scholar
1. Böhme MA
2. Beis C
3. Reddy-Alla S
4. Reynolds E
5. Mampell MM
6. Grasskamp AT
7. Lützkendorf J
8. Bergeron DD
9. Driller JH
10. Babikir H
11. Göttfert F
12. Robinson IM
13. O’Kane CJ
14. Hell SW
15. Wahl MC
16. Stelzl U
17. Loll B
18. Walter AM
19. Sigrist SJ
(2016) Active zone scaffolds differentially accumulate Unc13 isoforms to tune Ca(2+) channel-vesicle coupling
Nature Neuroscience 19:1311–1320.

https://doi.org/10.1038/nn.4364
- PubMed
- Google Scholar
1. Böhme MA
2. McCarthy AW
3. Grasskamp AT
4. Beuschel CB
5. Goel P
6. Jusyte M
7. Laber D
8. Huang S
9. Rey U
10. Petzoldt AG
11. Lehmann M
12. Göttfert F
13. Haghighi P
14. Hell SW
15. Owald D
16. Dickman D
17. Sigrist SJ
18. Walter AM
(2019) Rapid active zone remodeling consolidates presynaptic potentiation
Nature Communications 10:1085.

https://doi.org/10.1038/s41467-019-08977-6
- PubMed
- Google Scholar
1. Branco T
2. Staras K
(2009) The probability of neurotransmitter release: variability and feedback control at single synapses
Nature Reviews. Neuroscience 10:373–383.

https://doi.org/10.1038/nrn2634
- PubMed
- Google Scholar
1. Bruckner JJ
2. Zhan H
3. Gratz SJ
4. Rao M
5. Ukken F
6. Zilberg G
7. O’Connor-Giles KM
(2017) Fife organizes synaptic vesicles and calcium channels for high-probability neurotransmitter release
The Journal of Cell Biology 216:231–246.

https://doi.org/10.1083/jcb.201601098
- PubMed
- Google Scholar
1. Campiglio M
2. Flucher BE
(2015) The role of auxiliary subunits for the functional diversity of voltage-gated calcium channels
Journal of Cellular Physiology 230:2019–2031.

https://doi.org/10.1002/jcp.24998
- PubMed
- Google Scholar
(2004) Presynaptic Ca2+ channels compete for channel type-preferring slots in altered neurotransmission arising from Ca2+ channelopathy
Neuron 43:387–400.

https://doi.org/10.1016/j.neuron.2004.07.014
- PubMed
- Google Scholar
1. Cassidy JS
2. Ferron L
3. Kadurin I
4. Pratt WS
5. Dolphin AC
(2014) Functional exofacially tagged N-type calcium channels elucidate the interaction with auxiliary α2δ-1 subunits
PNAS 111:8979–8984.

https://doi.org/10.1073/pnas.1403731111
- PubMed
- Google Scholar
1. Chen Z
2. Das B
3. Nakamura Y
4. DiGregorio DA
5. Young SM
(2015) Ca2+ channel to synaptic vesicle distance accounts for the readily releasable pool kinetics at a functionally mature auditory synapse
The Journal of Neuroscience 35:2083–2100.

https://doi.org/10.1523/JNEUROSCI.2753-14.2015
- PubMed
- Google Scholar
1. Cingolani LA
2. Thalhammer A
3. Jaudon F
4. Muià J
5. Baj G
(2023) Nanoscale organization of Ca_V2.1 splice isoforms at presynaptic terminals: implications for synaptic vesicle release and synaptic facilitation
Biological Chemistry 404:931–937.

https://doi.org/10.1515/hsz-2023-0235
- PubMed
- Google Scholar
(2022) Regulation of presynaptic Ca²⁺ channel abundance at active zones through a balance of delivery and turnover
eLife 11:78648.

https://doi.org/10.7554/eLife.78648
- PubMed
- Google Scholar
1. Dai Y
2. Taru H
3. Deken SL
4. Grill B
5. Ackley B
6. Nonet ML
7. Jin Y
(2006) SYD-2 Liprin-alpha organizes presynaptic active zone formation through ELKS
Nature Neuroscience 9:1479–1487.

https://doi.org/10.1038/nn1808
- PubMed
- Google Scholar
1. Dannhäuser S
2. Mrestani A
3. Gundelach F
4. Pauli M
5. Komma F
6. Kollmannsberger P
7. Sauer M
8. Heckmann M
9. Paul MM
(2022) Endogenous tagging of Unc-13 reveals nanoscale reorganization at active zones during presynaptic homeostatic potentiation
Frontiers in Cellular Neuroscience 16:1074304.

https://doi.org/10.3389/fncel.2022.1074304
- PubMed
- Google Scholar
1. Davis GW
2. Müller M
(2015) Homeostatic control of presynaptic neurotransmitter release
Annual Review of Physiology 77:251–270.

https://doi.org/10.1146/annurev-physiol-021014-071740
- PubMed
- Google Scholar
(2008) Mutations in a Drosophila alpha2delta voltage-gated calcium channel subunit reveal a crucial synaptic function
The Journal of Neuroscience 28:31–38.

https://doi.org/10.1523/JNEUROSCI.4498-07.2008
- PubMed
- Google Scholar
1. Dolphin AC
(2018) Voltage-gated calcium channel α2δ subunits: an assessment of proposed novel roles
F1000Research 7:1830.

https://doi.org/10.12688/f1000research.16104.1
- Google Scholar
1. Dolphin AC
2. Lee A
(2020) Presynaptic calcium channels: specialized control of synaptic neurotransmitter release
Nature Reviews. Neuroscience 21:213–229.

https://doi.org/10.1038/s41583-020-0278-2
- PubMed
- Google Scholar
1. Dong W
2. Radulovic T
3. Goral RO
4. Thomas C
5. Suarez Montesinos M
6. Guerrero-Given D
7. Hagiwara A
8. Putzke T
9. Hida Y
10. Abe M
11. Sakimura K
12. Kamasawa N
13. Ohtsuka T
14. Young SM
(2018) CAST/ELKS proteins control voltage-gated Ca²⁺ channel density and synaptic release probability at a mammalian central synapse
Cell Reports 24:284–293.

https://doi.org/10.1016/j.celrep.2018.06.024
- PubMed
- Google Scholar
(2011) Nanodomain coupling between Ca²⁺ channels and sensors of exocytosis at fast mammalian synapses
Nature Reviews. Neuroscience 13:7–21.

https://doi.org/10.1038/nrn3125
- PubMed
- Google Scholar
1. Ehmann N
2. van de Linde S
3. Alon A
4. Ljaschenko D
5. Keung XZ
6. Holm T
7. Rings A
8. DiAntonio A
9. Hallermann S
10. Ashery U
11. Heckmann M
12. Sauer M
13. Kittel RJ
(2014) Quantitative super-resolution imaging of Bruchpilot distinguishes active zone states
Nature Communications 5:4650.

https://doi.org/10.1038/ncomms5650
- PubMed
- Google Scholar
1. Fedchyshyn MJ
2. Wang LY
(2005) Developmental transformation of the release modality at the calyx of Held synapse
The Journal of Neuroscience 25:4131–4140.

https://doi.org/10.1523/JNEUROSCI.0350-05.2005
- PubMed
- Google Scholar
1. Fekete A
2. Nakamura Y
3. Yang YM
4. Herlitze S
5. Mark MD
6. DiGregorio DA
7. Wang LY
(2019) Underpinning heterogeneity in synaptic transmission by presynaptic ensembles of distinct morphological modules
Nature Communications 10:826.

https://doi.org/10.1038/s41467-019-08452-2
- PubMed
- Google Scholar
1. Fouquet W
2. Owald D
3. Wichmann C
4. Mertel S
5. Depner H
6. Dyba M
7. Hallermann S
8. Kittel RJ
9. Eimer S
10. Sigrist SJ
(2009) Maturation of active zone assembly by Drosophila Bruchpilot
The Journal of Cell Biology 186:129–145.

https://doi.org/10.1083/jcb.200812150
- PubMed
- Google Scholar
1. Frank CA
2. Kennedy MJ
3. Goold CP
4. Marek KW
5. Davis GW
(2006) Mechanisms underlying the rapid induction and sustained expression of synaptic homeostasis
Neuron 52:663–677.

https://doi.org/10.1016/j.neuron.2006.09.029
- Google Scholar
1. Frank CA
(2014) Homeostatic plasticity at the Drosophila neuromuscular junction
Neuropharmacology 78:63–74.

https://doi.org/10.1016/j.neuropharm.2013.06.015
- Google Scholar
1. Früh SM
2. Matti U
3. Spycher PR
4. Rubini M
5. Lickert S
6. Schlichthaerle T
7. Jungmann R
8. Vogel V
9. Ries J
10. Schoen I
(2021) Site-specifically-labeled antibodies for super-resolution microscopy reveal in situ linkage errors
ACS Nano 15:12161–12170.

https://doi.org/10.1021/acsnano.1c03677
- PubMed
- Google Scholar
1. Fulterer A
2. Andlauer TFM
3. Ender A
4. Maglione M
5. Eyring K
6. Woitkuhn J
7. Lehmann M
8. Matkovic-Rachid T
9. Geiger JRP
10. Walter AM
11. Nagel KI
12. Sigrist SJ
(2018) Active zone scaffold protein ratios tune functional diversity across brain synapses
Cell Reports 23:1259–1274.

https://doi.org/10.1016/j.celrep.2018.03.126
- PubMed
- Google Scholar
1. Genç Ö
2. Davis GW
(2019) Target-wide induction and synapse type-specific robustness of presynaptic homeostasis
Current Biology 29:3863–3873.

https://doi.org/10.1016/j.cub.2019.09.036
- PubMed
- Google Scholar
1. Ghelani T
2. Escher M
3. Thomas U
4. Esch K
5. Lützkendorf J
6. Depner H
7. Maglione M
8. Parutto P
9. Gratz S
10. Matkovic-Rachid T
11. Ryglewski S
12. Walter AM
13. Holcman D
14. O’Connor Giles K
15. Heine M
16. Sigrist SJ
(2023) Interactive nanocluster compaction of the ELKS scaffold and Cacophony Ca²⁺ channels drives sustained active zone potentiation
Science Advances 9:eade7804.

https://doi.org/10.1126/sciadv.ade7804
- PubMed
- Google Scholar
(2014) Highly specific and efficient CRISPR/Cas9-catalyzed homology-directed repair in Drosophila
Genetics 196:961–971.

https://doi.org/10.1534/genetics.113.160713
- PubMed
- Google Scholar
(2019) Endogenous tagging reveals differential regulation of Ca²⁺ channels at single active zones during presynaptic homeostatic potentiation and depression
The Journal of Neuroscience 39:2416–2429.

https://doi.org/10.1523/JNEUROSCI.3068-18.2019
- PubMed
- Google Scholar
1. Grimm JB
2. English BP
3. Chen J
4. Slaughter JP
5. Zhang Z
6. Revyakin A
7. Patel R
8. Macklin JJ
9. Normanno D
10. Singer RH
11. Lionnet T
12. Lavis LD
(2015) A general method to improve fluorophores for live-cell and single-molecule microscopy
Nature Methods 12:244–250.

https://doi.org/10.1038/nmeth.3256
- PubMed
- Google Scholar
1. Guerrero G
2. Reiff DF
3. Agarwal G
4. Ball RW
5. Borst A
6. Goodman CS
7. Isacoff EY
(2005) Heterogeneity in synaptic transmission along a Drosophila larval motor axon
Nature Neuroscience 8:1188–1196.

https://doi.org/10.1038/nn1526
- PubMed
- Google Scholar
1. Hallermann S
2. Kittel RJ
3. Wichmann C
4. Weyhersmüller A
5. Fouquet W
6. Mertel S
7. Owald D
8. Eimer S
9. Depner H
10. Schwärzel M
11. Sigrist SJ
12. Heckmann M
(2010) Naked dense bodies provoke depression
The Journal of Neuroscience 30:14340–14345.

https://doi.org/10.1523/JNEUROSCI.2495-10.2010
- PubMed
- Google Scholar
1. Hatt H
2. Smith DO
(1976) Non-uniform probabilities of quantal release at the crayfish neuromuscular junction
The Journal of Physiology 259:395–404.

https://doi.org/10.1113/jphysiol.1976.sp011472
- PubMed
- Google Scholar
1. He Y
2. Dupree J
3. Wang J
4. Sandoval J
5. Li J
6. Liu H
7. Shi Y
8. Nave KA
9. Casaccia-Bonnefil P
(2007) Crucial role of Drosophila neurexin in proper active zone apposition to postsynaptic densities, synaptic growth, and synaptic transmission
Neuron 55:217–230.

https://doi.org/10.1016/j.neuron.2007.06.029
- PubMed
- Google Scholar
1. He K
2. Han Y
3. Li X
4. Hernandez RX
5. Riboul DV
6. Feghhi T
7. Justs KA
8. Mahneva O
9. Perry S
10. Macleod GT
11. Dickman D
(2023) Physiologic and nanoscale distinctions define glutamatergic synapses in tonic vs phasic neurons
The Journal of Neuroscience 43:4598–4611.

https://doi.org/10.1523/JNEUROSCI.0046-23.2023
- PubMed
- Google Scholar
1. Heinrich L
2. Ryglewski S
(2020) Different functions of two putative Drosophila α₂δ subunits in the same identified motoneurons
Scientific Reports 10:13670.

https://doi.org/10.1038/s41598-020-69748-8
- PubMed
- Google Scholar
1. Held RG
2. Liu C
3. Kaeser PS
(2016) ELKS controls the pool of readily releasable vesicles at excitatory synapses through its N-terminal coiled-coil domains
eLife 5:e14862.

https://doi.org/10.7554/eLife.14862
- PubMed
- Google Scholar
1. Holderith N
2. Lorincz A
3. Katona G
4. Rózsa B
5. Kulik A
6. Watanabe M
7. Nusser Z
(2012) Release probability of hippocampal glutamatergic terminals scales with the size of the active zone
Nature Neuroscience 15:988–997.

https://doi.org/10.1038/nn.3137
- PubMed
- Google Scholar
(2019) The calcium channel subunit α₂δ-3 organizes synapses via an activity-dependent and autocrine BMP signaling pathway
Nature Communications 10:5575.

https://doi.org/10.1038/s41467-019-13165-7
- PubMed
- Google Scholar
1. Hoppa MB
2. Lana B
3. Margas W
4. Dolphin AC
5. Ryan TA
(2012) α2δ expression sets presynaptic calcium channel abundance and release probability
Nature 486:122–125.

https://doi.org/10.1038/nature11033
- PubMed
- Google Scholar
1. Horn C
2. Offen N
3. Nystedt S
4. Häcker U
5. Wimmer EA
(2003) piggyBac-based insertional mutagenesis and enhancer detection as a tool for functional insect genomics
Genetics 163:647–661.

https://doi.org/10.1093/genetics/163.2.647
- PubMed
- Google Scholar
(2019) Maintenance of homeostatic plasticity at the Drosophila neuromuscular synapse requires continuous IP(3)-directed signaling
eLife 08:e39643.

https://doi.org/10.7554/eLife.39643
- Google Scholar
(2023) Molecular logic of synaptic diversity between Drosophila tonic and phasic motoneurons
Neuron 111:3554–3569.

https://doi.org/10.1016/j.neuron.2023.07.019
- PubMed
- Google Scholar
1. Kanamori T
2. Kanai MI
3. Dairyo Y
4. Yasunaga K
5. Morikawa RK
6. Emoto K
(2013) Compartmentalized calcium transients trigger dendrite pruning in Drosophila sensory neurons
Science 340:1475–1478.

https://doi.org/10.1126/science.1234879
- PubMed
- Google Scholar
(2000) A temperature-sensitive paralytic mutant defines A primary synaptic calcium channel in Drosophila
The Journal of Neuroscience 20:4885–4889.

https://doi.org/10.1523/JNEUROSCI.20-13-04885.2000
- PubMed
- Google Scholar
1. Kittel RJ
2. Wichmann C
3. Rasse TM
4. Fouquet W
5. Schmidt M
6. Schmid A
7. Wagh DA
8. Pawlu C
9. Kellner RR
10. Willig KI
11. Hell SW
12. Buchner E
13. Heckmann M
14. Sigrist SJ
(2006) Bruchpilot promotes active zone assembly, Ca2+ channel clustering, and vesicle release
Science 312:1051–1054.

https://doi.org/10.1126/science.1126308
- PubMed
- Google Scholar
1. Kurdyak P
2. Atwood HL
3. Stewart BA
4. Wu CF
(1994) Differential physiology and morphology of motor axons to ventral longitudinal muscles in larval Drosophila
The Journal of Comparative Neurology 350:463–472.

https://doi.org/10.1002/cne.903500310
- PubMed
- Google Scholar
(2009) Presynaptic alpha2delta-3 is required for synaptic morphogenesis independent of its Ca2+-channel functions
Nature Neuroscience 12:1415–1423.

https://doi.org/10.1038/nn.2417
- PubMed
- Google Scholar
1. Laghaei R
2. Ma J
3. Tarr TB
4. Homan AE
5. Kelly L
6. Tilvawala MS
7. Vuocolo BS
8. Rajasekaran HP
9. Meriney SD
10. Dittrich M
(2018) Transmitter release site organization can predict synaptic function at the neuromuscular junction
Journal of Neurophysiology 119:1340–1355.

https://doi.org/10.1152/jn.00168.2017
- PubMed
- Google Scholar
1. Li X
2. Goel P
3. Wondolowski J
4. Paluch J
5. Dickman D
(2018) A glutamate homeostat controls the presynaptic inhibition of neurotransmitter release
Cell Reports 23:1716–1727.

https://doi.org/10.1016/j.celrep.2018.03.130
- PubMed
- Google Scholar
(2013) Alternative splicing: functional diversity among voltage-gated calcium channels and behavioral consequences
Biochimica et Biophysica Acta 1828:1522–1529.

https://doi.org/10.1016/j.bbamem.2012.09.018
- PubMed
- Google Scholar
1. Lipscombe D
2. Lopez Soto EJ
(2019) Alternative splicing of neuronal genes: new mechanisms and new therapies
Current Opinion in Neurobiology 57:26–31.

https://doi.org/10.1016/j.conb.2018.12.013
- PubMed
- Google Scholar
1. Littleton JT
2. Ganetzky B
(2000) Ion channels and synaptic organization
Neuron 26:35–43.

https://doi.org/10.1016/S0896-6273(00)81135-6
- Google Scholar
1. Liu KSY
2. Siebert M
3. Mertel S
4. Knoche E
5. Wegener S
6. Wichmann C
7. Matkovic T
8. Muhammad K
9. Depner H
10. Mettke C
11. Bückers J
12. Hell SW
13. Müller M
14. Davis GW
15. Schmitz D
16. Sigrist SJ
(2011) RIM-binding protein, a central part of the active zone, is essential for neurotransmitter release
Science 334:1565–1569.

https://doi.org/10.1126/science.1212991
- PubMed
- Google Scholar
1. Liu C
2. Bickford LS
3. Held RG
4. Nyitrai H
5. Südhof TC
6. Kaeser PS
(2014) The active zone protein family ELKS supports Ca2+ influx at nerve terminals of inhibitory hippocampal neurons
The Journal of Neuroscience 34:12289–12303.

https://doi.org/10.1523/JNEUROSCI.0999-14.2014
- PubMed
- Google Scholar
1. Liu S
2. Hoess P
3. Ries J
(2022) Super-resolution microscopy for structural cell biology
Annual Review of Biophysics 51:301–326.

https://doi.org/10.1146/annurev-biophys-102521-112912
- PubMed
- Google Scholar
1. Lnenicka GA
2. Keshishian H
(2000)
Identified motor terminals in Drosophila larvae show distinct differences in morphology and physiology

Journal of Neurobiology 43:186–197.
- PubMed
- Google Scholar
1. Los GV
2. Encell LP
3. McDougall MG
4. Hartzell DD
5. Karassina N
6. Zimprich C
7. Wood MG
8. Learish R
9. Ohana RF
10. Urh M
11. Simpson D
12. Mendez J
13. Zimmerman K
14. Otto P
15. Vidugiris G
16. Zhu J
17. Darzins A
18. Klaubert DH
19. Bulleit RF
20. Wood KV
(2008) HaloTag: a novel protein labeling technology for cell imaging and protein analysis
ACS Chemical Biology 3:373–382.

https://doi.org/10.1021/cb800025k
- PubMed
- Google Scholar
1. Lu Z
2. Chouhan AK
3. Borycz JA
4. Lu Z
5. Rossano AJ
6. Brain KL
7. Zhou Y
8. Meinertzhagen IA
9. Macleod GT
(2016) High-probability neurotransmitter release sites represent an energy-efficient design
Current Biology 26:2562–2571.

https://doi.org/10.1016/j.cub.2016.07.032
- Google Scholar
1. Ly CV
2. Yao C-K
3. Verstreken P
4. Ohyama T
5. Bellen HJ
(2008) straightjacket is required for the synaptic stabilization of cacophony, a voltage-gated calcium channel alpha1 subunit
The Journal of Cell Biology 181:157–170.

https://doi.org/10.1083/jcb.200712152
- PubMed
- Google Scholar
1. Macleod GT
2. Chen L
3. Karunanithi S
4. Peloquin JB
5. Atwood HL
6. McRory JE
7. Zamponi GW
8. Charlton MP
(2006) The Drosophila cacts2 mutation reduces presynaptic Ca2+ entry and defines an important element in Cav2.1 channel inactivation
The European Journal of Neuroscience 23:3230–3244.

https://doi.org/10.1111/j.1460-9568.2006.04873.x
- PubMed
- Google Scholar
(2020) Assembly of synaptic active zones requires phase separation of scaffold molecules
Nature 588:454–458.

https://doi.org/10.1038/s41586-020-2942-0
- PubMed
- Google Scholar
1. Medeiros AT
2. O’Connor-Giles K
(2023) To Ib or not to b: Transcriptional regulation of tonic type Ib vs. phasic type Is motor neurons
Neuron 111:3497–3499.

https://doi.org/10.1016/j.neuron.2023.10.033
- PubMed
- Google Scholar
(2013) Spontaneous and evoked release are independently regulated at individual active zones
The Journal of Neuroscience 33:17253–17263.

https://doi.org/10.1523/JNEUROSCI.3334-13.2013
- PubMed
- Google Scholar
1. Miki T
2. Kaufmann WA
3. Malagon G
4. Gomez L
5. Tabuchi K
6. Watanabe M
7. Shigemoto R
8. Marty A
(2017) Numbers of presynaptic Ca²⁺ channel clusters match those of functionally defined vesicular docking sites in single central synapses
PNAS 114:E5246–E5255.

https://doi.org/10.1073/pnas.1704470114
- PubMed
- Google Scholar
1. Mrestani A
2. Pauli M
3. Kollmannsberger P
4. Repp F
5. Kittel RJ
6. Eilers J
7. Doose S
8. Sauer M
9. Sirén A-L
10. Heckmann M
11. Paul MM
(2021) Active zone compaction correlates with presynaptic homeostatic potentiation
Cell Reports 37:109770.

https://doi.org/10.1016/j.celrep.2021.109770
- PubMed
- Google Scholar
(1999) Calcium entry related to active zones and differences in transmitter release at phasic and tonic synapses
The Journal of Neuroscience 19:8419–8434.

https://doi.org/10.1523/JNEUROSCI.19-19-08419.1999
- PubMed
- Google Scholar
1. Muhammad K
2. Reddy-Alla S
3. Driller JH
4. Schreiner D
5. Rey U
6. Böhme MA
7. Hollmann C
8. Ramesh N
9. Depner H
10. Lützkendorf J
11. Matkovic T
12. Götz T
13. Bergeron DD
14. Schmoranzer J
15. Goettfert F
16. Holt M
17. Wahl MC
18. Hell SW
19. Scheiffele P
20. Walter AM
21. Loll B
22. Sigrist SJ
(2015) Presynaptic spinophilin tunes neurexin signalling to control active zone architecture and function
Nature Communications 6:8362.

https://doi.org/10.1038/ncomms9362
- PubMed
- Google Scholar
1. Müller CS
2. Haupt A
3. Bildl W
4. Schindler J
5. Knaus H-G
6. Meissner M
7. Rammner B
8. Striessnig J
9. Flockerzi V
10. Fakler B
11. Schulte U
(2010) Quantitative proteomics of the Cav2 channel nano-environments in the mammalian brain
PNAS 107:14950–14957.

https://doi.org/10.1073/pnas.1005940107
- PubMed
- Google Scholar
1. Nakamura Y
2. Harada H
3. Kamasawa N
4. Matsui K
5. Rothman JS
6. Shigemoto R
7. Silver RA
8. DiGregorio DA
9. Takahashi T
(2015) Nanoscale distribution of presynaptic Ca(2+) channels and its impact on vesicular release during development
Neuron 85:145–158.

https://doi.org/10.1016/j.neuron.2014.11.019
- PubMed
- Google Scholar
1. Newman ZL
2. Hoagland A
3. Aghi K
4. Worden K
5. Levy SL
6. Son JH
7. Lee LP
8. Isacoff EY
(2017) Input-specific plasticity and homeostasis at the Drosophila larval neuromuscular junction
Neuron 93:1388–1404.

https://doi.org/10.1016/j.neuron.2017.02.028
- PubMed
- Google Scholar
1. Newman ZL
2. Bakshinskaya D
3. Schultz R
4. Kenny SJ
5. Moon S
6. Aghi K
7. Stanley C
8. Marnani N
9. Li R
10. Bleier J
11. Xu K
12. Isacoff EY
(2022) Determinants of synapse diversity revealed by super-resolution quantal transmission and active zone imaging
Nature Communications 13:229.

https://doi.org/10.1038/s41467-021-27815-2
- PubMed
- Google Scholar
1. Oh KH
2. Xiong A
3. Choe J-Y
4. Richmond JE
5. Kim H
(2023) Active zone trafficking of CaV2/UNC-2 channels is independent of β/CCB-1 and α2δ/UNC-36 Subunits
The Journal of Neuroscience 43:5142–5157.

https://doi.org/10.1523/JNEUROSCI.2264-22.2023
- PubMed
- Google Scholar
(2024) FlyBase: updates to the Drosophila genes and genomes database
Genetics 227:iyad211.

https://doi.org/10.1093/genetics/iyad211
- PubMed
- Google Scholar
1. Paez-Segala MG
2. Sun MG
3. Shtengel G
4. Viswanathan S
5. Baird MA
6. Macklin JJ
7. Patel R
8. Allen JR
9. Howe ES
10. Piszczek G
11. Hess HF
12. Davidson MW
13. Wang Y
14. Looger LL
(2015) Fixation-resistant photoactivatable fluorescent proteins for CLEM
Nature Methods 12:215–218.

https://doi.org/10.1038/nmeth.3225
- PubMed
- Google Scholar
1. Peled ES
2. Isacoff EY
(2011) Optical quantal analysis of synaptic transmission in wild-type and rab3-mutant Drosophila motor axons
Nature Neuroscience 14:519–526.

https://doi.org/10.1038/nn.2767
- PubMed
- Google Scholar
(2014) Evoked and spontaneous transmission favored by distinct sets of synapses
Current Biology 24:484–493.

https://doi.org/10.1016/j.cub.2014.01.022
- PubMed
- Google Scholar
1. Peng IF
2. Wu CF
(2007) Drosophila cacophony channels: a major mediator of neuronal Ca2+ currents and a trigger for K+ channel homeostatic regulation
The Journal of Neuroscience 27:1072–1081.

https://doi.org/10.1523/JNEUROSCI.4746-06.2007
- PubMed
- Google Scholar
(1997) Genetic analysis of glutamate receptors in Drosophila reveals a retrograde signal regulating presynaptic transmitter release
Neuron 19:1237–1248.

https://doi.org/10.1016/s0896-6273(00)80415-8
- PubMed
- Google Scholar
1. Radulovic T
2. Dong W
3. Goral RO
4. Thomas CI
5. Veeraraghavan P
6. Montesinos MS
7. Guerrero-Given D
8. Goff K
9. Lübbert M
10. Kamasawa N
11. Ohtsuka T
12. Young SM Jr
(2020) Presynaptic development is controlled by the core active zone proteins CAST/ELKS
The Journal of Physiology 598:2431–2452.

https://doi.org/10.1113/JP279736
- PubMed
- Google Scholar
1. Rebola N
2. Reva M
3. Kirizs T
4. Szoboszlay M
5. Lőrincz A
6. Moneron G
7. Nusser Z
8. DiGregorio DA
(2019) Distinct nanoscale calcium channel and synaptic vesicle topographies contribute to the diversity of synaptic function
Neuron 104:693–710.

https://doi.org/10.1016/j.neuron.2019.08.014
- PubMed
- Google Scholar
1. Reddy-Alla S
2. Böhme MA
3. Reynolds E
4. Beis C
5. Grasskamp AT
6. Mampell MM
7. Maglione M
8. Jusyte M
9. Rey U
10. Babikir H
11. McCarthy AW
12. Quentin C
13. Matkovic T
14. Bergeron DD
15. Mushtaq Z
16. Göttfert F
17. Owald D
18. Mielke T
19. Hell SW
20. Sigrist SJ
21. Walter AM
(2017) Stable Positioning of Unc13 restricts synaptic vesicle fusion to defined release sites to promote synchronous neurotransmission
Neuron 95:1350–1364.

https://doi.org/10.1016/j.neuron.2017.08.016
- PubMed
- Google Scholar
1. Reuveny A
2. Shnayder M
3. Lorber D
4. Wang S
5. Volk T
(2018) Ma2/d promotes myonuclear positioning and association with the sarcoplasmic reticulum
Development 145:dev159558.

https://doi.org/10.1242/dev.159558
- Google Scholar
1. Risher WC
2. Kim N
3. Koh S
4. Choi J-E
5. Mitev P
6. Spence EF
7. Pilaz L-J
8. Wang D
9. Feng G
10. Silver DL
11. Soderling SH
12. Yin HH
13. Eroglu C
(2018) Thrombospondin receptor α2δ-1 promotes synaptogenesis and spinogenesis via postsynaptic Rac1
The Journal of Cell Biology 217:3747–3765.

https://doi.org/10.1083/jcb.201802057
- PubMed
- Google Scholar
(2021) The decoy SNARE Tomosyn sets tonic versus phasic release properties and is required for homeostatic synaptic plasticity
eLife 10:e72841.

https://doi.org/10.7554/eLife.72841
- PubMed
- Google Scholar
(2021) Presynaptic α₂δ subunits are key organizers of glutamatergic synapses
PNAS 118:e1920827118.

https://doi.org/10.1073/pnas.1920827118
- PubMed
- Google Scholar
1. Sheng J
2. He L
3. Zheng H
4. Xue L
5. Luo F
6. Shin W
7. Sun T
8. Kuner T
9. Yue DT
10. Wu L-G
(2012) Calcium-channel number critically influences synaptic strength and plasticity at the active zone
Nature Neuroscience 15:998–1006.

https://doi.org/10.1038/nn.3129
- PubMed
- Google Scholar
1. Smith LA
2. Wang X
3. Peixoto AA
4. Neumann EK
5. Hall LM
6. Hall JC
(1996) A Drosophila calcium channel alpha1 subunit gene maps to A genetic locus associated with behavioral and visual defects
The Journal of Neuroscience 16:7868–7879.

https://doi.org/10.1523/JNEUROSCI.16-24-07868.1996
- PubMed
- Google Scholar
1. Thomas GD
(2000) Effect of dose, molecular size, and binding affinity on uptake of antibodies
Methods in Molecular Medicine 25:115–132.

https://doi.org/10.1385/1-59259-075-6:115
- PubMed
- Google Scholar
1. Tong X-J
2. López-Soto EJ
3. Li L
4. Liu H
5. Nedelcu D
6. Lipscombe D
7. Hu Z
8. Kaplan JM
(2017) Retrograde synaptic inhibition is mediated by α-neurexin binding to the α2δ Subunits of N-type calcium channels
Neuron 95:326–340.

https://doi.org/10.1016/j.neuron.2017.06.018
- PubMed
- Google Scholar
1. Voigt A
2. Freund R
3. Heck J
4. Missler M
5. Obermair GJ
6. Thomas U
7. Heine M
(2016) Dynamic association of calcium channel subunits at the cellular membrane
Neurophotonics 3:041809.

https://doi.org/10.1117/1.NPh.3.4.041809
- PubMed
- Google Scholar
1. Wang LY
2. Augustine GJ
(2014) Presynaptic nanodomains: a tale of two synapses
Frontiers in Cellular Neuroscience 8:455.

https://doi.org/10.3389/fncel.2014.00455
- PubMed
- Google Scholar
1. Wang T
2. Jones RT
3. Whippen JM
4. Davis GW
(2016) α2δ-3 is required for rapid transsynaptic homeostatic signaling
Cell Reports 16:2875–2888.

https://doi.org/10.1016/j.celrep.2016.08.030
- PubMed
- Google Scholar
1. Weiss N
2. Zamponi GW
(2017) Trafficking of neuronal calcium channels
Neuronal Signaling 1:S20160003.

https://doi.org/10.1042/NS20160003
- PubMed
- Google Scholar
(2011) Rapid active zone remodeling during synaptic plasticity
The Journal of Neuroscience 31:6041–6052.

https://doi.org/10.1523/JNEUROSCI.6698-10.2011
- PubMed
- Google Scholar
1. Yazaki J
2. Kawashima Y
3. Ogawa T
4. Kobayashi A
5. Okoshi M
6. Watanabe T
7. Yoshida S
8. Kii I
9. Egami S
10. Amagai M
11. Hosoya T
12. Shiroguchi K
13. Ohara O
(2020) HaloTag-based conjugation of proteins to barcoding-oligonucleotides
Nucleic Acids Research 48:e8.

https://doi.org/10.1093/nar/gkz1086
- PubMed
- Google Scholar
1. Zhang Y
2. Wang T
3. Cai Y
4. Cui T
5. Kuah M
6. Vicini S
7. Wang T
(2023) Role of α2δ-3 in regulating calcium channel localization at presynaptic active zones during homeostatic plasticity
Frontiers in Molecular Neuroscience 16:1253669.

https://doi.org/10.3389/fnmol.2023.1253669
- PubMed
- Google Scholar

Article and author information

Author details

Audrey T Medeiros

Neuroscience Graduate Training Program, Brown University, Providence, United States

Contribution
Conceptualization, Resources, Data curation, Software, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-5562-4772
Scott J Gratz

Department of Neuroscience, Brown University, Providence, United States

Contribution
Conceptualization, Resources, Data curation, Software, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing

For correspondence
scott_gratz@brown.edu

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-0106-8336
Ambar Delgado

Department of Neuroscience, Brown University, Providence, United States

Contribution
Data curation, Formal analysis, Investigation, Writing – review and editing

Competing interests
No competing interests declared
Jason T Ritt
1. Department of Neuroscience, Brown University, Providence, United States
2. Carney Institute for Brain Science, Brown University, Providence, United States
Contribution
Software, Formal analysis, Methodology, Writing – review and editing

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0003-3113-7977
Kate M O'Connor-Giles
1. Neuroscience Graduate Training Program, Brown University, Providence, United States
2. Department of Neuroscience, Brown University, Providence, United States
3. Carney Institute for Brain Science, Brown University, Providence, United States
Contribution
Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Writing – original draft, Project administration, Writing – review and editing

For correspondence
kate_oconnor-giles@brown.edu

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-2259-8408

Funding

National Institute of Neurological Disorders and Stroke (R01NS078179)

Kate M O'Connor-Giles

National Institute of Neurological Disorders and Stroke (F31NS122424)

Audrey T Medeiros

Brown Neuroscience Graduate Program (T32 MH020068)

Audrey T Medeiros

The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank the Developmental Studies Hybridoma Bank, the Bloomington Drosophila Stock Center (NIH P40OD018537), Flybase (Öztürk-Çolak et al., 2024), Ehud Isacoff (UC Berkeley), and Stephan Sigrist (Freie Universität Berlin) for providing antibodies and fly stocks. The Nikon SoRa/STORM microscope was generously provided by The Neurobiology of Cells and Circuits/Center for Translational Neuroscience Microscopy Committee, Carney Institute for Brain Science. We are grateful to Joel Hirsch (Tel Aviv University) for consultations on tagging Ca-β, Nicholas Deakin (Nikon) for guidance on STORM imaging, the Heckmann lab (University of Würzburg) for guidance on STORM image analysis pipelines, Matthew Knoeppel for help generating CRISPR alleles, and Liana Lewis for her assistance with image analysis. We thank Rajan Thakur and the members of the O’Connor-Giles lab for thoughtful discussions and comments on the manuscript. This work was supported by grants from the National Institute of Neurological Disorders and Stroke, National Institutes of Health to KMOG (R01NS078179) and ATM (F31NS122424), Brown Neuroscience Graduate Program training grant T32 MH020068, and funds from the Brown University Carney Institute for Brain Science.

Version history

Preprint posted: April 10, 2023
Sent for peer review: May 2, 2023
Reviewed Preprint version 1: July 17, 2023
Reviewed Preprint version 2: July 18, 2024
Version of Record published: September 18, 2024

Cite all versions

You can cite all versions using the DOI https://doi.org/10.7554/eLife.88412. This DOI represents all versions, and will always resolve to the latest one.

Copyright

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.