Vacuolar H+-ATPase determines daughter cell fates through asymmetric segregation of the nucleosome remodeling and deacetylase complex
- Tsinghua-Peking Center for Life Sciences, Beijing Frontier Research Center for Biological Structure, McGovern Institute for Brain Research, State Key Laboratory of Membrane Biology, School of Life Sciences and MOE Key Laboratory for Protein Science, Tsinghua University, China
- State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, University of Chinese Academy of Sciences, China
- School of Medicine, Tsinghua University, China
Figures
Figure 1 with 5 supplements
Asymmetric segregation of nucleosome remodeling and deacetylase (NuRD) during asymmetric cell divisions (ACDs) of C. elegans Q neuroblast.
(A) Schematic of the Q neuroblast lineages. QL or QR neuroblast each generates three neurons and two apoptotic cells (Q.aa/Q.pp, X). QL produces PQR, PVM, and SDQL. QR produces AQR, AVM, and SDQR. (B…
Figure 1—figure supplement 1
Single-cell sequencing of the C. elegans embryonic cells.
(A) Schematic of the single-cell SPLiT-seq workflow for C. elegans embryonic cells. (B) Number of genes detected per cell is generated from exon, intron, and exon plus intron mapped reads. Each dot …
Figure 1—figure supplement 2
Asymmetric segregation of overexpressed nucleosome remodeling and deacetylase (NuRD) during asymmetric cell division (ACD) of QR.a.
Fluorescence time-lapse images of overexpressed GFP-tagged NuRD subunits and mCherry-tagged plasma membrane and histone during asymmetric divisions of QR.a cells. In each panel, the top row shows …
Figure 1—figure supplement 3
Asymmetric segregation of endogenous nucleosome remodeling and deacetylase (NuRD) during asymmetric cell divisions (ACDs) of Q cells.
(A) Representative images of HDA-1::GFP (top), LIN-53::mNeonGreen (middle), and MYS-1::GFP (down) during QR.a division. The anterior of the cell is on the left. In each panel, the top row shows …
Figure 1—figure supplement 4
Quantifications of asymmetric nucleosome remodeling and deacetylase (NuRD) segregation during asymmetric cell division (ACD).
(A) Schematics of the fluorescence quantification method. (B) Quantification of the fluorescence intensity ratio (MF1/MF2) changes of HDA-1, LIN-53, and MYS-1 in dividing Q cells. Data are presented …
Figure 1—figure supplement 5
Symmetric nucleosome remodeling and deacetylase (NuRD) segregation in pig-1 mutant.
(A) Representative images of HDA-1::GFP (left) and LIN-53::mNeonGreen (right) during asymmetric cell divisions (ACDs) of Q cells in pig-1 (gm344) mutant. In each panel, the top row shows merged …
Figure 2
Nucleosome remodeling and deacetylase (NuRD) asymmetry in C. elegans embryonic cell lineages.
(A) The tree visualization depicts the segregation of HDA-1::GFP and LIN-53::mNeonGreen between sister cells during embryonic development. In this tree structure, vertical lines represent cells and …
Figure 3 with 2 supplements
RNAi of hda-1 induces ectopic apoptosis and increases H3K27 acetylation of the egl-1 gene.
(A) Representative inverted fluorescence images show Phsp::sAnxV::GFP from ced-1(e1735) and ced-1(e1735); ced-3(n2433) embryos between late gastrulation and bean stage, treated with control RNAi or h…
Figure 3—figure supplement 1
RNAi of hda-1 and lin-53 reduce fluorescence of HDA-1::GFP and LIN-53::mNeonGreen and enhance H3K27 acetylation level.
(A) Representative inverted fluorescence images (top and middle) and bright-field images (bottom) of oocytes in HDA-1::GFP (left) and LIN-53::mNeonGreen (right) KI animals treated with control, hda-1…
Figure 3—figure supplement 2
HDA-1 regulates apoptotic cell fate through the canonical apoptosis pathway.
(A) Inverted fluorescence images of Phsp::sAnxV::GFP in ced-1(e1735), ced-1(e1735); ced-4(n1162), ced-1(e1735); ced-9(n1950), or ced-1(e1735); egl-1(n1084n3082) embryos between late gastrulation …
Figure 4 with 2 supplements
HAD-1 interacts with subunits of V-ATPase.
(A) The plot compares counts of proteins co-precipitated with HDA-1::GFP with those with the control ACT-4 (actin)::GFP. The PSM (Peptide-Spectrum Match) is the number of identified peptide spectra …
Figure 4—figure supplement 1
The composition of C. elegans nucleosome remodeling and deacetylase (NuRD) and NuRD subunits identified by co-IP and mass spectrometry.
(A) Upper: a schematic representation of the NuRD complex (Bracken et al., 2019; Lai and Wade, 2011). Lower: C. elegans homologs of NuRD subunits and their function. (B) Mass spectrometric analysis …
Figure 4—figure supplement 2
V-ATPase co-localizes with endoplasmic reticulum.
(A) Representative double-labeling images of VHA-17 and the ER marker SP12 (left) or the late endosomal marker RAB-7 (right) at metaphase and anaphase in dividing QR.a cells. Scale bar: 2 µm. (B) …
Figure 5 with 1 supplement
V-ATPase regulates nucleosome remodeling and deacetylase (NuRD) asymmetric segregation and cell fates.
(A) Dynamics of the cytosolic pH indicated by super-ecliptic pHluorin during QR.a division in DMSO- or BafA1-treated animals. In each panel, the top row shows mCherry-tagged plasma membrane and …
Figure 5—figure supplement 1
Quantile-quantile (Q–Q) plots for the data in Figures 1F, G, 3B, 5B, D, 6B.
The D'Agostino and Pearson and Shapiro–Wilk tests were performed to test the normal distribution of the datasets at 4 and 7 min, in Figure 1F. The Shapiro–Wilk tests were performed to test the …
Figure 6
V-ATPase distribution during asymmetric cell divisions (ACDs) and a model.
(A) Dynamics of VHA-17::wrmScarlet during QR.a cell division in DMSO- or BafA1-treated animals. VHA-17::wrmScarlet fluorescence is shown as inverted fluorescence images. Time 0 min is the onset of …
Videos
Video 1
Dynamics of CHD-3 during QR.a division.
Fluorescence time‐lapse movies of CHD-3::GFP (green) and mCherry-labeled plasma membrane and histone (magenta) in QR.a. Frames were taken every 1 min. The display rate is three frames per second. …
Video 2
Dynamics of MEP-1 during QR.a division.
Fluorescence time‐lapse movies of MEP-1::GFP (green) and mCherry-labeled plasma membrane and histone (magenta) in QR.a. Frames were taken every 1 min. The display rate is three frames per second. …
Video 3
Dynamics of HDA-1 during QR.a division.
Fluorescence time‐lapse movies of HDA-1::GFP (KI; green) and mCherry-labeled plasma membrane and histone (magenta) in QR.a. Frames were taken every 1 min. The display rate is three frames per …
Video 4
Dynamics of LIN-53 during QR.a division.
Fluorescence time‐lapse movies of LIN-53::mNeonGreen (KI; green) and mCherry-labeled plasma membrane and histone (magenta) in QR.a. Frames were taken every 1 min. The display rate is three frames …
Video 5
Dynamics of MYS-1 during QR.a division.
Fluorescence time‐lapse movies of MYS-1::GFP (green) and mCherry-labeled plasma membrane and histone (magenta) in QR.a. Frames were taken every 1 min. The display rate is three frames per second. …
Video 6
Dynamics of HDA-1 during QR.a division in the pig-1 mutant.
Fluorescence time‐lapse movies of HDA-1::GFP (KI; green) and mCherry-labeled plasma membrane and histone (magenta) during QR.a division in the pig-1 mutant. Frames were taken every 1 min. The …
Video 7
Dynamics of LIN-53 during QR.a division in the pig-1 mutant.
Fluorescence time‐lapse movies of LIN-53::mNeonGreen (KI; green) and mCherry-labeled plasma membrane and histone (magenta) during QR.a division in the pig-1 mutant. Frames were taken every 1 min. …
Video 8
Dynamics of super-ecliptic PHluorin during QR.a division.
Fluorescence time‐lapse movies of super-ecliptic PHluorin (green) and mCherry-labeled plasma membrane and histone (magenta) during QR.a division in DMSO and BafA1-treated animals. Frames were taken …
Video 9
BafA1 treatment disrupts HDA-1 asymmetry during QR.a division.
Fluorescence time‐lapse movies of HDA-1::GFP (KI; green) and mCherry-labeled plasma membrane and histone (magenta) during QR.a division in DMSO and BafA1-treated animals. Inverted fluorescence movie …
Video 10
Dynamics of VHA-17 during QR.a division.
Fluorescence time‐lapse movies of wrmScarlet-tagged VHA-17 (magenta) and HDA-1::GFP (KI; green) during QR.a division after DMSO or BafA1 treatments. Inverted fluorescence movie of VHA-17::wrmScarlet …
Tables
Table 1
C. elegans strains in this study.
| Strain name | Genotype | Method |
|---|---|---|
| N2 | Wild-type | N.A. |
| GOU4633 | cas1133[hda-1::TEV-S::gfp knock-in] V; ujIs113[Ppie-1::H2B::mCherry, Pnhr-2::HIS-24::mCherry, unc-119(+)] II | Microinjection |
| SYS1031 | sys1031[lin-53::mNeonGreen knock-in] I; ujIs113[Ppie-1::H2B::mCherry, Pnhr-2::HIS-24::mCherry, unc-119(+)] II | Microinjection |
| GOU4279 | cas1133; casIs165[Pegl‐17:: myri‐mCherry, Pegl‐17::mCherry‐TEV‐S::his‐24, unc‐76(+)] II | Genetic cross |
| GOU4277 | sys1031; casIs165 | Genetic cross |
| GOU4636 | casEX873[Phda-1::hda-1::gfp::unc-54 3’UTR, Pegl‐17:: myri‐mCherry, Pegl‐17::mCherry‐TEV‐S::his‐24] | Microinjection |
| GOU4635 | casEx874[Plin-53::lin-53::gfp::unc-54 3’UTR, Pegl‐17:: myri‐mCherry, Pegl‐17::mCherry‐TEV‐S::his‐24] | Microinjection |
| GOU4637 | casEx877[Pchd-3::chd-3::gfp::UNC-54 3’UTR, Pegl‐17:: myri‐mCherry, Pegl‐17::mCherry‐TEV‐S::his‐24] | Microinjection |
| GOU3631 | wgIs70[mep-1::TY1::EGFP::3xFLAG, unc-119(+)] III; casIs165[Pegl‐17:: myri‐mCherry, Pegl‐17::mCherry‐TEV‐S::his‐24, unc‐76(+)] II | Genetic cross |
| GOU4634 | casEX890[Pmys-1::mys-1::gfp-unc-54UTR,Pegl‐17:: myri‐mCherry, Pegl‐17::mCherry‐TEV‐S::his‐24] | Microinjection |
| CU3509 | ced-1(e1735) I; smIs76[Phsp-16.41::sAnxV::gfp] | Genetic cross |
| GOU3922 | ced-3(n2433) IV; ced-1(e1735) I; smIs76[Phsp-16.41::sAnxV::gfp] | Genetic cross |
| GOU3923 | ced-4(n1162) III; ced-1(e1735) I; smIs76 | Genetic cross |
| GOU3924 | ced-9(n1950) III; ced-1(e1735) I; smIs76 | Genetic cross |
| GOU3925 | egl-1(n1084n3082) V; ced-1(e1735) I; smIs76[Phsp-16.41::sAnxV::gfp] | Genetic cross |
| smIs89 | smIs89[Pegl-1::NLS::GFP] | Microinjection |
| GOU4285 | cas1133; casIs165; pig-1(gm344) | Genetic cross |
| GOU4281 | sys1031; casIs165; pig-1(gm344) | Genetic cross |
| GOU4287 | cas1133; casEx5309[Phsp-16.2::egl-20, Pegl‐17:: myri‐mCherry, Pegl‐17::mCherry‐TEV‐S::his‐24] | Genetic cross |
| GOU4283 | sys1031; casEx5309[Phsp-16.2::egl-20, Pegl‐17:: myri‐mCherry, Pegl‐17::mCherry‐TEV‐S::his‐24] | Genetic cross |
| GOU4638 | cas1133; him-5(e1490) V | Genetic cross |
| GOU4204 | sys1031; him-5(e1490) V | Genetic cross |
| GOU4607 | cas1589 [hda-1::GSlinker::degron::TEV-S::gfp knock-in];casIs165; casEx900[Pegl‐17:: TIR1::mRuby::unc-54 3’UTR,odr-1::gfp] | Microinjection |
| EX906 | casEx906 [Pegl-17::vha-17::wrmScarlet::unc-54 3’UTR;odr-1::gfp;Pegl-17::TIR1:unc-54 3’UTR];cas1589 | Microinjection |
| EX913 | casEx913[Pegl-17::sp12::gfp::unc-54 3’UTR;Pegl-17::vha-17::wrmScarlet::unc-54 3’UTR; odr-1::gfp] | Microinjection |
| SYB4702 | syb4702[gfp::rab-7 knock-in] | Microinjection: syb4702 was generated by Suny Biotech (http://www.sunybiotech.com/) using CRISPR-Cas9 |
| EX909 | casEx909[Pegl-17::vha-17::wrmScarlet::unc-54 3’UTR;odr-1::gfp]; syb4702 | Microinjection |
| EX910 | casEx910 [Pegl-17::super-ecliptic PHluorin::unc-54 3’UTR; odr-1::rfp]; casIs165 | Microinjection |
| EX911 | casEx910; syb4796 | Genetic cross |
Table 2
Genomic targets for CRISPR.
| Gene | CRISPR‐Cas9 targets (PAM) |
|---|---|
| hda-1 knock‐in | sg1: CTTCTACGATGGTGAGCGTGAGG |
| hda-1 knock‐in | sg2: GCAGCTCAGTTTGAGTCGGAAGG |
| lin-53 knock‐in | sg1: ATTTGCGACGCGATCTTCGGAGG |
| lin-53 knock‐in | Sg2: GGAGGTTCCATCTTCAAGAGTGG |
| vha-2 knock-in | sg1: ATCATTCCGACGAAGAGTCTTGG |
| vha-2 knock-in | sg2: GACGAAGAGTCTTGGCTGTTGGG |
| rab-7 knock‐in | sg1: TTTGAGCAGCGCCTTCTTTCTGG |
| rab-7 knock‐in | sg2: AATGTCGGGAACCAGAAAGAAGG |
Table 3
Plasmids and primers used in this study.
| Plasmids or PCR products | Forward primer | Reverse primer | Notes |
|---|---|---|---|
| pDD162-Peft‐3::Cas9+PU6::hda-1 sg1 | TCTACGATGGTGAGCGTGG TTTTAGAGCTAGAAATAGC | CGCTCACCATCGTAGAAG CAAGACATCTCGCAATAGGA | PCR from pDD162-Peft-3::Cas9+PU6::Empty sgRNA |
| pDD162-Peft-3::Cas9+PU6::hda-1 sg2 | AGCTCAGTTTGAGTCGGAG TTTTAGAGCTAGAAATAGC | CGACTCAAACTGAGCTGCC AAGACATCTCGCAATAGGA | PCR from pDD162-Peft-3::Cas9+PU6::Empty sgRNA |
| pPD95.77-hda-1–5’ arm::3’ arm knock-in | GTACCGGTAGAAAAAAT GAACTCAAACGGCCCGTT | GGAATTCTACGAATGCGAA TAAACCCTTGCGGCTT | The 5’ arm::hda-1::3’ arm sequences were amplified from N2 and cloned into pPD95.77 via In‐Fusion Advantage PCR Cloning Kit |
| pPD95.77-hda-1–5’ arm::TEV-S::gfp::3’ arm knock-in | GAACTATACAAATAGAACA CTAAAATGTGCCGCCG | CCGATCCCCCGGGCACT CTGTCTTCTGACGCTTTT | The TEV-S-gfp was cloned into pPD95.77-hda-1–5’ arm::3' arm knock-in via In-Fusion Advantage PCR Cloning Kit |
| pPD95.77-hda-1::TEV-S::gfp knock-in repair template | GATGGTGAGCGTGAAGGAGAT | CTTCACGCTCACCATCGTAG | PCR on pPD95.77-hda-1–5’ arm::TEV-S::gfp::3’arm knock-in plasmid to synonymously mutate the PAM sequence of sg2 |
| Pegl-17:: myri-mCherry | CTTCCGTTCTATGGAACACTC | GAATCATCGTTCA CTTTTCACGG | Pegl-17 promoter was amplified from N2 genomic DNA and inserted into the pDONR P4-P1R-mCherry plasmid via In-Fusion Advantage PCR Cloning Kit |
| Pegl-17::mCherry ::TEV-S::his-24 | CTTCCGTTCTATGGAACACTC | GAAGACGTTGAACG TCAAATTATC | Pegl-17 promoter was amplified from N2 genomic DNA and inserted into the pDONR P4-P1R-mCherry::TEV-S::his-24 plasmid via In-Fusion Advantage PCR Cloning Kit |
| linker::gfp::unc-54_3'UTR | AGACCCAAGCTTGGTACCA TGAGTAAAGGAGAAGAACTTTTCAC | AAGGGCCCGTACGGCC GACTAGTAGG | PCR from the plasmid pPD95.77 and then used as SOEing PCR template |
| Phda-1::hda-1 | CCAACTTCGACCTCACCCTC | GGTACCAAGCTTGGGTCTCTCT GTCTTCTGACGCTTTT | PCR from N2 genome and was then used as SOEing PCR template |
| Plin-53::lin-53 | AGCAAATGTTGCAGGGCTGTG | GGTACCAAGCTTGGGTCTCT GTTGTCTCTCTACCACAT | PCR from N2 genome and was then used as SOEing PCR template |
| Pchd-3::chd-3 | CACCTGTCCTTCGTGCCTATC | GGTACCAAGCTTGGGTCTAT ATCTCGGATAGGACGAACC | PCR from N2 genome and was then used as SOEing PCR template |
| Pmys-1::mys-1 | GCTCGTTATCAAGAAGGTCTCC | ACCAAGCTTGGGTCTGAA CATGATCTGCGCCTGAA | PCR from N2 genome and was then used as SOEing PCR template |
| Phda-1::hda-1::linker::gfp::unc-54_3'UTR | ACCAGTGCTCGACTTCGTGATG | GGAAACAGTTATGTTT GGTATATTGGG | SOEing PCR |
| Plin-53::lin-53::linker::gfp::unc-54_3'UTR | AGTCGGTCTTTGCGCTCAAC | GGAAACAGTTATGTTT GGTATATTGGG | SOEing PCR |
| Pchd-3::chd-3::linker::gfp::unc-54_3'UTR | GATCGTTGGTTAGG TCTCTCATGG | GGAAACAGTTATGTTT GGTATATTGGG | SOEing PCR |
| Pmys-1::mys-1::linker::gfp::unc-54_3'UTR | ATAAGAGCAAGAGT CAAGGCAGTC | GGAAACAGTTATGTTT GGTATATTGGG | SOEing PCR |
| egl-1 | GGCTACGAGATCGGCTCCAA | GAAGCATGGGCCGAGTAGGA | RT-qPCR |
| cdc-42 | GGAATGCTCGAGAAACTGGC | CAGTCCCTTCTGCGTCAAC | RT-qPCR |
| egl-1 TSS region | TAATCATCCTCATCAAGCCTGC | CACAGCTTCTCATTGCACGC | ChIP-qPCR |
| egl-1 gene body region | CTCTTCGGATCTTCTACCAATGTC | GAGTCGTCGGCAAATTGAGA | ChIP-qPCR |
| pPD95.77- Pegl-17::TIR1::mRuby::unc-54 3’UTR | ATGCAAAAGAGAATCGCCTTGT | AACAGTTATGTTTGGT ATATTGGGAATG | TIR1::mRuby::unc-54 3’UTR fragment was amplified from strain CA1210:IE28[dhc1::degron::gfp];ieSo57[Peft-3::TIR1::mRuby::unc-54 3'UTR.unc-119(+)]II |
| pPD95.77- Pegl-17::vha-17::wrmScarlet::unc-54 3’UTR | cccgaaatgtgagc tATGGGTATT CTCATTCCA CTCGTC | GCTACCACTTCCAGCGTTG TTGATTACGTTTGGTGCG | vha-17 genomic fragment was PCR from N2 genome and inserted into the pPD95.77- Pegl-17::wrmScarlet::unc-54 3’UTR plasmid via In-Fusion Advantage PCR Cloning Kit |
| pPD95.77-Pegl-17::sp12::gfp::unc-54 3’UTR | gcccgaaatgtgag ctATGGACG GAATGATTG CAATGC | GCTACCACTTCCAGCTTTC GTCTTCTTTGTCTCCTTTTTC | sp12 genomic fragment was PCR from N2 genome and inserted into the pPD95.77- Pegl-17::wrmScarlet::unc-54 3’UTR plasmid via In-Fusion Advantage PCR Cloning Kit |
| pPD95.77-Pegl-17::super-ecliptic PHluorin::unc-54 3’UTR | cccgaaatgtgagc tATGAGTAA AGGAGAAG AACTTTTCA | GAAGAGTAATTGGACCTATTTG TATAGTTCATCCATGCCA | Super-ecliptic PHluorin fragment was synthesized and inserted into the pPD95.77- Pegl-17::wrmScarlet::unc-54 3’UTR plasmid via In-Fusion Advantage PCR Cloning Kit |
Additional files
-
Supplementary file 1
Single-cell SPLiT-seq expression matrix and genes that were not detected from the Pegl-1-NLS-gfp-positive cells.
- https://cdn.elifesciences.org/articles/89032/elife-89032-supp1-v1.xlsx
-
Supplementary file 2
The fluorescence intensity ratio of each cell pair and normalized fluorescence intensity of each cell in embryonic lineage tracing assay.
- https://cdn.elifesciences.org/articles/89032/elife-89032-supp2-v1.xlsx
-
Supplementary file 3
Differential expression of RNA-seq under control, hda-1, or lin-53 RNAi.
- https://cdn.elifesciences.org/articles/89032/elife-89032-supp3-v1.xlsx
-
Supplementary file 4
Anti-GFP IP-MS results of HDA-1::GFP KI worms and ACT-4::GFP transgenic worms.
- https://cdn.elifesciences.org/articles/89032/elife-89032-supp4-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/89032/elife-89032-mdarchecklist1-v1.docx
