Mo-DCs were stimulated with viable or irradiated Mtb (iMtb) at two multiplicities of infection (1 or 2 Mtb per DC) for 24 hr. Glycolysis was measured as (A) lactate release in culture supernatants …
Monocyte-derived DCs (Mo-DCs) were stimulated with irradiated Mtb (iMtb) or infected with Mtb expressing red fluorescent protein (Mtb-RFP, panel C). (A) Representative histograms showing the …
Relative contributions of mitochondrial and FAO dependences to overall DC metabolism analyzed with SCENITH in DCs exposed or not to iMtb (N = 6). Paired t-test (***p<0.001) as depicted by lines. The …
Mo-DCs were stimulated with irradiated Mtb (iMtb) in the presence of neutralizing antibodies against either TLR2 (aTLR2), TLR4 (aTLR4), or their respective isotype controls. (A) Lactate release as …
(A, B) Mo-DCs were stimulated or not with LPS in the presence of neutralizing antibodies against either TLR2 (aTLR2) or TLR4 (aTLR4). (A) Lactate release measured in supernatant (N = 6). (B) Glucose …
(A–C) Monocyte-derived DCs (Mo-DCs) were stimulated with iMtb in the presence or absence of the HIF1A inhibitor PX-478 (PX). (A) Metabolic flux analysis showing quantification of mitochondrial ATP …
Monocyte-derived DCs (Mo-DCs) were stimulated with iMtb in the presence of PX-478 (PX, A–C) or echinomycin (Ech, D–F), both HIF1A inhibitors. (A, D) Lactate release measured in supernatant (N = …
Monocyte-derived DCs (Mo-DCs) were stimulated with iMtb in the presence or not of echinomycin (Ech), an HIF1A inhibitor. Mean fluorescence intensity (MFI) of CD83, CD86, and PD-L1 (N = 10). Two-way …
Monocytes from PPD+ healthy donors were differentiated toward dendritic cells (DCs), challenged or not with irradiated Mtb (iMtb) in the presence or not of PX-478, and co-cultured with autologous …
Monocyte-derived DCs (Mo-DCs) were treated (or not) with HIF1A inhibitor PX-478 (PX) or LDH inhibitor oxamate (OX) and stimulated with iMtb for 24 hr. (A) Lactate release as measured in supernatants …
(A, B) Monocyte-derived DCs (Mo-DCs) were treated or not with the glycolysis inhibitor GSK2837808A and stimulated with iMtb. (A) Lactate release (N = 5). (B) Chemotactic activity toward CCL21 (N = …
Tolerogenic Mo-DCs were generated by dexamethasone (Dx) treatment and were stimulated (or not) with irradiated Mycobacterium tuberculosis (iMtb) in the presence or absence of HIF1A activator …
Tolerogenic monocyte-derived DCs (Mo-DCs) were generated in the presence or not of Dx and stimulated with iMtb. (A) Mean fluorescence intensity (MFI) of CD83, CD86, and PD-L1 (N = 9). The data are …
(A) Monocytes from TB patients or healthy subjects (HS) were isolated and cultured with IL-4 and GM-CSF for 24 hr. Accumulation of lactate in culture supernatants were measured at 1 and 24 hr of …
The glycolytic capacity was assessed in monocyte subsets from tuberculosis (TB) patients with bilateral versus unilateral disease, reflecting the extent of disease (upper panels), or with cavitary …
(A) Ex vivo determination of HIF1A expression by monocytes from healthy subjects (HS) or TB patients (TB) for each monocyte subset (CD14+CD16-, CD14+CD16+, and CD14dimCD16+) (N = 6). (B, C) …
Monocytes from healthy subjects (HS) were treated with dimethyloxalylglycine (DMOG) during the first 24 hr of differentiation with IL-4/GM-CSF (earlyDMOG) and removed afterward. On day 6 of …
Working model showing that DCs enhance their glycolytic activity upon encountering M. tuberculosis, facilitating their migration to lymph nodes. Conversely, in CD16+ monocyte populations of patients …
Linear regression lines are shown. Spearman’s rank test. The data are represented as scatter plots with each circle representing a single individual.
Comparisons with a p-value of less than 0.05 and an FDR value of less than 0.25 are considered significantly different.
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Antibody | Anti-human TLR2 | BioLegend | Cat# 309717 | |
Antibody | Anti-human TLR4 | BioLegend | Cat# 312813 | |
Antibody | Anti-human CD1a | eBioscience | RRID:AB_467039 | |
Antibody | Anti-human DC-SIGN | R&D System | Cat# MAB161 | |
Antibody | Anti-human CD14 | BD Biosciences | Cat# 557154 | |
Antibody | Anti-human CD86 | BioLegend | Cat# 374216 | |
Antibody | Anti-human CD83 | eBioscience | Cat# 14-0839-82 | |
Antibody | Anti-human CD274 (B7-H1, PD-L1) | BD Pharmingen | Cat# 557924 | |
Antibody | Anti-human Glut1 | R&D System | Cat# MAB1418 | |
Antibody | Anti-human HIF1A | BioLegend | Cat# 359704 | |
Antibody | Anti-human CD4 | BioLegend | Cat# 357402 | |
Antibody | Anti-human CXCR3 | BioLegend | Cat# 353719 | |
Antibody | Anti-human CCR4 | BD Biosciences | Cat# 560726 | |
Antibody | Anti-human CCR6 | BD Biosciences | Cat# 560619 | |
Antibody | Anti-human CD3 | BioLegend | Cat# 300317 | |
Antibody | Anti-human CD16 | BioLegend | Cat# 302008 | |
Antibody | Anti-mouse CD11c | BD Pharmingen | Cat# 561044 | |
Biological sample (Mycobacterium tuberculosis) | M. tuberculosis H37Rv | N/A | N/A | |
Biological sample (M. tuberculosis) | Tuberculosis γ-irradiated H37Rv | BEI Resource | Cat# NR-49098 | |
Biological sample | Patients-derived blood | Hospital F.J.Muñiz (Buenos Aires, Argentina) | N/A | |
Biological sample | Buffy coats from healthy donors | Centro Regional de Hemoterapia Garrahan (Buenos Aires, Argentina) | N/A | |
Biological sample | Blood from PPD+ healthy donors | N/A | N/A | |
Peptide, recombinant protein | Recombinant human GM-CSF | Peprotech | Cat# 300-03 | |
Peptide, recombinant protein | Recombinant human IL-4 | BioLegend | Cat# 430307 | |
Peptide, recombinant protein | Recombinant mouse GM-CSF | BioLegend | Cat# 576304 | |
Peptide, recombinant protein | Recombinant mouse IL-4 | BioLegend | Cat# 574302 | |
Chemical compound, drug | Lipopolysaccharides from Escherichia coli O127:B8 | Sigma-Aldrich | Cat# 93572-42-0 | |
Chemical compound, drug | Dexamethasone | Sidus | Cat# 229197-1 | |
Chemical compound, drug | PX-478 2HCl | Selleck Chemicals | Cat# S7612 | |
Chemical compound, drug | DMOG | Bertin Technologies | Cat# 300-02 | |
Chemical compound, drug | GSK2837808A | Cayman Chemical | Cat# 1445879-21-9 | |
Chemical compound, drug | Echinomycin | Cayman Chemical | Cat# 512-64-1 | |
Chemical compound, drug | Sodium oxamate | Cayman Chemical | Cat# 565-73-1 | |
Peptide, recombinant protein | Recombinant Human Exodus-2 (CCL21) | Peprotech | Cat# 300-35A | |
Chemical compound, drug | Collagen from calf skin | Sigma-Aldrich | Cat# C9791-10MG | |
Commercial assay or kit | Lactate Kit | Wiener | Cat# 1999795 | |
Commercial assay or kit | Glicemia Enzimática AA Kit | Wiener | Cat# 1009803 | |
Commercial assay or kit | Perm2 solution | BD Biosciences | Cat# 340973 | |
Commercial assay or kit | Trizol reagent | Thermo Fisher Scientific | Cat# 15596026 | |
Commercial assay or kit | MitoSpy Green FM | BioLegend | Cat# 424805 | |
Commercial assay or kit | TNF alpha Human ELISA Kit | eBiosciences | Cat# BMS223-4 | |
Commercial assay or kit | IL-10 Human ELISA Kit | eBiosciences | Cat# BMS215-2 | |
Commercial assay or kit | IL-17A Human ELISA Kit | eBiosciences | Cat# 88-7176-22 | |
Commercial assay or kit | IFN gamma Human ELISA Kit | eBiosciences | Cat# BMS228 | |
Commercial assay or kit | Zombie Violet Fixable Viability Kit | BioLegend | Cat# 423113 | |
Commercial assay or kit | SCENITH | Gifted by Rafael Argüello | N/A | |
Sequence-based reagent | Primer: EEF1A1 Fwd: TCGGGCAAGTCCACCACTAC | Marín Franco et al., 2020 | N/A | |
Sequence-based reagent | Primer: EEF1A1 Rev: CCAAGACCCAGGCATACTTGA | Marín Franco et al., 2020 | N/A | |
Sequence-based reagent | Primer: HIF1A Fwd: ACTAGCCGAGGAAGAACTATGAA | Marín Franco et al., 2020 | N/A | |
Sequence-based reagent | Primer: HIF1A Rev: TACCCACACTGAGGTTGGTTA | Marín Franco et al., 2020 | N/A | |
Sequence-based reagent | Primer: LDHA Fwd: TGGGAGTTCACCCATTAAGC | Marín Franco et al., 2020 | N/A | |
Sequence-based reagent | Primer: LDHA Rev: AGCACTCTCAACCACCTGCT | Marín Franco et al., 2020 | N/A | |
Software, algorithm | ImageJ | ImageJ | https://imagej.nih.gov/ij/ | |
Software, algorithm | Prism (v5) | GraphPad | https://www.graphpad.com/ | |
Software, algorithm | FlowJo 7.6.5 | TreeStar | https://www.flowjo.com/ | |
Software, algorithm | FCS Express V3 | DeNovo Software | https://www.denovosoftware.com/ | |
Software, algorithm | Seahorse Wave | Agilent | https://www.agilent.com/ | |
Software, algorithm | CFX Maestro | Bio-Rad | https://www.bio-rad.com/ | |
Software, algorithm | Metamorph | Molecular Devices | https://www.moleculardevices.com/ |
Age, years (range) | 36 (19–67) |
---|---|
Gender, % (number/total) | M, 81% (31/38) F, 19% (7/38) |
Nationality, % (number/total) | Argentina, 76.31% (29/38) Bolivia, 15.78% (6/38) Paraguay, 2.63% (1/38) Peru, 5.26% (2/38) |
TB disease localization, % (number/total) | Pulmonary, 94% (36/38) Pulmonary + extrapulmonary, 6% (2/38) |
AFB* in sputum, % (number/total) | 3+, 21% (8/38) 2+, 13% (5/38) 1+, 52% (20/38) -, 13% (5/38) |
Leukocyte count, mean ± SEM, cell/µl | 8483 ± 509 |
Lymphocyte mean ± SEM, % | 19 ± 2 |
Monocyte mean ± SEM, % | 7 ± 0.5 |
Acid-fast-bacilli (AFB) in sputum: -, 1+, 2+, 3+ are defined according to the International Union Against Tuberculosis and Lung Disease (IUATLD)/World Health Organization (WHO) quantification scale.
- | iMtb | - | iMtb | |
Exp 1 | 12,7 | 30,1 | 1,45 | 10,30 |
Exp 2 | 4,7 | 7,3 | 6,68 | 13,43 |
Exp 3 | 16,77 | 25,67 | 6,74 | 18,98 |
Exp 4 | 2,34 | 21,33 | 0,12 | 3,02 |
Exp 5 | 9,8 | 31 | 1,46 | 6,03 |
Exp 6 | 12 | 25 | 1,00 | 20,70 |