Mecp2 fine-tunes quiescence exit by targeting nuclear receptors
- Guangdong Provincial Key Laboratory of Bone and Joint Degenerative Diseases, The Third Affiliated Hospital of Southern Medical University, China
- State Key Laboratory of Organ Failure Research, Department of Cell Biology, School of Basic Medical Sciences, Southern Medical University, China
- Department of Biochemistry, School of Basic Medical Sciences, Southern Medical University, China
Figures
Figure 1 with 1 supplement
Mecp2 is immediately decreased in the liver after partial hepatectomy (PHx).
(A) Real-time PCR to evaluate mRNA levels of Mecp2 at different time points after PHx. Data are presented as means ± SEM; n = 6. n.s., not significant; ****p<0.0001 by one-way ANOVA. (B) Western …
-
Figure 1—source data 1
Mecp2 is immediately decreased in the liver after partial hepatectomy (PHx).
- https://cdn.elifesciences.org/articles/89912/elife-89912-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Mecp2 is dynamically expressed during partial hepatectomy (PHx)-induced liver regeneration.
(A) Schematic for the PHx time course and data collection. Three phases of liver regeneration and the cell cycle progression of the first round of cell division after PHx are indicated by …
-
Figure 1—figure supplement 1—source data 1
Mecp2 is dynamically expressed during partial hepatectomy (PHx)-induced liver regeneration.
- https://cdn.elifesciences.org/articles/89912/elife-89912-fig1-figsupp1-data1-v1.xlsx
Figure 2 with 1 supplement
Mecp2 fine-tunes quiescence exit in hepatocytes after partial hepatectomy (PHx) in vivo.
(A–D) Liver regeneration in Mecpfl/fl and Mecp2 cKO mice after PHx. (A) Real-time PCR to measure mRNA levels of Mecp2. The effects and corresponding quantification of Mecp2 KO on quiescence exit and …
-
Figure 2—source data 1
Mecp2 fine-tunes quiescence exit in hepatocytes after partial hepatectomy (PHx) in vivo.
- https://cdn.elifesciences.org/articles/89912/elife-89912-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Modulation of Mecp2 expression in the mouse liver.
(A) Schematic diagram of loss of Mecp2 in mouse hepatocyte. In the Mecp2 floxed allele, Mecp2 exons 2 and 3 were flanked with loxp sites. The Neo-cassette was removed by mating with FLP recombinase …
-
Figure 2—figure supplement 1—source data 1
Modulation of Mecp2 expression in the mouse liver.
- https://cdn.elifesciences.org/articles/89912/elife-89912-fig2-figsupp1-data1-v1.xlsx
Figure 3 with 1 supplement
Mecp2 is immediately decreased during quiescence exit in cellular models.
(A, B) Representative histograms of propidium iodide (PI) staining of either asynchronized (Asyn) proliferating or starvation-induced quiescent 3T3 cells after serum restimulation (SR) in (A) and …
-
Figure 3—source data 1
Mecp2 is immediately decreased during quiescence exit in cellular models.
- https://cdn.elifesciences.org/articles/89912/elife-89912-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Mecp2 is dynamically expressed during quiescence exit in both HT22 and human umbilical vein endothelial cells (HUVECs).
Serum restimulation (SR)-induced (A–D, I–L) or contact inhibition loss (CIL)-induced (E–H, M–P) quiescence exits in mouse hippocampal neuronal HT22 cells (A–H) or in HUVECs (I–P) was analyzed by …
-
Figure 3—figure supplement 1—source data 1
Mecp2 is dynamically expressed during quiescence exit in both HT22 and human umbilical vein endothelial cells (HUVECs).
- https://cdn.elifesciences.org/articles/89912/elife-89912-fig3-figsupp1-data1-v1.xlsx
Figure 4 with 1 supplement
Mecp2 negatively regulates the G0/G1 transition in the cellular model of serum restimulation (SR)-induced quiescence exit.
(A) Real-time PCR showing the mRNA levels of Mecp2 in 3T3 cells transfected with negative control siRNA (NC si) or Mecp2 siRNA (Mecp2 si) at the early stages of SR-induced cell cycle reentry. Data …
-
Figure 4—source data 1
Mecp2 negatively regulates the G0/G1 transition in the cellular model of serum restimulation (SR)-induced quiescence exit.
- https://cdn.elifesciences.org/articles/89912/elife-89912-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Mecp2 negatively regulates the G0/G1 transition in the cellular model of serum restimulation (SR)-induced quiescence exit.
(A) Protein quantitation of MeCP2 protein expression normalized to β-actin for Figure 4B western blotting (WB). Data are presented as means ± SEM; n = 3. *p<0.05; ***p<0.001; ****p<0.0001 by two-way …
-
Figure 4—figure supplement 1—source data 1
Mecp2 negatively regulates the G0/G1 transition in the cellular model of serum restimulation (SR)-induced quiescence exit.
- https://cdn.elifesciences.org/articles/89912/elife-89912-fig4-figsupp1-data1-v1.xlsx
Figure 5 with 1 supplement
Nedd4 interacts with Mecp2 and affects quiescence exit by facilitating Mecp2 degradation.
(A) Reciprocal immunoprecipitation-western blotting (IP-WB) analysis to validate the interaction between endogenous Mecp2 and Nedd4. (B) Co-IP of Mecp2, ubiquitin, and Nedd4 in quiescent 3T3 cells …
-
Figure 5—source data 1
Nedd4 interacts with Mecp2 and affects quiescence exit by facilitating Mecp2 degradation.
- https://cdn.elifesciences.org/articles/89912/elife-89912-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Nedd4 interacts with Mecp2.
(A) Western blotting (WB) of Mecp2 in quiescent 3T3 cells treated with or without MG132 after being released from G0 by serum restimulation (SR). (B) WB of Mecp2 in quiescent 3T3 cells treated with …
-
Figure 5—figure supplement 1—source data 1
Nedd4 interacts with Mecp2.
- https://cdn.elifesciences.org/articles/89912/elife-89912-fig5-figsupp1-data1-v1.xlsx
Figure 6 with 1 supplement
Mecp2 transcriptionally regulates quiescence exit.
(A) Heatmap of Mecp2 direct target genes at the early stage of liver regeneration rank-ordered by their gene expression fold change. (B) The top 10 most significantly overrepresented Gene Ontology …
-
Figure 6—source data 1
Mecp2 transcriptionally regulates quiescence exit.
- https://cdn.elifesciences.org/articles/89912/elife-89912-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
Related to Figure 6.
(A) Schematic showing the definition of Mecp2-binding genes. Lower panel: distribution of Mecp2 peaks in defined promoter-proximal, gene body, and distal regions. TSS, transcriptional start site; …
-
Figure 6—figure supplement 1—source data 1
Raw data related to Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/89912/elife-89912-fig6-figsupp1-data1-v1.xlsx
Figure 7
Depletion of either Nr1h3 or Rara mimics the Mecp2 knockdown (KD) phenotype during quiescence exit.
(A) ChIP-qPCR analyses of Mecp2 at the promoter-proximal regions of Rara and Nr1h3 in Mecp2fl/fl and Mecp2-cKO livers before and 6 hr post-partial hepatectomy (PHx). (B–D) Either Nr1h3 or Rara KD …
-
Figure 7—source data 1
Depletion of either Nr1h3 or Rara mimics the Mecp2 KD phenotype during quiescence exit.
- https://cdn.elifesciences.org/articles/89912/elife-89912-fig7-data1-v1.xlsx
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | HUVEC | ATCC | Cat# CRL-1730 | |
| Cell line (H. sapiens) | LentiX-293T | ATCC | Cat# ACS-4500 | |
| Cell line (Mus musculus) | NIH3T3 | ATCC | Cat# SCSP-515 | |
| Cell line (M. musculus) | Ht22 | Procell Life Science&Technology | Cat# CL-0697 | |
| Antibody | Albumin (mouse monoclonal) | Proteintech | Cat# 66051-1-Ig; RRID:AB_11042320 | 1:100 |
| Antibody | β-Actin (mouse monoclonal) | Proteintech | Cat# 66009-1-Ig; RRID:AB_2687938 | 1:4000 |
| Antibody | Cyclin A2 (mouse monoclonal) | abcam | Cat# ab38; RRID:AB_304084 | 1:1000 |
| Antibody | Cyclin B1 (mouse monoclonal) | abcam | Cat# ab72; RRID:AB_305751 | 1:1000 |
| Antibody | Cyclin D1 (rabbit monoclonal) | abcam | Cat# ab16663; RRID:AB_443423 | 1:1000 |
| Antibody | Cyclin E1 (rabbit monoclonal) | Cell Signaling Technology | Cat# 20808; RRID:AB_2783554 | 1:1000 |
| Antibody | H3K27ac (rabbit polyclonal) | abcam | Cat# ab4729; RRID:AB_2118291 | 1:50 |
| Antibody | IgG (rabbit, IgG) | Cell Signaling Technology | Cat# 2729; RRID:AB_1031062 | 1:50 |
| Antibody | K48-ubiquitin (rabbit monoclonal) | abcam | Cat# ab140601 | 1:1000 |
| Antibody | Ki67-Immunofluorescence (mouse monoclonal) | abcam | Cat# ab279653 | 1:100 |
| Antibody | Ki67-FACS (rat monoclonal) | BioLegend | Cat# 652406; RRID:AB_2561930 | 1:100 |
| Antibody | MeCP2 (rabbit monoclonal) | Cell Signaling Technology | Cat# 3456; RRID:AB_2143849 | 1:1000 |
| Antibody | MeCP2-ChIP (rabbit polyclonal) | abcam | Cat# ab2828; RRID:AB_2143853 | 1:50 |
| Antibody | Nedd4 (rabbit polyclonal) | Proteintech | Cat# 21698-1-AP; RRID:AB_10858626 | 1:1000 |
| Antibody | Nr1h3 (rabbit polyclonal) | Proteintech | Cat# 14351-1-AP; RRID:AB_10640525 | 1:1000 |
| Antibody | Rara (rabbit polyclonal) | Proteintech | Cat# 10331-1-AP; RRID:AB_2177742 | 1:1000 |
| Antibody | p-Rb S807/811 (rabbit monoclonal) | Cell Signaling Technology | Cat# 8516; RRID:AB_11178658 | 1:1000 |
| Antibody | Ubiquitin (mouse monoclonal) | Cell Signaling Technology | Cat# 3936; RRID:AB_331292 | 1:1000 |
| Antibody | Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (mouse polyclonal) | Thermo Fisher Scientific | Cat# A21202; RRID:AB_141607 | 1:100 |
| Antibody | Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (rabbit polyclonal) | Thermo Fisher Scientific | Cat# A21207; RRID:AB_141637 | 1:100 |
| Recombinant DNA reagent | pLKO.1 vector | Addgene | Cat #8453; RRID:Addgene_8453 | |
| Recombinant DNA reagent | pCMV-deltaR8 | Addgene | Cat #12263; RRID:Addgene_12263 | |
| Recombinant DNA reagent | pCMV-VsVg | Addgene | Cat #8454; RRID:Addgene_8454 | |
| Recombinant DNA reagent | AAV8-TBG-MeCP2 | Genechem Co., Ltd | GOSV0233517 | |
| Recombinant DNA reagent | Mecp2 Mouse Tagged ORF Clone, transcript variant 1 | OriGene | Cat# MR226839 | |
| Recombinant DNA reagent | Mecp2 Mouse Tagged ORF Clone, transcript variant 2 | OriGene | Cat# MR207745 | |
| Recombinant DNA reagent | Nedd4 Mouse Tagged ORF Clone | OriGene | Cat# MR222243 | |
| Recombinant DNA reagent | pCMV6-Entry Mammalian Expression Vector | OriGene | Cat# PS100001 | |
| Chemical compound, drug | MG132 | selleck | Cat# S2619 | 10 μM |
| Chemical compound, drug | Puromycin | Sigma-Aldrich | Cat# P8833 | 2 µg/ml |
| Chemical compound, drug | Polybrene | Sigma-Aldrich | Cat# TR-1003 | 6 µg/ml |
| Chemical compound, drug | Pen Strep | Gibco | Cat# 15140-122 | 1% |
| Commercial assay or kit | Complete Protease Inhibitor mini EASY packs EDTA-Free | Roche | Cat# 05892791001 | |
| Commercial assay or kit | Lipofectamine 3000 Transfection Reagent | Thermo Fisher Scientific | Cat# L3000-015 | |
| Commercial assay or kit | Propidium Iodide (PI)/RNase Staining Solution | Cell Signaling Technology | Cat# 4087 | |
| Commercial assay or kit | DAPI | Thermo Fisher Scientific | Cat# D-1306 | |
| Commercial assay or kit | Pierce IP Lysis Buffer | Thermo Fisher Scientific | Cat# 87787 | |
| Commercial assay or kit | DAB Kit | ZSGB-BIO | Cat# ZLI-9018 | |
| Commercial assay or kit | Western Lightning Plus ECL | PerkinElmer | Cat# 0RT2655 | |
| Commercial assay or kit | SimpleChIP Plus Enzymatic Chromatin IP Kit | Cell Signaling Technology | Cat# 9005 | |
| Commercial assay or kit | Dynabeads Protein G | Thermo Fisher Scientific | Cat# 10004D | |
| Commercial assay or kit | Coomassie Blue Super Fast Staining Solution | Beyotime | Cat# P0017F | |
| Sequence-based reagent | siRNA to MeCP2 #1 | This paper | Suzhou GenePharma Co., Ltd | CCUGAAGGUUGGACACGAA |
| Sequence-based reagent | siRNA to MeCP2 #2 | This paper | Suzhou GenePharma Co., Ltd | UGACAAAGCUUCCCGAUUA |
| Sequence-based reagent | siRNA to MeCP2 #3 | This paper | Suzhou GenePharma Co., Ltd | CCGAAUUGCUGCUGCUUUA |
| Sequence-based reagent | siRNA to MeCP2 #4 | This paper | Suzhou GenePharma Co., Ltd | CGAAAUGGCUGUGUAGCAA |
| Sequence-based reagent | siRNA to Nedd4: #1 | This paper | Suzhou GenePharma Co., Ltd | CAGUGAUCCUUACGUAAGATT |
| Sequence-based reagent | siRNA to Nedd4 #2 | This paper | Suzhou GenePharma Co., Ltd | GGGAAAUCGUACGAGAAGATT |
| Sequence-based reagent | siRNA to Nedd4 #3 | This paper | Suzhou GenePharma Co., Ltd | GGAGGAUUAUGGGUGUGAATT |
| Sequence-based reagent | Alb, F | This paper | PCR primer | ACCTGAAGATGTTCGCGATTATCT |
| Sequence-based reagent | Alb, R | This paper | PCR primer | ACCGTCAGTACGTGAGATATCTT |
| Sequence-based reagent | MeCP2, F | This paper | PCR primer | GCTGGGGCCCTTGTTTTGAAT |
| Sequence-based reagent | MeCP2, R | This paper | PCR primer | GCTTTAGGTTGCTGGTGATA |
| Sequence-based reagent | Ar, F | This paper | PCR primer | CTGGGAAGGGTCTACCCAC |
| Sequence-based reagent | Ar, R | This paper | PCR primer | GGTGCTATGTTAGCGGCCTC |
| Sequence-based reagent | α-actin mouse, F | This paper | PCR primer | GGCTGTATTCCCCTCCATCG |
| Sequence-based reagent | α-actin mouse, R | This paper | PCR primer | CCAGTTGGTAACAATGCCATGT |
| Sequence-based reagent | α-actin human, F | This paper | PCR primer | CACCATTGGCAATGAGCGGTTC |
| Sequence-based reagent | α-actin human, R | This paper | PCR primer | AGGTCTTTGCGGATGTCCACGT |
| Sequence-based reagent | MeCP2 common, F | This paper | PCR primer | TATTTGATCAATCCCCAGGG |
| Sequence-based reagent | MeCP2 common, R | This paper | PCR primer | CTCCCTCTCCCAGTTACCGT |
| Sequence-based reagent | MeCP2 mouse, F | This paper | PCR primer | GAGCGGCACTGGGAGACC |
| Sequence-based reagent | MeCP2 mouse, R | This paper | PCR primer | CTGGATGGTGGTGATGAT |
| Sequence-based reagent | MeCP2 human, F | This paper | PCR primer | GATGTGTATTTGATCAATCCC |
| Sequence-based reagent | MeCP2 human, R | This paper | PCR primer | TTAGGGTCCAGGGATGTGTC |
| Sequence-based reagent | Nedd4, F | This paper | PCR primer | TCGGAGGACGAGGTATGGG |
| Sequence-based reagent | Nedd4, R | This paper | PCR primer | GGTACGGATCAGCAGTGAACA |
| Sequence-based reagent | Nr1h3, F | This paper | PCR primer | CTCAATGCCTGATGTTTCTCCT |
| Sequence-based reagent | Nr1h3, R | This paper | PCR primer | TCCAACCCTATCCCTAAAGCAA |
| Sequence-based reagent | Nr1i3, F | This paper | PCR primer | ATATGGGCCGAGGAACTGTGT |
| Sequence-based reagent | Nr1i3, R | This paper | PCR primer | GGCGTGGAAATGATAGCCTGT |
| Sequence-based reagent | Nr2f6, F | This paper | PCR primer | GAGGACGATTCGGCGTCAC |
| Sequence-based reagent | Nr2f6, R | This paper | PCR primer | GTAATGCTTTCCACTGGACTTGT |
| Sequence-based reagent | Nr3c1, F | This paper | PCR primer | AGCTCCCCCTGGTAGAGAC |
| Sequence-based reagent | Nr3c1, R | This paper | PCR primer | GGTGAAGACGCAGAAACCTTG |
| Sequence-based reagent | Nr4a1, F | This paper | PCR primer | TTGAGTTCGGCAAGCCTACC |
| Sequence-based reagent | Nr4a1, R | This paper | PCR primer | GTGTACCCGTCCATGAAGGTG |
| Sequence-based reagent | Nr5a2, F | This paper | PCR primer | TGAGGAACAACTCCGGGAAAA |
| Sequence-based reagent | Nr5a2, R | This paper | PCR primer | CAGACACTTTATCGCCACACA |
| Sequence-based reagent | Nr6a1, F | This paper | PCR primer | CGCAACGGTTTCTGTCAGGAT |
| Sequence-based reagent | Nr6a1, R | This paper | PCR primer | GTTCAGCTCGATCATCTGGGA |
| Sequence-based reagent | Ppard, F | This paper | PCR primer | CTCATGAATGTGCCCCAGGT |
| Sequence-based reagent | Ppard, R | This paper | PCR primer | GTGCAGCAAGGTCTCACTCT |
| Sequence-based reagent | Rxrg, F | This paper | PCR primer | CATGAGCCCTTCAGTAGCCTT |
| Sequence-based reagent | Rxrg, R | This paper | PCR primer | CGGAGAGCCAAGAGCATTGAG |
| Sequence-based reagent | Rara, F | This paper | PCR primer | ATGTACGAGAGTGTGGAAGTCG |
| Sequence-based reagent | Rara, Reserve | This paper | PCR primer | ACAGGCCCGGTTCTGGTTA |
| Sequence-based reagent | Srebf1, F | This paper | PCR primer | GCAGCCACCATCTAGCCTG |
| Sequence-based reagent | Srebf1, R | This paper | PCR primer | CAGCAGTGAGTCTGCCTTGAT |
| Sequence-based reagent | MeCP2, F | This paper | ChIP-qPCR primer | TAAGTGACAGGAGTCACAGCG |
| Sequence-based reagent | MeCP2, R | This paper | ChIP-qPCR primer | TGGGACGTTGTATGTAACGGG |
| Sequence-based reagent | Nr1h3, F | This paper | ChIP-qPCR primer | CAGCACGTTGTAATGGAAGCC |
| Sequence-based reagent | Nr1h3, R | This paper | ChIP-qPCR primer | TAGCATTCAGTGGAGGGAAGG |
| Sequence-based reagent | Rara, F | This paper | ChIP-qPCR primer | CGATGAGTGGCAAGGTCTTT |
| Sequence-based reagent | Rara, R | This paper | ChIP-qPCR primer | ATAGCATAGCACCAGGGACAC |
| Sequence-based reagent | shRNA for Nr1h3 | This paper | shRNA sequence | CCTCAAGGACTTCAGTTACAA |
| Sequence-based reagent | shRNA for Rara | This paper | shRNA sequence | GAGCAGCAGTTCCGAAGAGAT |
| Other | B6. Cg-Speer6-ps1Tg (Alb-cre)21Mgn/J mice | The Jackson Laboratory | Cat# 003574 | Hepatocyte-specific Cre-transgenic mouse |
| Other | MeCP2flox/flox | Shanghai Model Organisms Center | Cat #NM-CKO-190001 | Mice carrying the targeted MeCP2 allele |
| Other | C57/BL6 | Guangdong Medical Laboratory Animal Center | Cat #17 | Wild-type mouse |
| Software, algorithm | GraphPad Prism | GraphPad Software | Version 8.0 | |
| Software, algorithm | ModFit | ModFit LT Software | Version 4.1 | https://www.vsh.com/products/mflt/index.asp |
| Software, algorithm | ImageJ | ImageJ software | https://imagej.nih.gov/ij/ |
Additional files
-
Supplementary file 1
For the GO enrichment analysis, the binding proteins of Mecp2 during the cell cycle reentry.
- https://cdn.elifesciences.org/articles/89912/elife-89912-supp1-v1.csv
-
MDAR checklist
- https://cdn.elifesciences.org/articles/89912/elife-89912-mdarchecklist1-v1.pdf
