Mecp2 fine-tunes quiescence exit by targeting nuclear receptors

  1. Jun Yang
  2. Shitian Zou
  3. Zeyou Qiu
  4. Mingqiang Lai
  5. Qing Long
  6. Huan Chen
  7. Ping lin Lai
  8. Sheng Zhang
  9. Zhi Rao
  10. Xiaoling Xie
  11. Yan Gong
  12. Anling Liu  Is a corresponding author
  13. Mangmang Li  Is a corresponding author
  14. Xiaochun Bai  Is a corresponding author
  1. Guangdong Provincial Key Laboratory of Bone and Joint Degenerative Diseases, The Third Affiliated Hospital of Southern Medical University, China
  2. State Key Laboratory of Organ Failure Research, Department of Cell Biology, School of Basic Medical Sciences, Southern Medical University, China
  3. Department of Biochemistry, School of Basic Medical Sciences, Southern Medical University, China
7 figures, 1 table and 2 additional files

Figures

Figure 1 with 1 supplement
Mecp2 is immediately decreased in the liver after partial hepatectomy (PHx).

(A) Real-time PCR to evaluate mRNA levels of Mecp2 at different time points after PHx. Data are presented as means ± SEM; n = 6. n.s., not significant; ****p<0.0001 by one-way ANOVA. (B) Western …

Figure 1—source data 1

Mecp2 is immediately decreased in the liver after partial hepatectomy (PHx).

https://cdn.elifesciences.org/articles/89912/elife-89912-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Mecp2 is dynamically expressed during partial hepatectomy (PHx)-induced liver regeneration.

(A) Schematic for the PHx time course and data collection. Three phases of liver regeneration and the cell cycle progression of the first round of cell division after PHx are indicated by …

Figure 1—figure supplement 1—source data 1

Mecp2 is dynamically expressed during partial hepatectomy (PHx)-induced liver regeneration.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig1-figsupp1-data1-v1.xlsx
Figure 2 with 1 supplement
Mecp2 fine-tunes quiescence exit in hepatocytes after partial hepatectomy (PHx) in vivo.

(A–D) Liver regeneration in Mecpfl/fl and Mecp2 cKO mice after PHx. (A) Real-time PCR to measure mRNA levels of Mecp2. The effects and corresponding quantification of Mecp2 KO on quiescence exit and …

Figure 2—source data 1

Mecp2 fine-tunes quiescence exit in hepatocytes after partial hepatectomy (PHx) in vivo.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Modulation of Mecp2 expression in the mouse liver.

(A) Schematic diagram of loss of Mecp2 in mouse hepatocyte. In the Mecp2 floxed allele, Mecp2 exons 2 and 3 were flanked with loxp sites. The Neo-cassette was removed by mating with FLP recombinase …

Figure 2—figure supplement 1—source data 1

Modulation of Mecp2 expression in the mouse liver.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig2-figsupp1-data1-v1.xlsx
Figure 3 with 1 supplement
Mecp2 is immediately decreased during quiescence exit in cellular models.

(A, B) Representative histograms of propidium iodide (PI) staining of either asynchronized (Asyn) proliferating or starvation-induced quiescent 3T3 cells after serum restimulation (SR) in (A) and …

Figure 3—source data 1

Mecp2 is immediately decreased during quiescence exit in cellular models.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Mecp2 is dynamically expressed during quiescence exit in both HT22 and human umbilical vein endothelial cells (HUVECs).

Serum restimulation (SR)-induced (A–D, I–L) or contact inhibition loss (CIL)-induced (E–H, M–P) quiescence exits in mouse hippocampal neuronal HT22 cells (A–H) or in HUVECs (I–P) was analyzed by …

Figure 3—figure supplement 1—source data 1

Mecp2 is dynamically expressed during quiescence exit in both HT22 and human umbilical vein endothelial cells (HUVECs).

https://cdn.elifesciences.org/articles/89912/elife-89912-fig3-figsupp1-data1-v1.xlsx
Figure 4 with 1 supplement
Mecp2 negatively regulates the G0/G1 transition in the cellular model of serum restimulation (SR)-induced quiescence exit.

(A) Real-time PCR showing the mRNA levels of Mecp2 in 3T3 cells transfected with negative control siRNA (NC si) or Mecp2 siRNA (Mecp2 si) at the early stages of SR-induced cell cycle reentry. Data …

Figure 4—source data 1

Mecp2 negatively regulates the G0/G1 transition in the cellular model of serum restimulation (SR)-induced quiescence exit.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Mecp2 negatively regulates the G0/G1 transition in the cellular model of serum restimulation (SR)-induced quiescence exit.

(A) Protein quantitation of MeCP2 protein expression normalized to β-actin for Figure 4B western blotting (WB). Data are presented as means ± SEM; n = 3. *p<0.05; ***p<0.001; ****p<0.0001 by two-way …

Figure 4—figure supplement 1—source data 1

Mecp2 negatively regulates the G0/G1 transition in the cellular model of serum restimulation (SR)-induced quiescence exit.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig4-figsupp1-data1-v1.xlsx
Figure 5 with 1 supplement
Nedd4 interacts with Mecp2 and affects quiescence exit by facilitating Mecp2 degradation.

(A) Reciprocal immunoprecipitation-western blotting (IP-WB) analysis to validate the interaction between endogenous Mecp2 and Nedd4. (B) Co-IP of Mecp2, ubiquitin, and Nedd4 in quiescent 3T3 cells …

Figure 5—source data 1

Nedd4 interacts with Mecp2 and affects quiescence exit by facilitating Mecp2 degradation.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Nedd4 interacts with Mecp2.

(A) Western blotting (WB) of Mecp2 in quiescent 3T3 cells treated with or without MG132 after being released from G0 by serum restimulation (SR). (B) WB of Mecp2 in quiescent 3T3 cells treated with …

Figure 6 with 1 supplement
Mecp2 transcriptionally regulates quiescence exit.

(A) Heatmap of Mecp2 direct target genes at the early stage of liver regeneration rank-ordered by their gene expression fold change. (B) The top 10 most significantly overrepresented Gene Ontology …

Figure 6—source data 1

Mecp2 transcriptionally regulates quiescence exit.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
Related to Figure 6.

(A) Schematic showing the definition of Mecp2-binding genes. Lower panel: distribution of Mecp2 peaks in defined promoter-proximal, gene body, and distal regions. TSS, transcriptional start site; …

Depletion of either Nr1h3 or Rara mimics the Mecp2 knockdown (KD) phenotype during quiescence exit.

(A) ChIP-qPCR analyses of Mecp2 at the promoter-proximal regions of Rara and Nr1h3 in Mecp2fl/fl and Mecp2-cKO livers before and 6 hr post-partial hepatectomy (PHx). (B–D) Either Nr1h3 or Rara KD …

Figure 7—source data 1

Depletion of either Nr1h3 or Rara mimics the Mecp2 KD phenotype during quiescence exit.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig7-data1-v1.xlsx

Tables

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Cell line (Homo sapiens)HUVECATCCCat# CRL-1730
Cell line
(H. sapiens)
LentiX-293TATCCCat# ACS-4500
Cell line
(Mus musculus)
NIH3T3ATCCCat# SCSP-515
Cell line
(M. musculus)
Ht22Procell Life Science&TechnologyCat# CL-0697
AntibodyAlbumin (mouse monoclonal)ProteintechCat# 66051-1-Ig; RRID:AB_110423201:100
Antibodyβ-Actin (mouse monoclonal)ProteintechCat# 66009-1-Ig; RRID:AB_26879381:4000
AntibodyCyclin A2 (mouse monoclonal)abcamCat# ab38; RRID:AB_3040841:1000
AntibodyCyclin B1 (mouse monoclonal)abcamCat# ab72; RRID:AB_3057511:1000
AntibodyCyclin D1 (rabbit monoclonal)abcamCat# ab16663; RRID:AB_4434231:1000
AntibodyCyclin E1 (rabbit monoclonal)Cell Signaling TechnologyCat# 20808; RRID:AB_27835541:1000
AntibodyH3K27ac (rabbit polyclonal)abcamCat# ab4729; RRID:AB_21182911:50
AntibodyIgG (rabbit, IgG)Cell Signaling TechnologyCat# 2729; RRID:AB_10310621:50
AntibodyK48-ubiquitin (rabbit monoclonal)abcamCat# ab1406011:1000
AntibodyKi67-Immunofluorescence (mouse monoclonal)abcamCat# ab2796531:100
AntibodyKi67-FACS (rat monoclonal)BioLegendCat# 652406; RRID:AB_25619301:100
AntibodyMeCP2 (rabbit monoclonal)Cell Signaling TechnologyCat# 3456; RRID:AB_21438491:1000
AntibodyMeCP2-ChIP (rabbit polyclonal)abcamCat# ab2828; RRID:AB_21438531:50
AntibodyNedd4 (rabbit polyclonal)ProteintechCat# 21698-1-AP; RRID:AB_108586261:1000
AntibodyNr1h3 (rabbit polyclonal)ProteintechCat# 14351-1-AP;
RRID:AB_10640525
1:1000
AntibodyRara (rabbit polyclonal)ProteintechCat# 10331-1-AP;
RRID:AB_2177742
1:1000
Antibodyp-Rb S807/811 (rabbit monoclonal)Cell Signaling TechnologyCat# 8516; RRID:AB_111786581:1000
AntibodyUbiquitin (mouse monoclonal)Cell Signaling TechnologyCat# 3936; RRID:AB_3312921:1000
AntibodyDonkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (mouse polyclonal)Thermo Fisher ScientificCat# A21202; RRID:AB_1416071:100
AntibodyDonkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (rabbit polyclonal)Thermo Fisher ScientificCat# A21207; RRID:AB_1416371:100
Recombinant DNA reagentpLKO.1 vectorAddgeneCat #8453;
RRID:Addgene_8453
Recombinant DNA reagentpCMV-deltaR8AddgeneCat #12263;
RRID:Addgene_12263
Recombinant DNA reagentpCMV-VsVgAddgeneCat #8454;
RRID:Addgene_8454
Recombinant DNA reagentAAV8-TBG-MeCP2Genechem Co., LtdGOSV0233517
Recombinant DNA reagentMecp2 Mouse Tagged ORF Clone, transcript variant 1OriGeneCat# MR226839
Recombinant DNA reagentMecp2 Mouse Tagged ORF Clone, transcript variant 2OriGeneCat# MR207745
Recombinant DNA reagentNedd4 Mouse Tagged ORF CloneOriGeneCat# MR222243
Recombinant DNA reagentpCMV6-Entry Mammalian Expression VectorOriGeneCat# PS100001
Chemical compound, drugMG132selleckCat# S261910 μM
Chemical compound, drugPuromycinSigma-AldrichCat# P88332 µg/ml
Chemical compound, drugPolybreneSigma-AldrichCat# TR-10036 µg/ml
Chemical compound, drugPen StrepGibcoCat# 15140-1221%
Commercial assay or kitComplete Protease Inhibitor mini EASY packs EDTA-FreeRocheCat# 05892791001
Commercial assay or kitLipofectamine 3000 Transfection ReagentThermo Fisher ScientificCat# L3000-015
Commercial assay or kitPropidium Iodide (PI)/RNase Staining SolutionCell Signaling TechnologyCat# 4087
Commercial assay or kitDAPIThermo Fisher ScientificCat# D-1306
Commercial assay or kitPierce IP Lysis BufferThermo Fisher ScientificCat# 87787
Commercial assay or kitDAB KitZSGB-BIOCat# ZLI-9018
Commercial assay or kitWestern Lightning Plus ECLPerkinElmerCat# 0RT2655
Commercial assay or kitSimpleChIP Plus Enzymatic Chromatin IP KitCell Signaling TechnologyCat# 9005
Commercial assay or kitDynabeads Protein GThermo Fisher ScientificCat# 10004D
Commercial assay or kitCoomassie Blue Super Fast Staining SolutionBeyotimeCat# P0017F
Sequence-based reagentsiRNA to MeCP2 #1This paperSuzhou GenePharma Co., LtdCCUGAAGGUUGGACACGAA
Sequence-based reagentsiRNA to MeCP2 #2This paperSuzhou GenePharma Co., LtdUGACAAAGCUUCCCGAUUA
Sequence-based reagentsiRNA to MeCP2 #3This paperSuzhou GenePharma Co., LtdCCGAAUUGCUGCUGCUUUA
Sequence-based reagentsiRNA to MeCP2 #4This paperSuzhou GenePharma Co., LtdCGAAAUGGCUGUGUAGCAA
Sequence-based reagentsiRNA to Nedd4: #1This paperSuzhou GenePharma Co., LtdCAGUGAUCCUUACGUAAGATT
Sequence-based reagentsiRNA to Nedd4 #2This paperSuzhou GenePharma Co., LtdGGGAAAUCGUACGAGAAGATT
Sequence-based reagentsiRNA to Nedd4 #3This paperSuzhou GenePharma Co., LtdGGAGGAUUAUGGGUGUGAATT
Sequence-based reagentAlb, FThis paperPCR primerACCTGAAGATGTTCGCGATTATCT
Sequence-based reagentAlb, RThis paperPCR primerACCGTCAGTACGTGAGATATCTT
Sequence-based reagentMeCP2, FThis paperPCR primerGCTGGGGCCCTTGTTTTGAAT
Sequence-based reagentMeCP2, RThis paperPCR primerGCTTTAGGTTGCTGGTGATA
Sequence-based reagentAr, FThis paperPCR primerCTGGGAAGGGTCTACCCAC
Sequence-based reagentAr, RThis paperPCR primerGGTGCTATGTTAGCGGCCTC
Sequence-based reagentα-actin mouse, FThis paperPCR primerGGCTGTATTCCCCTCCATCG
Sequence-based reagentα-actin mouse, RThis paperPCR primerCCAGTTGGTAACAATGCCATGT
Sequence-based reagentα-actin human, FThis paperPCR primerCACCATTGGCAATGAGCGGTTC
Sequence-based reagentα-actin human, RThis paperPCR primerAGGTCTTTGCGGATGTCCACGT
Sequence-based reagentMeCP2 common, FThis paperPCR primerTATTTGATCAATCCCCAGGG
Sequence-based reagentMeCP2 common, RThis paperPCR primerCTCCCTCTCCCAGTTACCGT
Sequence-based reagentMeCP2 mouse, FThis paperPCR primerGAGCGGCACTGGGAGACC
Sequence-based reagentMeCP2 mouse, RThis paperPCR primerCTGGATGGTGGTGATGAT
Sequence-based reagentMeCP2 human, FThis paperPCR primerGATGTGTATTTGATCAATCCC
Sequence-based reagentMeCP2 human, RThis paperPCR primerTTAGGGTCCAGGGATGTGTC
Sequence-based reagentNedd4, FThis paperPCR primerTCGGAGGACGAGGTATGGG
Sequence-based reagentNedd4, RThis paperPCR primerGGTACGGATCAGCAGTGAACA
Sequence-based reagentNr1h3, FThis paperPCR primerCTCAATGCCTGATGTTTCTCCT
Sequence-based reagentNr1h3, RThis paperPCR primerTCCAACCCTATCCCTAAAGCAA
Sequence-based reagentNr1i3, FThis paperPCR primerATATGGGCCGAGGAACTGTGT
Sequence-based reagentNr1i3, RThis paperPCR primerGGCGTGGAAATGATAGCCTGT
Sequence-based reagentNr2f6, FThis paperPCR primerGAGGACGATTCGGCGTCAC
Sequence-based reagentNr2f6, RThis paperPCR primerGTAATGCTTTCCACTGGACTTGT
Sequence-based reagentNr3c1, FThis paperPCR primerAGCTCCCCCTGGTAGAGAC
Sequence-based reagentNr3c1, RThis paperPCR primerGGTGAAGACGCAGAAACCTTG
Sequence-based reagentNr4a1, FThis paperPCR primerTTGAGTTCGGCAAGCCTACC
Sequence-based reagentNr4a1, RThis paperPCR primerGTGTACCCGTCCATGAAGGTG
Sequence-based reagentNr5a2, FThis paperPCR primerTGAGGAACAACTCCGGGAAAA
Sequence-based reagentNr5a2, RThis paperPCR primerCAGACACTTTATCGCCACACA
Sequence-based reagentNr6a1, FThis paperPCR primerCGCAACGGTTTCTGTCAGGAT
Sequence-based reagentNr6a1, RThis paperPCR primerGTTCAGCTCGATCATCTGGGA
Sequence-based reagentPpard, FThis paperPCR primerCTCATGAATGTGCCCCAGGT
Sequence-based reagentPpard, RThis paperPCR primerGTGCAGCAAGGTCTCACTCT
Sequence-based reagentRxrg, FThis paperPCR primerCATGAGCCCTTCAGTAGCCTT
Sequence-based reagentRxrg, RThis paperPCR primerCGGAGAGCCAAGAGCATTGAG
Sequence-based reagentRara, FThis paperPCR primerATGTACGAGAGTGTGGAAGTCG
Sequence-based reagentRara, ReserveThis paperPCR primerACAGGCCCGGTTCTGGTTA
Sequence-based reagentSrebf1, FThis paperPCR primerGCAGCCACCATCTAGCCTG
Sequence-based reagentSrebf1, RThis paperPCR primerCAGCAGTGAGTCTGCCTTGAT
Sequence-based reagentMeCP2, FThis paperChIP-qPCR primerTAAGTGACAGGAGTCACAGCG
Sequence-based reagentMeCP2, RThis paperChIP-qPCR primerTGGGACGTTGTATGTAACGGG
Sequence-based reagentNr1h3, FThis paperChIP-qPCR primerCAGCACGTTGTAATGGAAGCC
Sequence-based reagentNr1h3, RThis paperChIP-qPCR primerTAGCATTCAGTGGAGGGAAGG
Sequence-based reagentRara, FThis paperChIP-qPCR primerCGATGAGTGGCAAGGTCTTT
Sequence-based reagentRara, RThis paperChIP-qPCR primerATAGCATAGCACCAGGGACAC
Sequence-based reagentshRNA for Nr1h3This papershRNA sequenceCCTCAAGGACTTCAGTTACAA
Sequence-based reagentshRNA for RaraThis papershRNA sequenceGAGCAGCAGTTCCGAAGAGAT
OtherB6. Cg-Speer6-ps1Tg (Alb-cre)21Mgn/J miceThe Jackson LaboratoryCat# 003574Hepatocyte-specific Cre-transgenic mouse
OtherMeCP2flox/floxShanghai Model Organisms CenterCat #NM-CKO-190001Mice carrying the targeted MeCP2 allele
OtherC57/BL6Guangdong Medical Laboratory Animal CenterCat #17Wild-type mouse
Software, algorithmGraphPad PrismGraphPad
Software
Version 8.0
Software, algorithmModFitModFit LT SoftwareVersion 4.1https://www.vsh.com/products/mflt/index.asp
Software, algorithmImageJImageJ softwarehttps://imagej.nih.gov/ij/

Additional files

Download links