1. Cell Biology

Mecp2 fine-tunes quiescence exit by targeting nuclear receptors

  1. Jun Yang
  2. Shitian Zou
  3. Zeyou Qiu
  4. Mingqiang Lai
  5. Qing Long
  6. Huan Chen
  7. Ping lin Lai
  8. Sheng Zhang
  9. Zhi Rao
  10. Xiaoling Xie
  11. Yan Gong
  12. Anling Liu  Is a corresponding author
  13. Mangmang Li  Is a corresponding author
  14. Xiaochun Bai  Is a corresponding author
  1. Guangdong Provincial Key Laboratory of Bone and Joint Degenerative Diseases, The Third Affiliated Hospital of Southern Medical University, China
  2. State Key Laboratory of Organ Failure Research, Department of Cell Biology, School of Basic Medical Sciences, Southern Medical University, China
  3. Department of Biochemistry, School of Basic Medical Sciences, Southern Medical University, China
https://doi.org/10.7554/eLife.89912.3
Share this article
Cite this article
  1. Jun Yang
  2. Shitian Zou
  3. Zeyou Qiu
  4. Mingqiang Lai
  5. Qing Long
  6. Huan Chen
  7. Ping lin Lai
  8. Sheng Zhang
  9. Zhi Rao
  10. Xiaoling Xie
  11. Yan Gong
  12. Anling Liu
  13. Mangmang Li
  14. Xiaochun Bai
(2024)
Mecp2 fine-tunes quiescence exit by targeting nuclear receptors
eLife 12:RP89912.
https://doi.org/10.7554/eLife.89912.3
  2. Download BibTeX
  3. Download .RIS
7 figures, 1 table and 2 additional files

Figures

Figure 1 with 1 supplement
Download asset Open asset
Mecp2 is immediately decreased in the liver after partial hepatectomy (PHx).

(A) Real-time PCR to evaluate mRNA levels of Mecp2 at different time points after PHx. Data are presented as means ± SEM; n = 6. n.s., not significant; ****p<0.0001 by one-way ANOVA. (B) Western blotting (WB) showing the time course of protein levels of Mecp2, pRb, Cyclin D1, Cyclin E1, Cyclin A1, Cyclin B1, and β-actin in mouse livers after PHx. Right panel: quantification of Mecp2. Data are presented as means ± SEM; n = 3. n.s., not significant; ****p<0.0001; *p<0.05 by one-way ANOVA. (C) Representative immunofluorescence (IF) staining of Mecp2 (red) and Alb (green), together with DAPI (blue) for nuclei in liver sections at different time points after PHx. Lower panels: higher-magnification images. (D) Representative immunohistochemistry (IHC) images of liver tissues stained for Mecp2 or Ki67 at the indicated time points after PHx.

Figure 1—source data 1

Mecp2 is immediately decreased in the liver after partial hepatectomy (PHx).

https://cdn.elifesciences.org/articles/89912/elife-89912-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Download asset Open asset
Mecp2 is dynamically expressed during partial hepatectomy (PHx)-induced liver regeneration.

(A) Schematic for the PHx time course and data collection. Three phases of liver regeneration and the cell cycle progression of the first round of cell division after PHx are indicated by rainbow-colored and dotted arrows, respectively. (B) Real-time PCR to evaluate mRNA levels of two isoforms of Mecp2, Mecp2e1 and Mecp2e2, at different time points after PHx. Data are presented as means ± SEM; n = 6; n.s., not significant; **p<0.01; ****p<0.0001 by one-way ANOVA. (C) ChIP-qPCR showing H3K27ac occupancy at the Mecp2 promoter at the indicated time points after PHx. IgG served as a negative control. Data are presented as means ± SEM; n = 6; ****p<0.0001 by two-way ANOVA.

Figure 1—figure supplement 1—source data 1

Mecp2 is dynamically expressed during partial hepatectomy (PHx)-induced liver regeneration.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig1-figsupp1-data1-v1.xlsx
Figure 2 with 1 supplement
Download asset Open asset
Mecp2 fine-tunes quiescence exit in hepatocytes after partial hepatectomy (PHx) in vivo.

(A–D) Liver regeneration in Mecpfl/fl and Mecp2 cKO mice after PHx. (A) Real-time PCR to measure mRNA levels of Mecp2. The effects and corresponding quantification of Mecp2 KO on quiescence exit and liver regeneration were assessed by western blotting (WB) of Mecp2, pRb, and Cyclin D1 (B), immunofluorescence (IF) staining of Mecp2 (red) and Ki67 (green) in liver sections (C), and liver index of control and Mecp2 cKO mice (D) at the indicated time points. (E–H) Liver regeneration in Mecp2fl/fl livers without (AAV-EV) or with AAV-mediated Mecp2 OE (AAV-Mecp2) after PHx. AAV, adeno-associated virus; EV, empty vector. (E) Real-time PCR to measure mRNA levels of Mecp2. (F–H) The effects and corresponding quantification of Mecp2 OE on quiescence exit and liver regeneration were assessed by WB of Mecp2, pRb, and Cyclin D1 (F), IF staining of Mecp2 (red) and Ki67 (green) in liver sections (G), and liver index at the indicated time points (H). (I–L) Liver regeneration in Mecp2 cKO livers without (Mecp2 cKO/AAV-EV) or with AAV-mediated Mecp2 restoration (Mecp2 cKO/AAV-Mecp2) after PHx. (I) Real-time PCR to measure mRNA levels of Mecp2. (J–L) The effects and corresponding quantification of Mecp2 restoration on quiescence exit and liver regeneration in Mecp2 cKO livers were assessed by WB of Mecp2, pRb and Cyclin D1 (J), IF staining of Mecp2 (red) and Ki67 (green) in liver sections (K), and liver index (L) at the indicated time points. Data are presented as means ± SEM. In (A, E, I), n = 6; (B, F, J), n = 3; in (D, H, L), n = 5 mice/group. n.s., not significant; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001 by two-way ANOVA.

Figure 2—source data 1

Mecp2 fine-tunes quiescence exit in hepatocytes after partial hepatectomy (PHx) in vivo.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Download asset Open asset
Modulation of Mecp2 expression in the mouse liver.

(A) Schematic diagram of loss of Mecp2 in mouse hepatocyte. In the Mecp2 floxed allele, Mecp2 exons 2 and 3 were flanked with loxp sites. The Neo-cassette was removed by mating with FLP recombinase homozygous mice. Exons 2 and 3 were deleted by mating with Alb-Cre recombinase homozygous mice. (B–D) Evaluation of hepatocyte-specific depletion of Mecp2 by genotyping (B), real-time PCR (C), and western blotting (WB) (D) in Mecp2fl/fl and Mecp2 cKO livers. Data are presented as means ± SEM. n = 6 mice/group; ****p<0.0001 by one-way ANOVA. (E) Representative images of Mecp2fl/fl and Mecp2 cKO mice at 3 months of age. (F) Representative liver morphology and liver index of Mecp2fl/fl and Mecp2 cKO mice before PHx. Data are presented as means ± SEM. n = 5 mice/group; n.s., not significant by Student’s t-test. (G) Representative H&E staining and immunohistochemistry (IHC) for Ki67 images of liver tissues from Mecp2fl/fl and Mecp2 cKO mice before PHx. (H) Representative liver morphology and liver index of Mecp2fl/fl and Mecp2 cKO mice at 7 d post-PHx. Data are presented as means ± SEM. n = 5 mice/group; n.s., not significant by Student’s t-test. (I) Representative liver morphology and liver index of Mecp2fl/fl mice without (AAV-EV) or with (AAV-Mecp2) AAV-mediated Mecp2 overexpression at 7 d post-PHx. EV, empty vector. Data are presented as means ± SEM. n = 5 mice/group; n.s., not significant by Student’s t-test. (J) Representative liver morphology and liver index of Mecp2-cKO mice without (Mecp2 cKO/AAV-EV) or with (Mecp2 cKO/AAV-Mecp2) the rescue of Mecp2 at 7 d post-PHx. Data are presented as means ± SEM. n = 5 mice/group; n.s., not significant by Student’s t-test.

Figure 2—figure supplement 1—source data 1

Modulation of Mecp2 expression in the mouse liver.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig2-figsupp1-data1-v1.xlsx
Figure 3 with 1 supplement
Download asset Open asset
Mecp2 is immediately decreased during quiescence exit in cellular models.

(A, B) Representative histograms of propidium iodide (PI) staining of either asynchronized (Asyn) proliferating or starvation-induced quiescent 3T3 cells after serum restimulation (SR) in (A) and statistical analysis of cell cycle distribution (B). (C) Real-time PCR to examine mRNA levels of Mecp2. Data are presented as means ± SEM; n = 9. n.s., not significant; ****p<0.0001 by one-way ANOVA. (D) Western blotting (WB) of Mecp2, pRb, Cyclin D1, Cyclin E1, Cyclin A1, and Cyclin B1 in quiescent 3T3 cells upon SR. Right panel: quantification of Mecp2. Data are presented as means ± SEM; n = 3. n.s., not significant; ****p<0.0001 by one-way ANOVA. (E) Representative immunofluorescence (IF) staining of Mecp2 (red) and Ki67 (green), together with DAPI (blue) in Asyn and quiescent 3T3 cells upon SR. (F, G) Representative histograms of PI staining of contact inhibition (CI)-induced quiescent 3T3 cells after CI loss (CIL) (F) and statistical analysis of cell cycle distribution (G) at the indicated time points. (H) Real-time PCR to examine mRNA levels of Mecp2 in 3T3 cells released from CI-induced quiescence. Data are presented as means ± SEM; n = 6. n.s., not significant; ****p<0.0001 by one-way ANOVA. (I) WB of Mecp2, pRb, Cyclin D1, Cyclin E1, Cyclin A1, and Cyclin B1 in quiescent 3T3 cells upon CIL. Right panel: quantification of Mecp2. Data are presented as means ± SEM; n = 3. n.s., not significant; ****p<0.0001 by one-way ANOVA. (J) Representative IF staining of Mecp2 and Ki67 in 3T3 cells released from CI-induced quiescence.

Figure 3—source data 1

Mecp2 is immediately decreased during quiescence exit in cellular models.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Download asset Open asset
Mecp2 is dynamically expressed during quiescence exit in both HT22 and human umbilical vein endothelial cells (HUVECs).

Serum restimulation (SR)-induced (A–D, I–L) or contact inhibition loss (CIL)-induced (E–H, M–P) quiescence exits in mouse hippocampal neuronal HT22 cells (A–H) or in HUVECs (I–P) was analyzed by propidium iodide (PI) staining (A, B, E, F, I, J, M, N), real-time PCR (C, G, K, O), and western blotting (WB) (D, H, L, P) in a time course of quiescence exit. (A, E, I, M) Representative histograms of PI staining. (B, F, J, N) Statistical analysis of the cell cycle distribution. (D, H, L, P) WB of Mecp2, pRb, Cyclin D1, Cyclin E1, Cyclin A1, Cyclin B1, and β-actin in cells released from G0. Left panel: quantification of Mecp2 protein levels. In (C, K), n = 9; In (O, P), n = 6; In (D, G, H, L) n = 3; Data are presented as means ± SEM; n.s., not significant; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001 by one-way ANOVA.

Figure 3—figure supplement 1—source data 1

Mecp2 is dynamically expressed during quiescence exit in both HT22 and human umbilical vein endothelial cells (HUVECs).

https://cdn.elifesciences.org/articles/89912/elife-89912-fig3-figsupp1-data1-v1.xlsx
Figure 4 with 1 supplement
Download asset Open asset
Mecp2 negatively regulates the G0/G1 transition in the cellular model of serum restimulation (SR)-induced quiescence exit.

(A) Real-time PCR showing the mRNA levels of Mecp2 in 3T3 cells transfected with negative control siRNA (NC si) or Mecp2 siRNA (Mecp2 si) at the early stages of SR-induced cell cycle reentry. Data are presented as means ± SEM; n = 6. n.s., not significant; ***p<0.001; ****p<0.0001 by two-way ANOVA. (B) Western blotting (WB) of Mecp2, pRb, Cyclin D1, Cyclin E1, Cyclin A2, and Cyclin B1 in control and Mecp2 knockdown (KD) 3T3 cells released from serum starvation (SS)-induced quiescence at the indicated time points. (C) Representative immunofluorescence (IF) staining of Mecp2 and Ki67 in control and Mecp2 KD 3T3 cells upon SR-induced quiescent exit. (D) Ki67 and propidium iodide (PI) double staining followed by flow cytometry showing cell cycle profiles of 3T3 cells transfected with NC or Mecp2 siRNA upon SR-induced quiescence exit. Cells in G0, G1, and S/G2/M phases were defined by Ki67−/2N DNA content, Ki67+/2N DNA content and >2N DNA content population, respectively. Lower panel: quantification of the percentage of 3T3 cells in the G0 phase. Data are presented as means ± SEM; n = 3. n.s., not significant; ****p<0.0001 by two-way ANOVA. (E) Real-time PCR showing the mRNA levels of Mecp2 in 3T3 cells transduced with the empty vector (EV) or the vector overexpressing Mecp2 (Mecp2 overexpression [OE]) at the early stages of quiescence exit. Data are presented as means ± SEM; n = 3. ****p<0.0001 by two-way ANOVA. (F) WB of Mecp2, pRb, Cyclin D1, Cyclin E1, Cyclin A2, and Cyclin B1 in control and Mecp2 OE 3T3 cells released from SS-induced quiescence at the indicated time points. (G) Representative IF staining of Mecp2 and Ki67 in quiescent control and Mecp2 OE 3T3 cells upon SR. (H) Representative flow cytometry plots of Ki67/PI double staining in control and Mecp2 OE 3T3 cells upon SR-induced quiescence exit. Lower panel: quantification of proportion of 3T3 cells in the G0 phase. Data are presented as means ± SEM; n = 3. n.s., not significant; ***p<0.001; ****p<0.0001 by two-way ANOVA.

Figure 4—source data 1

Mecp2 negatively regulates the G0/G1 transition in the cellular model of serum restimulation (SR)-induced quiescence exit.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Download asset Open asset
Mecp2 negatively regulates the G0/G1 transition in the cellular model of serum restimulation (SR)-induced quiescence exit.

(A) Protein quantitation of MeCP2 protein expression normalized to β-actin for Figure 4B western blotting (WB). Data are presented as means ± SEM; n = 3. *p<0.05; ***p<0.001; ****p<0.0001 by two-way ANOVA. (B) Protein quantitation of MeCP2 protein expression normalized to β-actin for Figure 4F western blotting. Data are presented as means ± SEM; n = 3. **p<0.01; ****p<0.0001 by two-way ANOVA. (C) WB of Mecp2 and pRb in control and Mecp2 knockdown (KD) 3T3 cells released from serum starvation (SS)-induced quiescence at the indicated time points. (D) WB of Mecp2 and pRb in control and Mecp2 overexpression (OE) 3T3 cells released from SS-induced quiescence at the indicated time points.

Figure 4—figure supplement 1—source data 1

Mecp2 negatively regulates the G0/G1 transition in the cellular model of serum restimulation (SR)-induced quiescence exit.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig4-figsupp1-data1-v1.xlsx
Figure 5 with 1 supplement
Download asset Open asset
Nedd4 interacts with Mecp2 and affects quiescence exit by facilitating Mecp2 degradation.

(A) Reciprocal immunoprecipitation-western blotting (IP-WB) analysis to validate the interaction between endogenous Mecp2 and Nedd4. (B) Co-IP of Mecp2, ubiquitin, and Nedd4 in quiescent 3T3 cells during serum restimulation (SR)-induced quiescence exit. (C) Real-time PCR showing siRNA-mediated Nedd4 knockdown (KD) in 3T3 cells upon SR-induced quiescence exit. Data are presented as means ± SEM; n = 5. ****p<0.0001 by two-way ANOVA. (D–F) The effect of Nedd4 KD on quiescent exit in 3T3 cells determined by WB (D), immunofluorescence (IF) staining of Ki67 and Nedd4 (E), and Ki67/PI staining followed by flow cytometry (F) at the indicated time points. Lower panel in (F): quantification of the percentage of 3T3 cells in the G0 phase. Data are presented as means ± SEM; n = 3. n.s., not significant; ***p<0.001, ****p<0.0001 by two-way ANOVA. (G) Real-time PCR showing Nedd4 overexpression (OE) in 3T3 cells upon SR-induced quiescence exit. Data are presented as means ± SEM; n = 5. ****p<0.0001 by two-way ANOVA. (H–J) The effect of Nedd4 OE on quiescent exit in 3T3 cells determined by WB (H), IF staining of Ki67 and Nedd4 (I), and Ki67/PI staining (J) at the indicated time points. Data are presented as means ± SEM; n = 3. n.s., not significant; ****p<0.0001 by two-way ANOVA.

Figure 5—source data 1

Nedd4 interacts with Mecp2 and affects quiescence exit by facilitating Mecp2 degradation.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Download asset Open asset
Nedd4 interacts with Mecp2.

(A) Western blotting (WB) of Mecp2 in quiescent 3T3 cells treated with or without MG132 after being released from G0 by serum restimulation (SR). (B) WB of Mecp2 in quiescent 3T3 cells treated with or without chloroquine after being released from G0 by SR. (C) Coomassie staining of Mecp2 co-IP proteins separated by SDS-PAGE. Right: representative peptides of Nedd4 identified by mass spectrometry. (D) WB showing protein levels of Nedd4 in mouse livers before and 6 hr after partial hepatectomy (PHx).

Figure 5—figure supplement 1—source data 1

Nedd4 interacts with Mecp2.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig5-figsupp1-data1-v1.xlsx
Figure 6 with 1 supplement
Download asset Open asset
Mecp2 transcriptionally regulates quiescence exit.

(A) Heatmap of Mecp2 direct target genes at the early stage of liver regeneration rank-ordered by their gene expression fold change. (B) The top 10 most significantly overrepresented Gene Ontology (GO) terms for the partial hepatectomy (PHx)-activated (red) and PHx-repressed (green) Mecp2 target genes. (C) Heatmaps depicting ChIP-seq enrichment of Mecp2 at the promoter-proximal region (3 kb away from transcription start sites [TSS]) and the defined gene region of Mecp2 target genes in Mecpfl/fl and Mecp2 cKO livers before and 6 hr post-PHx. Genes are rank-ordered according to the fold change of expression. (D) Real-time PCR validation of PHx-repressed NRs in Mecp2fl/fl and Mecp2 cKO livers upon PHx. Data are presented as means ± SEM; n = 5. n.s., not significant; **p<0.01; ****p<0.0001 by two-way ANOVA.

Figure 6—source data 1

Mecp2 transcriptionally regulates quiescence exit.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
Download asset Open asset
Related to Figure 6.

(A) Schematic showing the definition of Mecp2-binding genes. Lower panel: distribution of Mecp2 peaks in defined promoter-proximal, gene body, and distal regions. TSS, transcriptional start site; TES, transcriptional end site. The cutoff of distance of peak-to-gene is 25 kb. (B) Venn diagram overlap of Mecp2 binding genes in Mecp2fl/fl livers before (0 hr) and after partial hepatectomy (PHx) (6 hr). (C) Pipeline showing the integration of Mecp2 ChIP-seq data with RNA-seq data to identify Mecp2-direct target genes. (D) Real-time PCR validation of PHx-repressed NRs in 3T3 cells upon serum restimulation (SR)-induced quiescence exit. Data are presented as means ± SEM; n = 3. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001 by one-way ANOVA.

Figure 6—figure supplement 1—source data 1

Raw data related to Figure 6—figure supplement 1.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig6-figsupp1-data1-v1.xlsx
Figure 7
Download asset Open asset
Depletion of either Nr1h3 or Rara mimics the Mecp2 knockdown (KD) phenotype during quiescence exit.

(A) ChIP-qPCR analyses of Mecp2 at the promoter-proximal regions of Rara and Nr1h3 in Mecp2fl/fl and Mecp2-cKO livers before and 6 hr post-partial hepatectomy (PHx). (B–D) Either Nr1h3 or Rara KD promotes serum restimulation (SR)-induced quiescence exit in 3T3 cells. (B) Real-time PCR showing lentivirus-mediated KD of either Nr1h3 or Rara. shLuc served as a negative control. (C) Western blotting (WB) of pRb, Cyclin D1, Nr1h3, and Rara in control and Nr1h3 or Rara KD 3T3 cells at the indicated time points. (D) The effect of Nr1h3 or Rara KD on quiescent exit in 3T3 cells determined by Ki67/PI staining followed by flow cytometry. Data are presented as means ± SEM; In (A, B), n = 5; in (D), n = 3. *p<0.05; ***p<0.001; ****p<0.0001 by two-way ANOVA. (E–H) Either Nr1h3 or Rara KD further enhances quiescence exit in Mecp2 cKO livers. (E) Real-time PCR showing adeno-associated virus (AAV)-mediated KD of either Nr1h3 or Rara. shLuc served as a negative control. (F) WB of pRb, Cyclin D1, Nr1h3, and Rara in control and Nr1h3 or Rara KD 3T3 cells at the indicated time points. (G) The effect of Nr1h3 or Rara KD on quiescent exit in Mecp2 cKO livers determined by IF and liver index (H) before and 6 hr post-PHx. Data are presented as means ± SEM. In (E, H), n = 5 mice/group; n.s., not significant; *p<0.05, ****p<0.0001 by two-way ANOVA. (I) Model of the negative regulatory role for Mecp2 in fine-tuning quiescence exit.

Figure 7—source data 1

Depletion of either Nr1h3 or Rara mimics the Mecp2 KD phenotype during quiescence exit.

https://cdn.elifesciences.org/articles/89912/elife-89912-fig7-data1-v1.xlsx

Tables

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Cell line (Homo sapiens)HUVECATCCCat# CRL-1730
Cell line
(H. sapiens)		LentiX-293TATCCCat# ACS-4500
Cell line
(Mus musculus)		NIH3T3ATCCCat# SCSP-515
Cell line
(M. musculus)		Ht22Procell Life Science&TechnologyCat# CL-0697
AntibodyAlbumin (mouse monoclonal)ProteintechCat# 66051-1-Ig; RRID:AB_110423201:100
Antibodyβ-Actin (mouse monoclonal)ProteintechCat# 66009-1-Ig; RRID:AB_26879381:4000
AntibodyCyclin A2 (mouse monoclonal)abcamCat# ab38; RRID:AB_3040841:1000
AntibodyCyclin B1 (mouse monoclonal)abcamCat# ab72; RRID:AB_3057511:1000
AntibodyCyclin D1 (rabbit monoclonal)abcamCat# ab16663; RRID:AB_4434231:1000
AntibodyCyclin E1 (rabbit monoclonal)Cell Signaling TechnologyCat# 20808; RRID:AB_27835541:1000
AntibodyH3K27ac (rabbit polyclonal)abcamCat# ab4729; RRID:AB_21182911:50
AntibodyIgG (rabbit, IgG)Cell Signaling TechnologyCat# 2729; RRID:AB_10310621:50
AntibodyK48-ubiquitin (rabbit monoclonal)abcamCat# ab1406011:1000
AntibodyKi67-Immunofluorescence (mouse monoclonal)abcamCat# ab2796531:100
AntibodyKi67-FACS (rat monoclonal)BioLegendCat# 652406; RRID:AB_25619301:100
AntibodyMeCP2 (rabbit monoclonal)Cell Signaling TechnologyCat# 3456; RRID:AB_21438491:1000
AntibodyMeCP2-ChIP (rabbit polyclonal)abcamCat# ab2828; RRID:AB_21438531:50
AntibodyNedd4 (rabbit polyclonal)ProteintechCat# 21698-1-AP; RRID:AB_108586261:1000
AntibodyNr1h3 (rabbit polyclonal)ProteintechCat# 14351-1-AP;
RRID:AB_10640525		1:1000
AntibodyRara (rabbit polyclonal)ProteintechCat# 10331-1-AP;
RRID:AB_2177742		1:1000
Antibodyp-Rb S807/811 (rabbit monoclonal)Cell Signaling TechnologyCat# 8516; RRID:AB_111786581:1000
AntibodyUbiquitin (mouse monoclonal)Cell Signaling TechnologyCat# 3936; RRID:AB_3312921:1000
AntibodyDonkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (mouse polyclonal)Thermo Fisher ScientificCat# A21202; RRID:AB_1416071:100
AntibodyDonkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (rabbit polyclonal)Thermo Fisher ScientificCat# A21207; RRID:AB_1416371:100
Recombinant DNA reagentpLKO.1 vectorAddgeneCat #8453;
RRID:Addgene_8453
Recombinant DNA reagentpCMV-deltaR8AddgeneCat #12263;
RRID:Addgene_12263
Recombinant DNA reagentpCMV-VsVgAddgeneCat #8454;
RRID:Addgene_8454
Recombinant DNA reagentAAV8-TBG-MeCP2Genechem Co., LtdGOSV0233517
Recombinant DNA reagentMecp2 Mouse Tagged ORF Clone, transcript variant 1OriGeneCat# MR226839
Recombinant DNA reagentMecp2 Mouse Tagged ORF Clone, transcript variant 2OriGeneCat# MR207745
Recombinant DNA reagentNedd4 Mouse Tagged ORF CloneOriGeneCat# MR222243
Recombinant DNA reagentpCMV6-Entry Mammalian Expression VectorOriGeneCat# PS100001
Chemical compound, drugMG132selleckCat# S261910 μM
Chemical compound, drugPuromycinSigma-AldrichCat# P88332 µg/ml
Chemical compound, drugPolybreneSigma-AldrichCat# TR-10036 µg/ml
Chemical compound, drugPen StrepGibcoCat# 15140-1221%
Commercial assay or kitComplete Protease Inhibitor mini EASY packs EDTA-FreeRocheCat# 05892791001
Commercial assay or kitLipofectamine 3000 Transfection ReagentThermo Fisher ScientificCat# L3000-015
Commercial assay or kitPropidium Iodide (PI)/RNase Staining SolutionCell Signaling TechnologyCat# 4087
Commercial assay or kitDAPIThermo Fisher ScientificCat# D-1306
Commercial assay or kitPierce IP Lysis BufferThermo Fisher ScientificCat# 87787
Commercial assay or kitDAB KitZSGB-BIOCat# ZLI-9018
Commercial assay or kitWestern Lightning Plus ECLPerkinElmerCat# 0RT2655
Commercial assay or kitSimpleChIP Plus Enzymatic Chromatin IP KitCell Signaling TechnologyCat# 9005
Commercial assay or kitDynabeads Protein GThermo Fisher ScientificCat# 10004D
Commercial assay or kitCoomassie Blue Super Fast Staining SolutionBeyotimeCat# P0017F
Sequence-based reagentsiRNA to MeCP2 #1This paperSuzhou GenePharma Co., LtdCCUGAAGGUUGGACACGAA
Sequence-based reagentsiRNA to MeCP2 #2This paperSuzhou GenePharma Co., LtdUGACAAAGCUUCCCGAUUA
Sequence-based reagentsiRNA to MeCP2 #3This paperSuzhou GenePharma Co., LtdCCGAAUUGCUGCUGCUUUA
Sequence-based reagentsiRNA to MeCP2 #4This paperSuzhou GenePharma Co., LtdCGAAAUGGCUGUGUAGCAA
Sequence-based reagentsiRNA to Nedd4: #1This paperSuzhou GenePharma Co., LtdCAGUGAUCCUUACGUAAGATT
Sequence-based reagentsiRNA to Nedd4 #2This paperSuzhou GenePharma Co., LtdGGGAAAUCGUACGAGAAGATT
Sequence-based reagentsiRNA to Nedd4 #3This paperSuzhou GenePharma Co., LtdGGAGGAUUAUGGGUGUGAATT
Sequence-based reagentAlb, FThis paperPCR primerACCTGAAGATGTTCGCGATTATCT
Sequence-based reagentAlb, RThis paperPCR primerACCGTCAGTACGTGAGATATCTT
Sequence-based reagentMeCP2, FThis paperPCR primerGCTGGGGCCCTTGTTTTGAAT
Sequence-based reagentMeCP2, RThis paperPCR primerGCTTTAGGTTGCTGGTGATA
Sequence-based reagentAr, FThis paperPCR primerCTGGGAAGGGTCTACCCAC
Sequence-based reagentAr, RThis paperPCR primerGGTGCTATGTTAGCGGCCTC
Sequence-based reagentα-actin mouse, FThis paperPCR primerGGCTGTATTCCCCTCCATCG
Sequence-based reagentα-actin mouse, RThis paperPCR primerCCAGTTGGTAACAATGCCATGT
Sequence-based reagentα-actin human, FThis paperPCR primerCACCATTGGCAATGAGCGGTTC
Sequence-based reagentα-actin human, RThis paperPCR primerAGGTCTTTGCGGATGTCCACGT
Sequence-based reagentMeCP2 common, FThis paperPCR primerTATTTGATCAATCCCCAGGG
Sequence-based reagentMeCP2 common, RThis paperPCR primerCTCCCTCTCCCAGTTACCGT
Sequence-based reagentMeCP2 mouse, FThis paperPCR primerGAGCGGCACTGGGAGACC
Sequence-based reagentMeCP2 mouse, RThis paperPCR primerCTGGATGGTGGTGATGAT
Sequence-based reagentMeCP2 human, FThis paperPCR primerGATGTGTATTTGATCAATCCC
Sequence-based reagentMeCP2 human, RThis paperPCR primerTTAGGGTCCAGGGATGTGTC
Sequence-based reagentNedd4, FThis paperPCR primerTCGGAGGACGAGGTATGGG
Sequence-based reagentNedd4, RThis paperPCR primerGGTACGGATCAGCAGTGAACA
Sequence-based reagentNr1h3, FThis paperPCR primerCTCAATGCCTGATGTTTCTCCT
Sequence-based reagentNr1h3, RThis paperPCR primerTCCAACCCTATCCCTAAAGCAA
Sequence-based reagentNr1i3, FThis paperPCR primerATATGGGCCGAGGAACTGTGT
Sequence-based reagentNr1i3, RThis paperPCR primerGGCGTGGAAATGATAGCCTGT
Sequence-based reagentNr2f6, FThis paperPCR primerGAGGACGATTCGGCGTCAC
Sequence-based reagentNr2f6, RThis paperPCR primerGTAATGCTTTCCACTGGACTTGT
Sequence-based reagentNr3c1, FThis paperPCR primerAGCTCCCCCTGGTAGAGAC
Sequence-based reagentNr3c1, RThis paperPCR primerGGTGAAGACGCAGAAACCTTG
Sequence-based reagentNr4a1, FThis paperPCR primerTTGAGTTCGGCAAGCCTACC
Sequence-based reagentNr4a1, RThis paperPCR primerGTGTACCCGTCCATGAAGGTG
Sequence-based reagentNr5a2, FThis paperPCR primerTGAGGAACAACTCCGGGAAAA
Sequence-based reagentNr5a2, RThis paperPCR primerCAGACACTTTATCGCCACACA
Sequence-based reagentNr6a1, FThis paperPCR primerCGCAACGGTTTCTGTCAGGAT
Sequence-based reagentNr6a1, RThis paperPCR primerGTTCAGCTCGATCATCTGGGA
Sequence-based reagentPpard, FThis paperPCR primerCTCATGAATGTGCCCCAGGT
Sequence-based reagentPpard, RThis paperPCR primerGTGCAGCAAGGTCTCACTCT
Sequence-based reagentRxrg, FThis paperPCR primerCATGAGCCCTTCAGTAGCCTT
Sequence-based reagentRxrg, RThis paperPCR primerCGGAGAGCCAAGAGCATTGAG
Sequence-based reagentRara, FThis paperPCR primerATGTACGAGAGTGTGGAAGTCG
Sequence-based reagentRara, ReserveThis paperPCR primerACAGGCCCGGTTCTGGTTA
Sequence-based reagentSrebf1, FThis paperPCR primerGCAGCCACCATCTAGCCTG
Sequence-based reagentSrebf1, RThis paperPCR primerCAGCAGTGAGTCTGCCTTGAT
Sequence-based reagentMeCP2, FThis paperChIP-qPCR primerTAAGTGACAGGAGTCACAGCG
Sequence-based reagentMeCP2, RThis paperChIP-qPCR primerTGGGACGTTGTATGTAACGGG
Sequence-based reagentNr1h3, FThis paperChIP-qPCR primerCAGCACGTTGTAATGGAAGCC
Sequence-based reagentNr1h3, RThis paperChIP-qPCR primerTAGCATTCAGTGGAGGGAAGG
Sequence-based reagentRara, FThis paperChIP-qPCR primerCGATGAGTGGCAAGGTCTTT
Sequence-based reagentRara, RThis paperChIP-qPCR primerATAGCATAGCACCAGGGACAC
Sequence-based reagentshRNA for Nr1h3This papershRNA sequenceCCTCAAGGACTTCAGTTACAA
Sequence-based reagentshRNA for RaraThis papershRNA sequenceGAGCAGCAGTTCCGAAGAGAT
OtherB6. Cg-Speer6-ps1Tg (Alb-cre)21Mgn/J miceThe Jackson LaboratoryCat# 003574Hepatocyte-specific Cre-transgenic mouse
OtherMeCP2flox/floxShanghai Model Organisms CenterCat #NM-CKO-190001Mice carrying the targeted MeCP2 allele
OtherC57/BL6Guangdong Medical Laboratory Animal CenterCat #17Wild-type mouse
Software, algorithmGraphPad PrismGraphPad
Software		Version 8.0
Software, algorithmModFitModFit LT SoftwareVersion 4.1https://www.vsh.com/products/mflt/index.asp
Software, algorithmImageJImageJ softwarehttps://imagej.nih.gov/ij/

Additional files

Supplementary file 1

For the GO enrichment analysis, the binding proteins of Mecp2 during the cell cycle reentry.

https://cdn.elifesciences.org/articles/89912/elife-89912-supp1-v1.csv
MDAR checklist
https://cdn.elifesciences.org/articles/89912/elife-89912-mdarchecklist1-v1.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Jun Yang
  2. Shitian Zou
  3. Zeyou Qiu
  4. Mingqiang Lai
  5. Qing Long
  6. Huan Chen
  7. Ping lin Lai
  8. Sheng Zhang
  9. Zhi Rao
  10. Xiaoling Xie
  11. Yan Gong
  12. Anling Liu
  13. Mangmang Li
  14. Xiaochun Bai
(2024)
Mecp2 fine-tunes quiescence exit by targeting nuclear receptors
eLife 12:RP89912.
https://doi.org/10.7554/eLife.89912.3