Research Article

Genetics and Genomics

Mitochondrial genomes of Pleistocene megafauna retrieved from recent sediment layers of two Siberian lakes

Department of Biology, University of Konstanz, Germany
Agroengineering Department/Department of Landscape Design and Sustainable Ecosystems, Agrarian and Technological Institute, RUDN University, Russian Federation
Laboratory of Carbon Monitoring in Terrestrial Ecosystems, Institute of Physicochemical and Biological Problems of Soil Science of the Russian Academy of Sciences, Russian Federation
Alfred Wegener Institute Helmholtz Centre for Polar and Marine Research, Polar Terrestrial Environmental Systems, Germany
Department of Ecology and Evolutionary Biology, University of California, Santa Cruz, United States
Howard Hughes Medical Institute, University of California, Santa Cruz, United States
Embark Veterinary, Inc, United States

Mar 15, 2024

https://doi.org/10.7554/eLife.89992.3

Open access
Copyright information

Figures
Tables
Additional files

3 figures, 16 tables and 1 additional file

Figures

Figure 1

Download asset Open asset

aDNA of *Mammuthus* in recent lake sediments.

(A) Read counts assigned to *Mammuthus* (square-root-transformed proportion of the respective number of raw reads per library) after hybridization capture enrichment of aeDNA of core LK-001 (shown are results of 22 libraries; one library was excluded as it did not produce any reads assigned to mammals); square-root transformation of percentage. Indicated are sample depths (in cm; 1.5–80 cm) and approximate ages as per ²¹⁰Pb chronology (Appendix 1—table 7; to a maximum depth of 39.5 cm). The solid line indicates the general trend. Across the 22 libraries: (B) Fragment length distribution and (C) damage patterns (red indicates C-to-T transitions, blue G-to-A transitions. the Y-axis indicates the percentage of positions with a nucleotide change, the X-axis indicates the position along the fragment).

Figure 2

Download asset Open asset

Locations of the sediment cores of the present study (Yamal peninsula, Siberia) and previously retrieved mammoth remains and their haplo(sub)groups (Appendix 1—table 6).

The bar chart indicates a maximum-likelihood estimate of the haplogroup proportions derived from the reads from the three sediment core libraries with the most mammoth reads.

Appendix 1—figure 1

Download asset Open asset

Comparison of transformed metabarcoding read counts (A) and ddPCR concentration estimations (B) of *Mammuthus primigenius* DNA in sediment cores LK-001 and LK-007 from the Yamal peninsula.

Tables

Table 1

Sediment cores retrieved from two lakes on the Yamal peninsula, Siberia.

Lake	Coordinates	m above sea level	Area	Water depth	Core length
LK-001	70°16'45.6" N, 68°53'02.8" E	28	38 ha	17 m	80 cm
LK-007	70°16'02.8" N, 68°59'35.7" E	36	39 ha	14 m	75 cm

Appendix 1—table 1

Sample depths and extraction protocols.

(a) LK-001		(b) LK-007
Sample depth (cm)	Extraction protocol*	Sample depth (cm)	Extraction protocol*
1.5	PowerLyzer	2.0	PowerLyzer
4.0		4.0	PowerSoil Pro
7.0		6.0	PowerLyzer
11.0		8.0	PowerSoil Pro
12.0		10.0	PowerLyzer
15,5		12.0	PowerSoil Pro
18.0		14.0	PowerSoil Pro
21.5		18.0	PowerLyzer
23.0		20.	PowerSoil Pro
28.0		24.0	PowerLyzer
31.5		26.0	PowerSoil Pro
35.0		30.0	PowerSoil Pro
40.0		32.0	PowerSoil Pro
44.0		36.0	PowerLyzer
46.5		38.0	PowerSoil Pro
49.0		42.0	PowerSoil Pro
51.0		44.0	PowerLyzer
62.0		48.0	PowerLyzer
65.5		50.0	PowerLyzer
66.5		54.0	PowerLyzer
69.5		56.0	PowerLyzer
73.5		60.0	PowerLyzer
80.0		62.0	PowerSoil Pro
		64.0	PowerLyzer
		66.0	PowerSoil Pro
		68.0	PowerLyzer
		70.0	PowerSoil Pro

*

Kits from Qiagen (Hilden, Germany).

Appendix 1—table 2

PowerLyzer DNA extraction.

Day 1:	1. Add 750 μL PowerBead Solution to the PowerBead Tube 2. Transfer 0.25–0.35 g manually homogenized sediment to PowerBead Tube 3. FastPrep bead beating: two times Quickprep protocol (20 s at 4.0 m/s); briefly centrifuge to eliminate foam 4. Lysis mix (per sample): Solution C1 60 µL Proteinase K (20 mg/mL) 2 µL 1 M DTT 25 µL Vortex and briefly centrifuge. 5. Add 87 μL lysis mix to each PowerBead Tube; vortex for 5 min; invert the tube, flick and vortex to dissolve pellet, if present. 6. Incubate overnight at 56 °C and 12 rpm
Day 2:	1. Remove PowerBead Tube from the incubator oven and allow to cool to room temperature 2. Centrifuge at 10,000 x g for 1 min 3. Add 250 μL Solution C2 to a 2 mL collection tube 4. Avoiding the pellet, pour the supernatant from step 2 into the collection tube containing Solution C2; vortex for 5 s 5. Incubate at 2–8 °C for 10 min 6. Centrifuge at 10,000 x g for 1 min 7. Label a new clean 2 mL collection tube and add 250 μL Solution C3 8. Avoiding the pellet, pour up to 800 μL of supernatant to the collection tube containing Solution C3; vortex for 5 s 9. Incubate at 2–8 °C for 10 min 10. Centrifuge at 10,000 x g for 1 min 11. Label a new clean 5 mL collection tube and add 1,400 μL Solution C4 12. Avoiding the pellet, pour 880 μL of supernatant to the collection tube containing Solution C4; vortex for 5 s; briefly centrifuge 13. Load 650 μL of the Solution C4-supernatant mix on a Spin Column 14. Centrifuge the Spin Column at 10,000 x g for 1 min 15. Transfer the Spin Column to a new 2 mL collection tube 16. Repeat steps above until all Solution C4-supernatant mix has been loaded onto the Spin Column 17. Centrifuge the Spin Column at 10,000 x g for 1 min 18. Load 500 μL of Solution C5 on the Spin Column 19. Centrifuge the Spin Column at 10,000 x g for 1 min 20. Transfer the Spin Column to a new 1.5 mL collection tube 21. Centrifuge the Spin Column at 10,000 x g for 1 min 22. Transfer the Spin Column to a new, labelled, and sterile 1.5 mL collection tube 23. Add 65 μL of elution buffer to the center of the filter membrane 24. Incubate at room temperature for 10 min 25. Centrifuge the Spin Column at 10,000 x g for 1 min 26. Repeat steps above for a final elution volume of 120–125 μL
PowerSoil Pro DNA extraction was performed as follows:
Day 1:	1. Spin the PowerBead Pro Tube briefly; add up to 500 mg soil and 800 μL Solution CD1. Vortex briefly to mix. Add 20 µL Proteinase K (2 mg/mL). 2. FastPrep bead beating: two times 20 s at 4.0 m/s; briefly centrifuge to eliminate foam. Incubate at 56 °C overnight.
Day 2:	3. Centrifuge the PowerBead Pro Tube at 15,000 x g for 1 min. 4. Transfer the supernatant to a clean 2 mL microcentrifuge tube. 5. Add 200 μL Solution CD2 and vortex for 5 s. 6. Centrifuge at 15,000 x g for 1 min at room temperature. Transfer up to 700 μL supernatant to a clean 2 mL microcentrifuge tube. 7. Add 600 μL Solution CD3 and vortex for 5 s. 8. Load 650 μL of the lysate on an MB Spin Column and centrifuge at 15,000 x g for 1 min. 9. Discard the flow-through and repeat step 8 to ensure that all of the lysate has passed through the MB Spin Column. 10. Place the MB Spin Column in a clean 2 mL collection tube. 11. Add 500 μL Solution EA to the MB Spin Column. Centrifuge at 15,000 x g for 1 min. 12. Discard the flow-through and place the MB Spin Column back into the same collection tube. 13. Add 500 μL Solution C5 to the MB Spin Column. Centrifuge at 15,000 x g for 1 min. 14. Discard the flow-through and place the MB Spin Column in a new 2 mL collection tube 15. Centrifuge at 16,000 x g for 2 min. Place the MB Spin Column in a new 1.5 mL elution tube. 16. Add 50–100 μL Solution C6 to the center of the white filter membrane; incubate for 5 min, and centrifuge at 15,000 x g for 1 min.

Appendix 1—table 3

Library preparation.

End repair		per library
Mix following components in a sterile low-binding PCR tube
	NEBNext End Repair Buffer (10 X)	5 µL
	NEBNext End Repair Enzyme Mix	2.5 µL
	genomic DNA	42.5 µL
Incubate in a thermal cycler for 30 mins at 20 °C. Purify using QIAquick/MinElute PCR purification kit. Elution: add 32 µl buffer EB and incubate at 37 °C for 5 min before spinning down the DNA at 13,000 rpm for 1 min.
Adapter ligation
Mix following components in a sterile low-binding PCR tube
	Quick Ligation Reaction Buffer (10 X)	10 µL
	nuclease-free water	4 µL
	P5/P7 adapter mix (50 µM stock)	1 µL
	DNA as purified in step above	30 µL
	Quick T4 DNA ligase	4.8 µL
final adapter concentrations for ancient samples should be between 0.25–0.5 µM. *it is vital to add ligase after mixing DNA with adaptors.
Incubate for 15 min at 25 °C; purify using a QIAquick/MinElute PCR purification kit. Elution: 42 µL buffer EB and incubate at 37 ºC for 5 min before spinning down the DNA at 13,000 rpm for 1 min.
Fill-In Reaction
Add the following reagents into a low-binding PCR tube
	ThermoPol Reaction Buffer	5 µL
	dNTPs (10 mM)	2 µL
	Bst DNA polymerase	3 µL
	DNA as eluted above	40 µL
Incubate: 20 mins at 65 °C 20 mins at 80 °C No purification is needed after this step.

Appendix 1—table 4

Indexing PCR.

Reagent	µL
H₂O	3.45
Platinum Hifi Taq Buffer 10 X (Thermo Fisher Scientific)	2.50
dNTPs (25 mM)	0.25
bovine serum albumin (New England Biolabs)	1.00
MgSO₄ (50 mM)	1.00
Platinum HiFi (5 U/µL; Thermo Fisher Scientific)	0.20
total	8.40
Index P5 (10 µM)	0.80
Index P7 (10 µM)	0.80
template DNA	15.00
Thermocycling
°C	t
94	1 min
94	15 s	8 cycles
60	20 s
68	60 s
68	3 min
20	store

Appendix 1—table 5

Mitogenome templates of 17 mammal species for design of RNA baits.

Order	Species	NCBI accession	# of baits
Artiodactyla	Bison bison	NC_012346.1	446
	Bos primigenius	NC_020746.1	456
	Saiga tatarica	NC_013996.1	538
	Ovis canadensis	NC_015889.1	522
	Ovibos moschatus	NC_020631.1	542
	Cervus elaphus	NC_007704.2	523
	Rangifer tarandus	NC_007703.1	526
	Alces alces	NC_020677.1	520
	Camelus ferus	NC_009629.2	583
Perissodactyla	Equus przewalskii	NC_024030.1	575
Perissodactyla	Coelodonta antiquitatis	NC_012681.1	571
Lagomorpha	Lepus arcticus	NC_044769.1	586
Lagomorpha	Ochotona collaris	NC_003033.1	591
Proboscidea	Mammuthus primigenius	NC_007596.2	588
Eulipotyphla	Sorex tundrensis	NC_025327.1	584
Rodentia	Castor canadensis	NC_033912.1	584
Rodentia	Dicrostonyx torquatus	NC_034646.1	575
9,310

Appendix 1—table 6

Cladonia rangiferina sequences for RNA bait design (shown are the NCBI accessions).

ITS-1
MN756840.1; DQ394367.1; JQ695919.1; MK179592.1; KP031549.1; KP001202.1; AF458306.1; KT792792.1; MK811970.1; KT792788.1; MK508944.1; GU169225.1; KP001197.1; KP001201.1; MK812260.1; MK811708.1; KY119381.1; MK508952.1; KT792789.1; EU266113.1; KY266884.1; KP001192.1; KP001190.1; JQ695918.1; KT792790.1; JQ695920.1; KP001191.1; AF458307.1; KP001200.1; MK508943.1; MK812460.1; MK508937.1; KT792791.1 *resulting in 23 baits*
ITS-2
KT792789.1; KP001190.1; AF458307.1; JQ695919.1; MK179592.1; DQ394367.1; KP001194.1; KP001193.1; KY266884.1; KP001199.1; KP001192.1; MK300750.1; MN756487.1; MK508937.1; KP001200.1; MK812460.1; MK508943.1; KP001191.1; KP031549.1; KP001202.1; AF458306.1; MK811970.1; KY119381.1; KP001198.1; MK812260.1; MK811708.1; GU169225.1; JQ695918.1; KP001201.1 *resulting in 6 baits*

Appendix 1—table 7

Reference mitogenomes used for mapping.

NC_020679.1	Antilocapra americana	NC_018783.1	Equus ovodovi
NC_012346.1	Bison bison	HM118851.1	Equus hemionus
NC_020746.1	Saiga tatarica	MK982180.1	Equus asinus
NC_013996.1	Bos primigenius	NC_012681.1	Coelodonta antiquitatis
NC_015889.1	Ovis canadensis	NC_007596.2	Mammuthus primigenius
NC_020630.1	Oreamnos americanus	FR691686.1	Castor fiber
NC_020631.1	Ovibos moschatus	NC_033912.1	Castor canadensis
NC_027233.1	Bison priscus	NC_034313.1	Dicrostonyx groenlandicus
NC_009629.2	Camelus ferus	NC_034646.1	Dicrostonyx torquatus
KR822422.1	Camelops cf. hesternus	JN181159.1	Peromyscus leucopus
NC_013836.1	Cervus elaphus xanthopygus	NC_006853.1	Bos taurus
NC_007704.2	Cervus elaphus	KM093871.1	Capra hircus
NC_013840.1	Cervus elaphus yarkandensis	NC_015241.1	Microtus fortis fortis
KP405229.1	Alces alces cameloides	KP200876.1	Vulpes lagopus
NC_020677.1	Alces alces	HM236180.1	Ovis aries
NC_020729.1	Odocoileus hemionus	KT448275.1	Canis latrans
NC_015247.1	Odocoileus virginianus	JN632610.1	Capreolus capreolus
NC_007703.1	Rangifer tarandus	KJ681493.1	Capreolus pygargus
KY987554.1	Platygonus compressus	JN632629.1	Dama dama
NC_002008.4	Canis lupus familiaris	KM982549.1	Lynx lynx
NC_009686.1	Canis lupus lupus	KP202265.1	Panthera pardus
NC_013445.1	Cuon alpinus	NC_026460.1	Rhinolophus macrotis
NC_026529.1	Vulpes lagopus	Y07726.1	Ceratotherium simum
NC_028302.1	Panthera leo	NC_005089.1	Mus musculus
NC_022842.1	Panthera onca	AM711900.1	Meles meles
NC_010642.1	Panthera tigris	KM091450.1	Mustela erminea
NC_014456.1	Lynx rufus	NC_005358.1	Ochotona princeps
NC_020642.1	Martes americana	NC_012095.1	Sus scrofa domesticus
NC_020641.1	Neovison vison	DQ480489.1	Canis lupus familiaris
NC_024942.1	Mustela nigripes	NC_020670.1	Crocuta crocuta
NC_020664.1	Martes pennanti	NC_011116.1	Arctodus simus
NC_020639.1	Mustela nivalis	NC_027963.1	Sorex araneus
NC_009685.1	Gulo gulo	NC_025327.1	Sorex tundrensis
NC_011112.1	Ursus spelaeus	KJ397607.1	Lepus arcticus
NC_003426.1	Ursus americanus	NC_001640.1	Equus caballus
NC_003427.1	Ursus arctos	NC_024030.1	Equus przewalskii
NC_003428.1	Ursus maritimus

Appendix 1—table 8

Command lines and software used for initial mapping, processing, and taxonomic assignment.

adapter trimming, filtering, and merging: leeHom Renaud et al., 2014:	src/leeHom -t 120 –ancientdna –auto -fq1 file_R1.fastq.gz -fq2 file_R2.fastq.gz -fqo leehom_out
mapping: BWA Li and Durbin, 2009 against 75 mammal mitogenomes Appendix 1—table 3:	bwa index reference_mitogenomes.fasta bwa aln reference_mitogenomes.fasta leehom_out.fq.gz -l 16,000 n 0.01 -O 2 -o 2 t 8>bwa_out.sai bwa samse reference_mitogenomes.fasta bwa_out.sai leehom_out.fq.gz>bwa_out.sam samtools view -q ≥ 30 S -b bwa_out.sam>bwa_out.bam
remove duplicates: samtools Li and Durbin, 2009	samtools collate -o bwa_out_col.bam bwa_out.bam samtools fixmate -m bwa_out_col.bam bwa_out_fixmate.bam samtools sort -o bwa_out_pos.bam bwa_out_fixmate.bam samtools markdup bwa_out_pos.bam bwa_out_mark.bam samtools fastq bwa_out_mark.bam>bwa_out.fastq
fastq to fasta	sed -n ‘1~4 s/^@/>/p;2~4 p’ bwa_out.fastq>bwa_out.fasta
	#alignment: blastn Altschul et al., 1990 blastn -db ncbi_nt -query bwa_out.fasta -evalue 0.01 -out blastn_out.fasta
aDNA damage: mapDamage Ginolhac et al., 2011	bwa index reference.fasta bwa aln reference.fasta sample.fasta >sample.sai bwa samse referecne.fasta sample.sai sample.fasta >sample.sam samtools view -q 25 S -b sample.sam >sample.bam mapDamage -i sample.bam -r reference.fasta mapDamage -d results_ sample/ -y 0.1 --plot-only mapDamage -i sample.bam -r reference.fasta –rescale mapDamage -d results_sample / --forward --stats-only -v -r reference.fasta

Appendix 1—table 9

Reference mammoth mitogenomes used for panel.

Clade	Haplogroup	Subgroup	Accession numbers	Proportion of reads assigned to haplogroup
II	A		EU153451, EU153450	-
III	B	B0	KX027526, KX027531	-
		B1	KX027526	0.1615
		B2	KX027531	-
I	C		KX027498, KX027565, KX027567, JF912200, KX027499, KX027502	-
I	D&E	D0	DQ316067, EU153454, EU153447, EU153456, EU153449, EU153455, EU153446	-
		D1	DQ316067	-
		D2	EU153454	-
		D3	EU153447	0.2790
		D4	EU153456	-
		D5	EU153449	0.0765
		D6	EU153455	0.4829
		D7	EU153446	-
I	F		KX027503, KX027512, NC_015529, KX027511, KX027548, KX027547, KX027556, KX027559, KX027550	-
Krestovka mammoth	K		PRJEB42269 (European Nucleotide Archive)	-
Conventional PCR
94 °C	2 min
94 °C	30 s	55 cycles
54 °C	30 s
68 °C	20 s
68 °C	1 min

Appendix 1—table 10

Conventional PCR.

Reagent	µL
H₂O	14.85
Platinum Hifi Taq Buffer 10 X (Thermo Fisher Scientific)	2.5
bovine serum albumin (New England Biolabs)	0.2
MgSO₄ (50 mM)	1.00
dNTPs (25 mM)	0.25
Platinum HiFi (5 U/µL; Thermo Fisher Scientific)	0.20
Blocking primer R (1 µM)	0.5
Blocking primer F (1 µM)	0.5
total	20.00
template DNA	3.00
Thermocycling
°C	t
94	5 min
94	30 s	40 cycles
50	30 s
68	30 s
68	10 min
RT	store

Appendix 1—table 11

Conventional PCR.

Load data	obi import --quality-sanger file_R1.fastq reads1 obi import --quality-sanger file_R2.fastq reads2
Import tags	obi import --ngsfilter-input taglist.txt ngsfile
Align paired-end reads	obi alignpairedend -R reads2 reads1 aligned_reads
Grep entries whose mode are alignment	obi grep -a mode:alignment aligned_reads good_sequences
Assign alignments to individual PCRs	obi ngsfilter -t ngsfile -u unidentified_sequences good_sequences identified_sequences
Filter out sequences	obi grep -p "sequence[’score']>50" identified_sequences identified_sequences_filtered obi grep -p "sequence[’score_norm']>0.9" identified_sequences_filtered identified_sequences_filtered_adj
Dereplicate Sequences	obi uniq -m sample identified_sequences_filtered_adj dereplicated_sequences_filtered
Keep only useful tags	obi annotate -k COUNT -k MERGED_sample dereplicated_sequences_filtered cleaned_metadata_sequences
Discard sequences that are shorter than 60 bp (based on primer pair)	obi grep -p "len(sequence) ≥ 60 and sequence['COUNT'] ≥ 10" cleaned_metadata_sequences denoised_sequences
Clean the sequences from PCR/sequencing errors	obi clean -s MERGED_sample -r 0.05 H denoised_sequences cleaned_sequences
Load database	cp STD_MAM_1.dat.gz ~/edna_LauraB/master/mammalia/database/
Import it into DMS	obi import /data/scc/edna/LauraBa/master/mammalia/database/STD_MAM_1.dat.gz database_mam obi import --embl EMBL embl_refs
Download the taxonomy	wget https://ftp.ncbi.nlm.nih.gov/pub/taxonomy/taxdump.tar.gz
Import the taxonomy in the DMS	obi import --taxdump /data/scc/edna/LauraBa/master/mammalia/taxdump.tar.gz taxonomy/my_tax
Cleaning the database with in silico PCR	obi ecopcr -e 3 l 50 L 150 F CGAGAAGACCCTATGGAGCT -R CCGAGGTCRCCCCAACC --taxonomy taxonomy/my_tax embl_refs mam_refs
Filter sequences	obi grep --require-rank=species --require-rank=genus --require-rank=family --taxonomy taxonomy/my_tax mam_refs mam_refs_clean
Dereplicate identical sequences	obi uniq --taxonomy taxonomy/my_tax mam_refs_clean mam_refs_uniq
Add taxid at the family level	obi grep --require-rank=family --taxonomy taxonomy/my_tax mam_refs_uniq
Build the reference database	obi build_ref_db -t 0.97 --taxonomy taxonomy/my_tax mam_refs_uniq_clean mam_db_97
Assign each sequence to a taxon	obi ecotag -m 0.97 --taxonomy taxonomy/my_tax -R mam_db_97 cleaned_sequences assigned_sequences
Align the sequences	obi align -t 0.95 assigned_sequences aligned_assigned_sequences
Export tables for downstream data analysis	obi grep -A SCIENTIFIC_NAME assigned_sequences assigned_for_metabR
Output two tables required by metabaR	obi annotate -k MERGED_sample assigned_for_metabR assigned_for_metabR_reads_tableobi export --tab-output --output-na-string 0 assigned_for_metabR_reads_table >mam_reads_01.txtobi annotate --taxonomy taxonomy/my_tax \ --with-taxon-at-rank superkingdom \ --with-taxon-at-rank kingdom \ --with-taxon-at-rank phylum \ --with-taxon-at-rank subphylum \ --with-taxon-at-rank class \ --with-taxon-at-rank subclass \ --with-taxon-at-rank order \ --with-taxon-at-rank suborder \ --with-taxon-at-rank infraorder \ --with-taxon-at-rank superfamily \ --with-taxon-at-rank family \ --with-taxon-at-rank genus \ --with-taxon-at-rank species \ --with-taxon-at-rank subspecies \ assigned_for_metabR assigned_for_metabR_taxInfo obi annotate \ -k BEST_IDENTITY -k TAXID -k SCIENTIFIC_NAME -k COUNT -k seq_length \ -k superkingdom_name \ -k kingdom_name \ -k phylum_name \ -k subphylum_name \ -k class_name \ -k subclass_name \ -k order_name \ -k suborder_name \ -k infraorder_name \ -k superfamily_name \ -k family_name \ -k genus_name \ -k species_name \ assigned_for_metabR_taxInfo assigned_for_metabR_motus obi export --tab-output assigned_for_metabR_motus >mam_motus_01.txt
Further processing of the data sets was done using RStudio.
Editing files for metabar	reads<- dt_reads %>% dplyr::select(-c("DEFINITION", "NUC_SEQ"))%>% as.data.frame() %>% janitor::row_to_names(row_number = 897, remove_rows_above = FALSE, remove_row = TRUE) %>% mutate_if(is.integer,as.numeric)
Assign name to first column	reads <- cbind(rownames(reads),reads) rownames(reads) <- NULL colnames(reads) <- c(names(reads)) colnames(reads)(1) <- "pcr_id"
Edit the names of the column	reads$pcr_id = strsplit(reads$pcr_id,"[.]") reads$pcr_id = sapply(reads$pcr_id, function(x) x[length(x)]) rownames(reads)<- reads$pcr_id
Organizing the MOTUs table	motus<- dplyr::select(dt_motus, 'ID', 'NUC_SEQ', 'COUNT','BEST_IDENTITY', 'TAXID', 'SCIENTIFIC_NAME', ’superkingdom_name', ’species_name', 'class_name', 'order_name', 'family_name', 'genus_name', 'kingdom_name', 'phylum_name', ’subphylum_name', ’subclass_name', ’suborder_name') names(motus)[names(motus) == 'NUC_SEQ'] <- ’sequence'

Appendix 1—table 12

Conventional PCR.

Reagent	µL
ddPCR Supermix for probes	11
H2O (DEPC)	6.8
20 x Target-Primers/Probe (FAM)	1.1
20 x Target-Primers/Probe (HEX)	1.1
total	20
template DNA	2.0
Thermocycling
°C	t
95	10 min
94	30 sec	40 cycles
50	30 sec
60	30 sec

Appendix 1—table 13

²¹⁰Pb chronology of Yamal lake sediment core LK-001.

Depth		Chronology			Sedimentation Rate
		Date	Age
cm	g cm^–2	AD	y	±	g cm^–2 y^–1	cm y^–1
0.00	0.0	2019	0	0
0.25	0.2	2018	1	1	0.34	0.37
1.25	1.1	2016	3	2	0.34	0.37
2.25	1.9	2013	6	2	0.34	0.37
3.25	2.8	2010	9	2	0.34	0.37
4.25	3.8	2008	11	2	0.34	0.37
5.25	4.7	2005	14	2	0.34	0.37
6.25	5.7	2002	17	2	0.34	0.37
7.25	6.7	1999	20	3	0.36	0.37
8.25	7.6	1996	23	3	0.39	0.41
10.25	9.7	1992	27	3	0.49	0.47
12.25	11.8	1988	31	4	0.53	0.49
14.25	14.0	1984	35	4	0.55	0.51
14.75	14.5	1983	36	4	0.55	0.51
15.50	15.4	1981	38	4	0.55	0.51
16.50	16.5	1980	39	4	0.55	0.51
17.50	17.6	1978	41	4	0.55	0.51
18.50	18.6	1976	43	4	0.55	0.51
20.50	20.7	1971	48	5	0.55	0.51
22.50	22.7	1968	51	6	0.55	0.51
23.50	23.7	1966	53	6	0.55	0.51
24.50	24.8	1964	55	6	0.55	0.51
25.50	25.9	1962	57	7	0.44	0.42
26.50	27.0	1961	58	7	0.37	0.36
27.50	28.0	1957	62	8	0.30	0.29
28.50	29.0	1952	67	9	0.28	0.22
29.50	30.2	1949	70	10	0.23	0.19
31.50	32.6	1938	81	10	0.23	0.19
33.50	34.7	1933	86	10	0.23	0.19
35.50	36.9	1927	92	11	0.23	0.19
37.50	39.1	1913	106	13	0.23	0.19
39.50	41.4	1895	124	17	0.23	0.19

Appendix 1—table 14

Radiocarbon dating results.

Sample label	F14C	± (abs)	Age (y)	± (y)	Weight (µg C)	Comment
LK-001_36.5 cm	0.9595	0.0095	332	79	35
LK-001_51 cm	0.3396	0.0056	8677	132	148	Off; lateral input
LK-001_74 cm	0.8248	0.0234	1547	228	13

Appendix 1—table 15

Numbers of sequences assigned to mammals (core LK-001).

		depth
	sum	1.5	4.0	7.0	11.0	12.0	15.5	18.0	21.5	23.0	28.0	31.5	35.0	40.0	46.5	49.0	51.0	62.0	65.5	66.5	69.5	73.5	80.0
Mammuthus primigenius	19,640	191	162	524	290	1205	605	194	666	277	800	3697	305	1188	1374	1923	631	674	519	1110	1083	814	1408
Rangifer tarandus	18,055	253	63	-	34	328	688	644	1816	545	902	2186	1240	1571	1574	86	284	2714	56	345	991	114	1,621
Dicrostonyx torquatus	16,870	211	112	34	111	1211	614	271	1035	522	1049	850	1298	314	761	193	318	656	200	2763	1011	1408	1928
Lepus	6371	148	134	105	23	584	245	40	369	336	630	382	231	404	799	285	141	116	126	352	330	293	298
Coelodonta antiquitatis	2737	33	-	-	28	119	153	347	55	-	97	128	467	298	141	27	103	152	-	250	144	4	191
Homo sapiens	387	-	-	-	-	-	-	38	217	-	-	23	-	25	-	69	-	15	-	-	-	-	-
Ovibos moschatus moschatus	145	-	69	-	-	-	-	-	-	-	38	-	-	-	38	-	-	-	-	-	-	-	-
Castor fiber	135	-	-	-	-	18	-	-	-	-	15	-	-	-	27	51	-	6	1	-	-	-	17
Bos	105	-	-	-	-	-	-	-	-	-	-	-	-	-	-	105	-	-	-	-	-	-	-
Cervinae	92	-	-	-	-	-	-	-	33	-	-	-	-	31	28	-	-	-	-	-	-	-	-
Saiga tatarica	91	-	-	-	-	-	-	-	-	-	57	-	34	-	-	-	-	-	-	-	-	-	-
Sus scrofa cristatus	85	-	-	-	-	-	-	-	34	-	-	-	-	-	-	24	-	-	-	-	27	-	-
Ochotona	74	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	14	-	-	-	60
Ovis aries musimon	70	-	-	-	-	70	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Bison	54	-	-	-	-	24	-	30	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Crocuta crocuta	53	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	53	-	-	-
Chrotopterus auritus	43	-	-	-	-	-	43	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Sorex tundrensis	32	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	32	-	-	-	-	-	-
Equus	32	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	7	-	-	-	25
Peromyscus maniculatus bairdii	29	-	-	-	-	-	-	-	-	-	-	-	-	-	29	-	-	-	-	-	-	-	-
Murinae	28	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	28	-
Capra	21	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	21	-	-	-	-	-	-
Myopus schisticolor	18	-	-	-	-	-	-	-	18	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Lemmus trimucronatus	16	16	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-

Additional files

MDAR checklist: https://cdn.elifesciences.org/articles/89992/elife-89992-mdarchecklist1-v1.docx
Download elife-89992-mdarchecklist1-v1.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Article PDF

Open citations (links to open the citations from this article in various online reference manager services)

Mendeley

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Peter Andreas Seeber
Laura Batke
Yury Dvornikov
Alexandra Schmidt
Yi Wang
Kathleen Stoof-Leichsenring
Katie Moon
Samuel H Vohr
Beth Shapiro
Laura S Epp

(2024)

Mitochondrial genomes of Pleistocene megafauna retrieved from recent sediment layers of two Siberian lakes

eLife 12:RP89992.

https://doi.org/10.7554/eLife.89992.3

Figures

aDNA of Mammuthus in recent lake sediments.

Locations of the sediment cores of the present study (Yamal peninsula, Siberia) and previously retrieved mammoth remains and their haplo(sub)groups (Appendix 1—table 6).

Comparison of transformed metabarcoding read counts (A) and ddPCR concentration estimations (B) of Mammuthus primigenius DNA in sediment cores LK-001 and LK-007 from the Yamal peninsula.

Tables

Sediment cores retrieved from two lakes on the Yamal peninsula, Siberia.

Sample depths and extraction protocols.

PowerLyzer DNA extraction.

Library preparation.

Indexing PCR.

Mitogenome templates of 17 mammal species for design of RNA baits.

Cladonia rangiferina sequences for RNA bait design (shown are the NCBI accessions).

Reference mitogenomes used for mapping.

Command lines and software used for initial mapping, processing, and taxonomic assignment.

Reference mammoth mitogenomes used for panel.

Conventional PCR.

Conventional PCR.

Conventional PCR.

²¹⁰Pb chronology of Yamal lake sediment core LK-001.

Radiocarbon dating results.

Numbers of sequences assigned to mammals (core LK-001).

Additional files

MDAR checklist

Download links

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Be the first to read new articles from eLife

Share this article

Cite this article

aDNA of Mammuthus in recent lake sediments.

Locations of the sediment cores of the present study (Yamal peninsula, Siberia) and previously retrieved mammoth remains and their haplo(sub)groups (Appendix 1—table 6).

Comparison of transformed metabarcoding read counts (A) and ddPCR concentration estimations (B) of Mammuthus primigenius DNA in sediment cores LK-001 and LK-007 from the Yamal peninsula.

Sediment cores retrieved from two lakes on the Yamal peninsula, Siberia.

Sample depths and extraction protocols.

PowerLyzer DNA extraction.

Library preparation.

Indexing PCR.

Mitogenome templates of 17 mammal species for design of RNA baits.

Cladonia rangiferina sequences for RNA bait design (shown are the NCBI accessions).

Reference mitogenomes used for mapping.

Command lines and software used for initial mapping, processing, and taxonomic assignment.

Reference mammoth mitogenomes used for panel.

Conventional PCR.

Conventional PCR.

Conventional PCR.

210Pb chronology of Yamal lake sediment core LK-001.

Radiocarbon dating results.

Numbers of sequences assigned to mammals (core LK-001).

MDAR checklist

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

²¹⁰Pb chronology of Yamal lake sediment core LK-001.