Three-dimensional single-cell transcriptome imaging of thick tissues
- Howard Hughes Medical Institute, Department of Chemistry and Chemical Biology, Department of Physics, Center for Brain Science, Harvard University, United States
- Howard Hughes Medical Institute, Department of Molecular and Cellular Biology, Center for Brain Science, Harvard University, United States
Figures
Figure 1 with 2 supplements
Deep learning (DL) enhances performance of confocal MERFISH imaging.
(a) A single-bit high-pass-filtered MERFISH confocal image of 242 genes in a brain tissue section taken with an exposure time of 0.1 s (left) and a magnified view of a single cell marked by the …
-
Figure 1—source data 1
This source data file contains source data for Figure 1b and d.
- https://cdn.elifesciences.org/articles/90029/elife-90029-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Comparison of epifluorescence and confocal MERFISH images in thick-tissue samples.
Images of nuclei (DAPI), total polyA mRNA, and two MERFISH bits were obtained using epifluorescence (Epi) and spinning-disk confocal microscopy respectively. Both epifluorescence and confocal images …
Figure 1—figure supplement 2
Characterization of MERFISH images of RNA molecules at different tissue depths in 100-µm- and 200-µm-thick brain tissue sections.
(a) Number of RNA molecules detected per field of view (FOV) at a single z-plane at the tissue depths of 10 µm and 90 µm in the first bit of the 242-gene MERFISH measurements in a 100-µm-thick …
-
Figure 1—figure supplement 2—source data 1
This source data file contains source data for Figure 1—figure supplement 2a-d.
- https://cdn.elifesciences.org/articles/90029/elife-90029-fig1-figsupp2-data1-v1.xlsx
Figure 2 with 4 supplements
3D-MERFISH imaging of thick brain tissue sections.
(a) 3D images of DAPI and total polyA mRNA from a single field of view (FOV) in a 100-µm-thick mouse brain tissue slice (top), alongside a single z-plane at tissue depth of 50 µm marked by the …
-
Figure 2—source data 1
This source data file contains source data for Figure 2d-h.
- https://cdn.elifesciences.org/articles/90029/elife-90029-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Optimization of MERFISH encoding and readout probe labeling conditions.
(a) Example high-pass-filtered bit-1 images of a 242-gene MERFISH measurement in a 100-µm-thick section of mouse cortex stained with different concentrations of encoding probes. The concentration …
-
Figure 2—figure supplement 1—source data 1
This source data file contains source data for Figure 2—figure supplement 1b, d, and e.
- https://cdn.elifesciences.org/articles/90029/elife-90029-fig2-figsupp1-data1-v1.xlsx
Figure 2—figure supplement 2
Displacement of RNA molecules between different imaging rounds reduces detection accuracy and efficiency.
(a) Total copy number of decoded RNAs detected per field of view (FOV) per z-plane at different tissue depths in a 242-gene MERFISH measurement of the 100-µm-thick section. (b) Pearson correlation …
-
Figure 2—figure supplement 2—source data 1
This source data file contains source data for Figure 2—figure supplement 2a-c.
- https://cdn.elifesciences.org/articles/90029/elife-90029-fig2-figsupp2-data1-v1.xlsx
Figure 2—figure supplement 3
Quantification of gel expansion effect by MERFISH buffers.
(a) Quantification of gel expansion factor in various buffers used in the MERFISH protocol. The initial gel size was the same as the coverslip, and the expansion factor after buffer exchange was …
-
Figure 2—figure supplement 3—source data 1
This source data file contains source data for Figure 2—figure supplement 3b.
- https://cdn.elifesciences.org/articles/90029/elife-90029-fig2-figsupp3-data1-v1.xlsx
Figure 2—figure supplement 4
3D MERFISH imaging of 242 genes in a 100-µm-thick section of the mouse cortex.
(a) Example images of decoded RNA molecules at different tissue depths. Each image shows decoded barcodes in a 10-µm-thick z-range, as indicated. Bottom panels show the zoom-in of the region marked …
Figure 3 with 4 supplements
Spatial organization of cell types in the mouse cortex and hypothalamus by 3D thick-tissue MERFISH.
(a) UMAP visualization of subclasses of cells identified in a 100-μm-thick section of the mouse cortex. Cells are color coded by subclass identities. IT: intratelencephalic projection neurons; ET: …
-
Figure 3—source data 1
This source data file contains source data for Figure 3e-h.
- https://cdn.elifesciences.org/articles/90029/elife-90029-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Neuronal clusters identified in the 100-µm-thick section of the mouse cortex.
UMAP visualization of excitatory (left) and inhibitory (right) neuronal clusters is shown with each cell colored by their cluster identities.
Figure 3—figure supplement 2
3D MERFISH imaging of 156 genes in a 200-µm-thick section of the mouse hypothalamus.
(a) The Pearson correlation coefficient of the RNA copy number for individual genes at different tissue depths versus those in the initial 1 µm range of the 200-µm-thick section of the mouse …
-
Figure 3—figure supplement 2—source data 1
This source data file contains source data for Figure 3—figure supplement 2a and b.
- https://cdn.elifesciences.org/articles/90029/elife-90029-fig3-figsupp2-data1-v1.xlsx
Figure 3—figure supplement 3
Transcriptionally distinct cell clusters identified in a 200-µm-thick section of the mouse hypothalamus.
(a) UMAP visualization of excitatory and inhibitory neuronal clusters identified in the 200-µm-thick section, with each cell colored by their cluster identities. (b) 2D spatial maps of individual …
Figure 3—figure supplement 4
Examples of tightly juxtaposed interneuron pairs and distribution of cell diameters across different cell types.
(a) Two examples of tightly juxtaposed interneuron pairs in the mouse cortex, marked by the dashed box (left). Different colors indicate distinct interneuron subclasses. A zoomed-in view of the …
-
Figure 3—figure supplement 4—source data 1
This source data file contains source data for Figure 3—figure supplement 4b.
- https://cdn.elifesciences.org/articles/90029/elife-90029-fig3-figsupp4-data1-v1.xlsx
Author response image 1
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Biological sample (Mus musculus) | C57BL/6J | The Jackson Laboratory | JAX: 000664 (RRID:IMSR_JAX:000664) | Brain tissue collection |
| Software, algorithm | MERlin | https://github.com/rx3fang/MERlin/releases/tag/v3.0.0-elife | https://doi.org/10.5281/zenodo.13356943 | 3D MERFISH decoding pipeline |
| Software, algorithm | storm-control | https://github.com/ZhuangLab/storm-control, copy archived at ZhuangLab, 2023 | https://doi.org/10.5281/zenodo.3264857 | MERFISH microscope control |
| Software, algorithm | Seurat V3 | Stuart et al., 2019 | https://doi.org/10.1016/j.cell.2019.05.031 | |
| Software, algorithm | BigStitcher | Hörl et al., 2019 | https://doi.org/10.1038/s41592-019-0501-0 | |
| Software, algorithm | CSBdeep | Weigert et al., 2018 | https://doi.org/10.1038/s41592-018-0216-7 | |
| Software, algorithm | Cellpose 2.0 | Pachitariu and Stringer, 2022 | https://doi.org/10.1038/s41592-022-01663-4 | |
| Chemical compound, drug | Tris (2-carboxyethyl) phosphine Hydrochloride | Gold Bio | 51805-45-9 | |
| Chemical compound, drug | Ethylene carbonate | Sigma | E26258 | |
| Chemical compound, drug | 40% Acrylamide/Bis Solution, 19:1 | Bio-Rad | 1610144 | |
| Chemical compound, drug | 3,4-Dihydroxybenzoic acid | Sigma | P5630 | |
| Chemical compound, drug | 6-Hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (trolox) | Sigma | 238813-1G | |
| Chemical compound, drug | Gel Slick Solution | Lonza | 50640 | |
| Chemical compound, drug | Dextran sulfate | Sigma | D8906 | |
| Chemical compound, drug | Low Melting Point Agarose | Thermo Fisher | 16520050 | |
| Chemical compound, drug | Paraformaldehyde | Electron Microscopy Sciences | 15714 | |
| Peptide, recombinant protein | Proteinase K | New England Biolabs | P8107S | |
| Peptide, recombinant protein | Protocatechuate 3,4-dioxygenase (rPCO) | OYC Americas | 46852904 | |
| Peptide, recombinant protein | RNase Inhibitor, Murine | New England Biolabs | M0314L | |
| Other | Yeast tRNA | Life Technologies | 15401-011 | Blocking agent used during RNA labeling |
| Other | FluoSpheres YG 0.1 um | Thermo Fisher | F8803 | Used as fiduciary markers |
| Other | DAPI | Thermo Fisher | D1306 | Used to label the cell nucleus |
| Sequence-based reagent | MERFISH encoding probes for cortex | Zhang et al., 2021 | https://doi.org/10.35077/g.21 | Supplementary file 2 |
| Sequence-based reagent | MERFISH encoding probes for hypothalamus | Moffitt et al., 2018; modified in this work | Supplementary file 5 | |
| Sequence-based reagent | polyA anchor probe | IDT | /5Acryd/TTGAGTGGATGGAGTGTAATT+TT +TT+TT+TT+TT+TT+TT+TT+TT+T | |
| Sequence-based reagent | Dye-labeled readout probes | Bio-Synthesis | Supplementary file 3 |
Additional files
-
Supplementary file 1
MERFISH codebook for 242-gene measurement.
The first column is the gene name, the second column is the Ensembl transcript ID, and the following columns indicate the binary values for each of the 22 bits indicated by name of the corresponding readout sequence. Barcodes that were used as blank controls are denoted by a gene name that begins with ‘Blank-.’
- https://cdn.elifesciences.org/articles/90029/elife-90029-supp1-v1.xlsx
-
Supplementary file 2
MERFISH encoding probe information for 242-gene measurement.
For each encoding probe, the encoding probe sequence, and the gene name and Ensembl ID of the targeted transcript are provided.
- https://cdn.elifesciences.org/articles/90029/elife-90029-supp2-v1.xlsx
-
Supplementary file 3
Readout probe information.
For each of the bits, the bit number, the readout probe sequence name, the readout probe sequence, the dye label and the detected color channel are indicated.
- https://cdn.elifesciences.org/articles/90029/elife-90029-supp3-v1.xlsx
-
Supplementary file 4
MERFISH codebook for 156-gene measurement.
The first column is the gene name, the second column is the Ensembl transcript ID, and the following columns indicate the binary values for each of the 20 bits indicated by name of the corresponding readout sequence. Barcodes that were used as blank controls are denoted by a gene name that begins with ‘Blank-.’
- https://cdn.elifesciences.org/articles/90029/elife-90029-supp4-v1.xlsx
-
Supplementary file 5
MERFISH encoding probe information for 156-gene measurement.
For each encoding probe, the encoding probe sequence, and the gene name and Ensembl ID of the targeted transcript are provided.
- https://cdn.elifesciences.org/articles/90029/elife-90029-supp5-v1.xlsx
-
Supplementary file 6
Imaging platforms used for specific data acquisition.
The first column is the data used in specific figures, the second column is the setup ID used for taking this dataset, the third column is the specific spinning disk confocal model used for taking this dataset, and the fourth column is the objective used for taking this dataset.
- https://cdn.elifesciences.org/articles/90029/elife-90029-supp6-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/90029/elife-90029-mdarchecklist1-v1.docx
