Homeodomain proteins hierarchically specify neuronal diversity and synaptic connectivity
- Institute of Neuroscience, Howard Hughes Medical Institute, University of Oregon, United States
- Janelia Research Campus, Howard Hughes Medical Institute, Helix Drive, United States
Figures
Figure 1
Sequential initiation of homeodomain transcription factors (HDTFs) during lamina neurogenesis.
(A–A’’”) Tll is identified as a lamina progenitor cell (LPC) marker, expressed complementary to Elav; Dac labels both Tll+ LPCs and Elav+ neurons. LF: lamina furrow. Here and below, scale bar: 10 µm, n≥5 brains. (B–B’’’) Tll+ cells are localized both within the lamina columns and before the columns. Lamina columns (white dash circle) are outlined by the photoreceptor axons, which are labeled by Chaoptin. n≥5 brains. LF: lamina furrow. (C–C’’’) Bsh is expressed in Tll+ Elav LPCs (white dash circle) as well as in Elav+ L4 and L5 neurons. (D–D’’’) Ap is expressed in L4 neurons. Newborn L4 neurons are Bsh+ Elav+ Ap- (yellow line circle), while older L4 neurons are Bsh+ Elav+ Ap+ (white line circle). (E–E’’’) Pdm3 is expressed in L5 neurons. Newborn L5 neurons are Bsh+ Pdm3- (yellow line circle), while older L5 neurons are Bsh+ Pdm3+ (white line circle). (F–F’’”) Bsh, Ap, and Pdm3 expressions are maintained in adults. (G) Schematic of lamina neuron development in early pupa. (H) Summary.
Figure 2 with 4 supplements
Bsh activates Ap/Pdm3 expression and specifies L4/L5 neuronal fate.
(A–B’’) Bsh-knockdown (KD) in lamina progenitor cells (LPCs) (R27G05-Gal4>UAS-Bsh-RNAi) eliminates Bsh in LPCs and neurons in wandering L3 (white circle). Tll labels all LPCs. LF: lamina furrow. L3: third larval instar. Here and below, scale bar: 10 µm, n≥5 brains. (C) Schematic of lamina neuron development at third larval instar. (D) Schematic of lamina neuron development from 1-day pupae to adult. (E–F’’) Bsh remains undetectable in the lamina of 3- to 4-day pupa in Bsh-KD (R27G05-Gal4>UAS-Bsh-RNAi). (G–K) Bsh-KD in LPCs removes most L4 (Bsh/Ap) (J) and L5 (Bsh/Pdm3) (I) neuron markers. The Ap expression in L5 is caused by the Gal4 driver line but is irrelevant here. (K) The number of Elav+ cells in a single slice. n=5 brains in (I) and (J), n=7 brains in (K). L4 layer, yellow outline. L5 layer, white outline. (L) Summary. Data are presented as mean ± SEM. Each dot represents a brain. ***p<0.001, ns = not significant, unpaired t-test.
Figure 2—figure supplement 1
R27G05-GAL4 is turned on in all lamina progenitor cells (LPCs) and turned off in lamina neurons.
(A–A’’’) R27G05-Gal4 drives GFP expression in all LPCs and lamina neurons (white dash circle) which are labeled by Dac at 96 hr after larval hatching (ALH). Hth labels LPCs next to lamina furrow (Piñeiro et al., 2014). Here and below, scale bar, 10 µm. (B, C) R27G05-Gal4 is turned off in lamina neurons. Activating R27G05-Gal4 at 29C at the beginning of wandering L3 for 20 hr (by inactivating Gal80ts) reveals continued expression of GFP; in contrast, activating R27G05-Gal4 at 29C at 1 day after pupa formation (APF) for 20 hr reveals little GFP, showing that R27G05 is not expressed in pupal stages containing postmitotic lamina neurons. Genotype: R27G05-Gal4>UAS-myrGFP, tubP-Gal80[ts]. (D, E) Although R27G05-Gal4 is turned off by 1 day APF, GFP persists in lamina neuron cell bodies until 66 hr APF and in their neurites until 75 hr APF. Genotype: R27G05-Gal4>UAS-myrGFP.
Figure 2—figure supplement 2
Bsh-knockdown (KD) or Bsh-knockout (KO) in lamina progenitor cells (LPCs) affects L4/L5 neuronal fate.
(A–D) Bsh-KD in LPCs removes most L4 (Bsh/Ap) and L5 (Bsh/Pdm3) neuron markers of 3-day adult flies. The Ap expression in L5 is caused by the Gal4 driver line but is irrelevant here. (C and D) The number of Pdm3+ (C) or Ap+/Pdm3- (D) cell bodies in a single slice in control (A) and Bsh-KD (B). Here and below, scale bar, 10 µm, white circle outlines the region of L4 and L5 cell bodies. (E–I) Bsh-KO in LPCs (27G05-Gal4>UAS-Cas9, UAS-Bsh-sgRNAs) decreases Ap and Pdm3 expression in the lamina of 3- to 4-day-old pupa. (G–I) The number of Bsh+ (G), Pdm3+ (H), or Ap+/Pdm3- (I) cell bodies in a single slice in control (E) and Bsh-KO (F). Data are presented as mean ± SEM. Each dot represents each brain. n=6 brains in (C) and (D), n=5 brains in (G), (H), and (I). Each dot represents each brain. ***p<0.001, unpaired t-test.
Figure 2—figure supplement 3
Bsh-knockdown (KD) in L4 neurons results in loss of detectable Bsh between 2 and 3 days after pupa formation (APF).
(A–C) Bsh expression is detected at 2 day APF following Bsh-knockout (KO) in L4 neurons. Genotype: 31C06-AD, 34G07-DBD>UAS-Cas9, UAS-Bsh-sgRNAs. (D–F) Bsh expression is absent at 3 days APF following Bsh-KD in L4 neurons. Genotype: 31C06-AD, 34G07-DBD>UAS-Cas9, UAS-Bsh-sgRNAs. GFP labels L4 neurons. White arrowhead indicates L4 cell body lacking Bsh expression. Data are presented as mean ± SEM. ns = not significant, ***p<0.001, unpaired t-test, n=6 brains; each dot represents one brain. Scale bar, 10 µm.
Figure 2—figure supplement 4
Bsh is not required in L4 neurons to maintain L4 neuronal fate.
(A–B’’) L1 marker Svp and L2 marker Bab2 are not detected in L4 cell bodies when knocking out Bsh in L4 (31C06-AD, 34G07-DBD>UAS-Cas9, UAS-Bsh-sgRNAs). Here and below, L4 is labeled by GFP (31C06-AD, 34G07-DBD>UAS-myrGFP). White outline, L4 cell body. Scale bar, 10 µm. (C–D’’) L3 marker Erm is not detected in L4 cell bodies when knocking out Bsh in L4. (E–F’’) Bsh becomes absent in most L4 while Ap expression remains normal when knocking out Bsh in L4. (G–H’’) L5 marker Pdm3 is not detected in L4 cell bodies when knocking out Bsh in L4. (I) The percentage of each lamina neuron marker in L4 neurons (GFP+). ***p<0.001, ns = not significant, unpaired t-test, n=5 or 6 brains, each dot represents each brain, data are presented as mean ± SEM.
Figure 3 with 3 supplements
Bsh suppresses L1/L3 neuronal fate.
(A–E) Bsh-knockdown (KD) in lamina progenitor cells (LPCs) results in the ectopic expression of the L1 marker Svp and L3 marker Erm in L4/L5 cell body layers (circled). (C) Schematic of lamina neuron development from 1-day pupae to adult. (D and E) Quantification of Erm and Svp expression. Here and below, scale bar, 10 µm. (F–H) Bsh-KD in LPCs does not produce ectopic Bab2-positive neurons or glia in the L5 layer (circled). n≥5 brains. Genotype: R27G05-Gal4>UAS-Bsh-RNAi. (H) Quantification of Bab2 expression. (I–L) Bsh-KD in LPCs results in ectopic Svp+ L1 neurons at the expense of Pdm3+ L5 neurons. Bsh GFP+ neurons marked with yellow arrowheads show L1 marker Svp expression in Bsh-KD while L5 marker Pdm3 expression is in control. Genotype: Bsh-LexA>LexAop-GFP. (K and L) Quantification of Pdm3 and Svp expression. (M–O) Bsh-KD transforms L5 neuron morphology to L1-like neuronal morphology. (M) Control L5 neurons have very few dendrites in the lamina neuropil. Genotype: R27G05-Gal4, Bsh-LexA>LexAop-GFP. (N) Bsh-KD transforms L5 neuron morphology to L1-like neuronal morphology. Genotype: R27G05-Gal4>UAS-Bsh-RNAi; Bsh-LexA>LexAop-GFP. (O) Control L1 neurons show bushy dendrites throughout the lamina. Genotype: svp-Gal4, R27G05-FLP>UAS-FRT-stop-FRT-myrGFP. (P) Summary. Data are presented as mean ± SEM. Each dot represents each brain. n=5 brains in (D), (E), (H), (K), and (L). *p<0.05, **p<0.01, ***p<0.001, ns = not significant, unpaired t-test.
Figure 3—figure supplement 1
Loss of Bsh in lamina progenitor cells (LPCs) transforms L5 neurons into L1 neurons.
(A–A’’) Bsh-LexA drives LexAop-myrGFP expression in L5 neurons but not L4 at 20 hr after pupa formation (APF). Older GFP cell bodies express L5 marker Pdm3. Ap labels L4 neurons. The white circle outlines GFP+ cells. Scale bar, 10 µm.
Figure 3—figure supplement 2
Ap-knockdown (KD) eliminates Ap initiation and maintenance in L4 neurons.
(A–C) Ap initiation in L4 neurons is eliminated at 19–20 hr after pupa formation (APF) when knocking down Ap (27G05-GAL4>UAS-Ap-RNAi). The top Bsh+ labels L4 and the bottom Bsh+ labels L5. Ap and Pdm3 are expressed in older L4 and older L5 neurons, respectively. The Ap expression in L5 neurons is caused by the Gal4 driver line but is irrelevant here. Scale bar, 10 µm. (C) The percentage of Ap expression in L4 neurons (top Bsh+ row) in control (A) and Ap-KD (B). (D–F) Ap expression remains undetectable in adults though Bsh expression remains normal. Bsh is unlikely able to reinitiate Ap expression if normal Ap initiation is lost. Scale bar, 10 µm. (F) The percentage of Ap expression (Ap+/Pdm3-) in L4 neurons (Bsh+/Pdm3-) in control (D) and Ap-KD (E). Data are presented as mean ± SEM. Each dot represents each brain. n=6 brains in (C) and (F). ***p<0.001, unpaired t-test.
Figure 3—figure supplement 3
Ap is not required to suppress other lamina neuron markers in L4 neurons.
(A–H’’) L1 (Svp, Zfh1), L2 (Bab2), L3 (Erm, Zfh1), and L5 (Pdm3) markers are not expressed in L4 neurons (top Bsh+ row) at 3–4 days after pupa formation (APF) when knocking down Ap (27G05-GAL4>UAS-Ap-RNAi). Scale bar, 10 µm. (I) The percentage of each lamina neuron marker in L4 neurons (top row of Bsh+). ***p<0.001, ns = not significant, unpaired t-test, n=6 brains, each dot represents each brain, data are presented as mean ± SEM.
Figure 4 with 1 supplement
Bsh represses Zfh1 to suppress L1/L3 neuronal fate.
(A–A’’) Zfh1 is expressed in all lamina progenitor cells (LPCs) and some lamina neurons at 12 hr after pupa formation (APF). GFP labels all lamina cells. Elav labels lamina neurons. The yellow dash circle outlines LPCs and the white dash circle outlines lamina neurons. Genotype: R27G05-Gal4>UAS-myrGFP. Here and below, scale bar, 10 µm. n≥5 brains. (B–B’’) Zfh1 is expressed in Svp+ L1 and Erm+ L3 neurons at 1–2 days APF; Svp and Erm are never co-expressed. The white dashed circle outlines L1 and L3 neurons and the yellow line indicates the rough boundary between L1 and L3 cell bodies. (C) Schematic of lamina neuron development from 1-day pupae to adult. (D–F) Zfh1-knockdown (KD) in LPCs results in a loss of Svp+ L1 and Erm+ L3 neurons. Quantification: the number of Erm+ or Svp+ cell bodies in a single optical slice. Genotype: R27G05-Gal4>UAS-zfh1-RNAi. (G–I) Bsh-KD in LPCs results in ectopic Zfh1 in L4/L5 layers. White circles label Bsh+ cell bodies in L4 layer in control. L5 layer, white outline. Quantification: the percentage of Bsh+ or Zfh1+ neurons in L5 layer. Genotype: R27G05-Gal4>UAS-bsh-RNAi. (J) Summary. Data are presented as mean ± SEM. Each dot represents each brain. n=6 brains in (F) and n=5 brains in (I). ***p<0.001, unpaired t-test.
Figure 4—figure supplement 1
Zfh1 expression and epistasis with Bsh.
(A–D) Zfh1-knockdown (KD) in lamina progenitor cells (LPCs) significantly reduces Zfh1 expression in all LPCs and lamina neurons at 12 hr after pupa formation (APF). The white line circle outlines LPCs. The yellow line circle outlines lamina neurons. White dash circle outlines Zfh1+ glia. Scale bar here and below, 10 µm. Genotype: R27G05-Gal4>UAS-Zfh1-RNAi. Quantification: Zfh1 signal of three cell bodies from each brain and normalized Zfh1 signal by setting the highest Zfh1 signal as 100. (E–H) The total number of Ap+ and Pdm3+ cell bodies is decreased when knocking down Zfh1 in LPCs. The number of Bsh+ L4 and L5 neurons is decreased when knocking down Zfh1 in LPCs. Scale bar, 10 µm. (G) The total number of Ap+ and Pdm3+ cell bodies in a single slice. (H) The number of Bsh+ L4 and L5 neurons in a single slice. Genotype: R27G05-Gal4>UAS-Zfh1-RNAi. (I–K) The number of lamina neurons is decreased when knocking down Zfh1 in LPCs. Scale bar, 10 µm. (K) The number of Elav+ cells in a single slice. Genotype: R27G05-Gal4>UAS-Zfh1-RNAi. (L–N) Zfh1 is ectopically expressed in GFP+ neurons. GFP (Bsh-LexA>LexAop-myrGFP) labels LPCs and L5 neurons in control. The white line circle outlines GFP+ neurons. GFP+ LPCs are Tll+ (yellow arrowhead). Scale bar, 10 µm. (N) The percentage of Zfh1+ cells in GFP+ neurons (Elav+) in control (L) and Bsh-KD (M). We divided GFP+ neurons into three domains with equal width from newborn to older neurons. Data are presented as mean ± SEM. Each dot represents a brain. n=5 brains per genotype. **p<0.01, ***p<0.001, unpaired t-test.
Figure 5 with 1 supplement
Bsh:DamID reveals Bsh direct binding to L4 identity genes and pan-neuronal genes.
(A) Schematic for TaDa method. (B) Both Dam and Bsh:Dam show high Pearson correlation coefficients among their three biological replicates, with lower Pearson correlation coefficients between Dam and Bsh:Dam. A heatmap is generated using the multiBamSummary and plotCorrelation functions of deepTools. (C) Bsh:Dam peaks in L4 (46–76 hr after pupa formation [APF]) called by find_peaks and L4 scRNAseq data (48 hr APF; 60 hr APF) (Jain et al., 2022) are combined (see Materials and methods). (D) Bsh:Dam shows strong signals in L4 identity genes and pan-neuronal genes. The Dam alone signal indicates the open chromatin region in L4 neurons. The y axes of Bsh:Dam signal represent log2 (Bsh:Dam/Dam) scores. Bsh peaks in L4 neurons were generated using find_peaks (FDR<0.01; min_quant = 0.9) and peaks2genes. (E) Summary.
Figure 5—figure supplement 1
UAS-Bsh:Dam expressed by 31C06-Gal4 is functional and specifically expressed in L4 neurons; Bsh:Dam shows a binding peak in ap locus but not pdm3 or zfh1 in L4 neurons.
(A) Schematic of the system used to restrict Bsh:Dam expression spatially to L4 (using the 31C06-Gal4 driver) and temporally to 46–76 hr after pupa formation (APF) (using the temperature-sensitive Gal4 inhibitor, Gal80ts; red T-bar). Note the high expression of GFP from the first ORF (thick green arrow), and low expression of Bsh or Bsh:Dam following the readthrough of the stop codons prior to the second ORF (thin green arrow). (B–B’’) 31C06-Gal4, Gal80ts, UAS-Bsh:Dam is expressed in Ap+ L4 neurons when conditionally expressed from 46 to 76 hr after pupa formation (APF). Scale bar, 10 µm. (C–E) Bsh:Dam retains Bsh function and can partially rescue Ap and Pdm3 expressions in Bsh-null mutant flies (Bsh-null mutant; R27G05-Gal4>UAS-myrGFP-Bsh:Dam). Note that Bsh:Dam expression from the second ORF is extremely low to avoid toxicity and is not detected by immunostaining. The white circle outlines the cell body area of lamina neurons. (E) Quantification of the number of Ap+ or Pdm3+ or Bsh+ cell bodies within z-stack of 2.88 µm in control (C–C’’) and Bsh:Dam (D–D’’). Scale bar, 10 µm. Data are presented as mean ± SEM. Each dot represents a brain. Control: n=5 brains; Bsh:Dam: n=4 brains. ns = not significant, **p<0.001, unpaired t-test. (F) Bsh:Dam shows strong signals in ap gene but not pdm3 or zfh1 gene in L4 neurons during the synapse formation window. The Dam alone signal indicates the open chromatin region in L4 neurons. The y axes of Bsh:Dam signal represent log2 (Bsh:Dam/Dam) scores. Bsh peaks in L4 neurons were generated using find_peaks (FDR<0.01; min_quant = 0.9) and peaks2genes.
Figure 6 with 1 supplement
Bsh and Ap form a coherent feed-forward loop to activate DIP-β.
(A–D) Bsh Crispr knockout (KO) in postmitotic L4 neurons results in loss of DIP-β expression in the proximal lamina neuropil (arrow) at 3 days after pupa formation (APF). DIP-β expression is detected using an anti-DIP-β antibody. The signal in the distal lamina is from non-lamina neurons, probably LawF. Significantly reduced DIP-β fluorescence intensity is observed in the proximal lamina (75–100% distance, marked by red bar (C, D)). ***p<0.001, unpaired t-test, n=8 brains, each line represents each brain, scale bar, 10 µm. Genotype: 31C06-AD, 34G07-DBD>UAS-Cas9, UAS-Bsh-sgRNAs. (E–I) Bsh Crispr KO in L4 neurons results in a decrease of primary dendrite length and proximal synapse number in postmitotic L4 neurons of 1-day adults. Here and below, white dash lines indicate the lamina neuropil and yellow lines show the boundary between the distal and proximal lamina. The average number of Brp puncta in L4 neurons present within the distal or proximal halves of lamina cartridges. *p<0.05, ***p<0.001, ns = not significant, unpaired t-test, n=100 cartridges, n=5 brains, each dot represents one cartridge, data are presented as mean ± SEM. Genotype: 31C06-AD, 34G07-DBD>UAS-Cas9, UAS-Bsh-sgRNAs, UAS-myrGFP, UAS-RSR, 79C23-S-GS-rst-stop-rst-smFPV5-2a-GAL4. (J–M) Ap RNAi knockdown (KD) in postmitotic L4 neurons results in loss of DIP-β expression in the proximal lamina neuropil (arrow) at 3 days APF. The signal in the distal lamina is from non-lamina neurons, probably LawF. Significantly reduced DIP-β fluorescence intensity is observed in the proximal lamina (75%–100% distance, marked by red bar (L, M)). ***p<0.001, unpaired t-test, n=8 brains, each line represents each brain, scale bar, 10 µm. Genotype: R27G05-Gal4>UAS-ApRNAi. (N–R) Ap-KD in L4 neurons results in an increase of primary dendrite length and proximal synapse number in postmitotic L4 neurons in 1-day adults. The average number of Brp puncta in L4 neurons present within the distal or proximal halves of lamina cartridges. *p<0.05, ***p<0.001, ns = not significant, unpaired t-test, n=100 cartridges, n=5 brains, each dot represents one cartridge, data are presented as mean ± SEM. Genotype: 31C06-AD, 34G07-DBD>UAS-RSR, 79C23-S-GS-rst-stop-rst-smFPV5-2a-GAL4, UAS-Ap-shRNA, UAS-myrGFP. (S) Summary.
Figure 6—figure supplement 1
DIP-β expression is disrupted when knocking down Ap in L4 neurons.
(A–C) Ap-knockdown (KD) (31C06-AD, 34G07-DBD>UAS-RSR, 79C23-S-GS-rst-stop-rst-smFPV5-2a-GAL4, UAS-Ap-shRNA; see Materials and methods for an explanation of this genotype) significantly reduced Ap expression in L4 neurons at 2 days after pupa formation (APF). The white line circle outlines lamina neuron cell bodies. Scale bar, 10 µm. (C) Quantification of Ap signal in the cell bodies of L4 neurons in control (A) and Ap-KD (B). We averaged the Ap signal of three cell bodies from each brain and normalized the Ap signal by setting the highest Ap signal as 100. ***p<0.001, unpaired t-test, n=6 brains, each dot represents each brain, data are presented as mean ± SEM. (D–F’) DIP-β expression is disrupted in L4 neurons in Ap-KD (31C06-AD, 34G07-DBD>UAS-RSR and 79C23-S-GS-rst-stop-rst-smFPV5-2a-GAL4) and UAS-Ap-shRNA. Note that the DIP-β signal in the proximal lamina belongs to L4 in control (arrow, L4), whereas the DIP-β signal in the distal lamina belongs to unknown cells. Scale bar, 10 µm. (E–G) Quantification of DIP-β fluorescence intensity along the long axis of lamina cartridges (see white lines in (D) and (F)) from the distal dash line to the proximal dash line. Significantly reduced fluorescence intensity is observed in the proximal lamina (75–100% distance, marked by the red bar in (E) and (G)) of Ap-KD flies compared to the control. ***p<0.001, unpaired t-test, n=5 brains, each line represents each brain.
Figure 7 with 1 supplement
Bsh+ L4/L5 are required for normal visual sensitivity.
(A) Schematic of the Fly Vision Box. (B) Bsh-knockdown (KD) adult flies show reduced responses to a high-speed stimulus. Left: stimulus with different temporal frequency; right: stimulus with 5 Hz temporal frequency, but with the indicated contrast level. (C) Bsh-KD adult flies show reduced phototaxis to both dim and bright lights. Relative intensity was used: 15 and 200 for dim and bright green, respectively; 20 and 100 for dim and bright UV, respectively. (D) Bsh-KD adult flies show larger responses toward bright UV illumination. For lower UV levels, flies walk toward the green LED, but walk toward the UV LED at higher UV levels. Data are presented as mean ± SD, with individual data points representing the mean value of all flies in each tube. For control (mherry-RNAi), n=18 groups of flies (tubes), for Bsh-KD, n=16 groups of flies, run across three different experiments. Each group is 11–13 male flies. *p<0.05, unpaired, two-sample t-test controlled for false discovery rate. (E) Model. Left: In wild type, Zfh1+ lamina progenitor cells (LPCs) give rise to L1 and L3 neurons, whereas Zfh1+Bsh+ LPCs give rise to L4 and L5 neurons. The lineage relationship between these neurons is unknown. Right: Bsh KD results in a transformation of L4/L5 into L1/L3 which may reveal a simpler, ancestral pattern of lamina neurons that contains the core visual system processing arrangement. (F) Summary.
Figure 7—figure supplement 1
Bsh-knockdown (KD) in lamina progenitor cells (LPCs) results in loss of Bsh in the adult fly.
(A–A’) Control flies have Bsh+ neurons in the adult L4 neurons (arrow). Genotype: w+, R27G05-Gal4>UAS-mCherry-RNAi, tubP-Gal80[ts]. Neuropil marker Brp (blue), Bsh neurons (green). Scale bar, 10 µm. (B–B’) Bsh-KD in LPCs results in the loss of Bsh+ neurons in adult L4 neurons. Neuropil marker Brp (blue), there are no Bsh+ neurons, although there is background staining (green). Scale bar, 10 µm. Genotype: w+, R27G05-Gal4>UAS-Bsh-RNAi, tubP-Gal80[ts].
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Drosophila melanogaster) | 10xUAS-IVS- myristoylated-GFP | Bloomington Drosophila Stock Center | RRID: BDSC_32199 | w[1118]; P{y[+t7.7] w[+mC]=10XUAS-IVS-myr::GFP}su(Hw)attP5 |
| Strain, strain background (D. melanogaster) | R27G05GAL4 | Bloomington Drosophila Stock Center | RRID: BDSC_48073 | w[1118]; P{y[+t7.7] w[+mC]=GMR27 G05-GAL4}attP2 |
| Strain, strain background (D. melanogaster) | UAS-Bsh-RNAi | Bloomington Drosophila Stock Center | RRID: BDSC_29336 | y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02498}attP2 |
| Strain, strain background (D. melanogaster) | Bsh-LexA | Bloomington Drosophila Stock Center | RRID: BDSC_52834 | w[1118]; P{y[+t7.7] w[+mC]=GMR64B07-lexA}attP40 |
| Strain, strain background (D. melanogaster) | 13xLexAop-IVS-myr::GFP | Bloomington Drosophila Stock Center | RRID: BDSC_32211 | y[1] w[*] P{y[+t7.7] w[+mC]=13XLexAop2-IVS-myr::GFP}su(Hw)attP8 |
| Strain, strain background (D. melanogaster) | UAS-Cas9 (attp40) | Bloomington Drosophila Stock Center | RRID: BDSC_58985 | P{ry[+t7.2]=hsFLP}12, y w[*]; P{y[+t7.7] w[+mC]=UAS-Cas9.P2}attP40 |
| Strain, strain background (D. melanogaster) | UAS-Cas9 (attp2) | Bloomington Drosophila Stock Center | RRID: BDSC_58986 | P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=UAS-Cas9.P2}attP2/TM6B, Tb[1] |
| Strain, strain background (D. melanogaster) | UAS-Bsh-sgRNA | Vienna Drosophila Resource Center | VDRC 341537 | P{ry[+t7.2]=hsFLP}1, y[1] () w[1118]; P{y[+t7.7] w[+mC]=HD_CFD00611}attP40/CyO-GFP |
| Strain, strain background (D. melanogaster) | UAS-Ap-RNAi | Bloomington Drosophila Stock Center | RRID: BDSC_41673 | y[1]sc[*] v[1] sev[21] ; P{y[+t7.7] v[+t1.8]=TRiP.HMS02207}attP2 |
| Strain, strain background (D. melanogaster) | 20xUAS-RSR.PEST | Bloomington Drosophila Stock Center | RRID: BDSC_55795 | w[1118]; P{y[+t7.7] w[+mC]=20XUAS-RSR.PEST}attP2 |
| Strain, strain background (D. melanogaster) | UAS-Ap-shRNA | Vienna Drosophila Resource Center | VDRC 330463 | P{VSH330463}attP40 |
| Strain, strain background (D. melanogaster) | UAS-Bsh-HA | Bloomington Drosophila Stock Center | RRID: BDSC_83310 | y[1] w[1118]; PBac{y[+mDint2] w[+mC]=UAS-bsh.ORF.3xHA.GW}VK00018/CyO |
| Strain, strain background (D. melanogaster) | tubP-GAL80[ts] | Bloomington Drosophila Stock Center | RRID: BDSC_7017 | w[*]; P{w[+mC]=tubP-GAL80[ts]}2/TM2 |
| Strain, strain background (D. melanogaster) | UAS-Zfh1-RNAi | Vienna Drosophila Resource Center | VDRC 103205 | P{KK109931}VIE-260B |
| Strain, strain background (D. melanogaster) | Brp-rst-stop-rst-smFPV5-2a-GAL4 | Jing Peng (Harvard Medical School) | W; Bl/CyO-GFP; Brp-rst-stop-rst-smFPV5-2A-Gal4/tm6b | |
| Strain, strain background (D. melanogaster) | 31C06AD (III), 34G07DBD (III) | Gift from Janelia Research Campus (Tuthill et al., 2013) | w; UAS-FLP/CyO; 31c06A, 34G07DBD/tm6b | |
| Strain, strain background (D. melanogaster) | 31C06-Gal4, UAS-myristoylated-tdTomato | Gift from Lawrence Zipursky | ;Bl/CyO; 31c06-Gal4, UAS- myristoylated-tdTomato/tm6b | |
| Strain, strain background (D. melanogaster) | VALIUM20-mCherry | Bloomington Drosophila Stock Center | RRID: BDSC_35785 | y[1] sc[*]v[1] sev[21]; P{y[+t7.7] v[+t1.8]=VALIUM20-mCherry}attP2 |
| Strain, strain background (D. melanogaster) | Bsh-ORF-3XHA (86Fb) | FlyORF Webshop | Cat#F000054 | M{UAS-bsh.ORF.3xHA.GW}ZH-86Fb |
| Strain, strain background (D. melanogaster) | flyORF-TaDa | Bloomington Drosophila Stock Center | RRID: BDSC_91637 | w[1118]; M{RFP[3xP3.PB] w[+mC]=FlyORF-TaDa}ZH-86Fb |
| Strain, strain background (D. melanogaster) | hs-FlpD5; FlyORF-TaDa | Bloomington Drosophila Stock Center | RRID: BDSC_91638 | w[1118]; P{y[+t7.7] w[+mC]=hs-FLPD5}attP40; M{RFP[3xP3.PB] w[+mC]=FlyORF-TaDa}ZH-86Fb |
| Strain, strain background (D. melanogaster) | Bsh-null mutant | Gift from Makoto Sato | ||
| Strain, strain background (D. melanogaster) | Bsh-TaDa | This paper | w; +/CyO; UAS-GFP-Bsh-DAM/tm6b; See Generating Bsh-TaDa fly line in Materials and methods | |
| Antibody | Chicken polyclonal | Abcam | Cat#ab13970, RRID_300798 | Anti-GFP (1:1000) |
| Antibody | Rabbit polyclonal | Gift from Claude Desplan (Özel et al., 2021) | Anti-Bsh (1:1000) | |
| Antibody | Guinea pig polyclonal | Gift from Lawrence Zipursky (Tan et al., 2015) and Makoto Soto | Anti-Bsh (1:1000) | |
| Antibody | Rabbit polyclonal | Gift from Markus Affolter (Bieli et al., 2015) | Anti-Apterous (1:1000) | |
| Antibody | Rat monoclonal | Gift from Cheng-Ting Chien (Chen et al., 2012) | Anti-Pdm3 (1:200) | |
| Antibody | Rabbit polyclonal | Gift from Cheng-Yu Lee (Janssens et al., 2014) | Anti-Erm (1:100) | |
| Antibody | Rat monoclonal | Gift from Jing Peng (Santiago et al., 2021) | Anti-Erm (1:70) | |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#Seven-up D2D3, RRID_2618079 | Anti-Svp (1:10) |
| Antibody | Rabbit polyclonal | Gift from James Skeath (Tian et al., 2004) | Anti-Zfh1 (1:1000) | |
| Antibody | Rabbit polyclonal | Asian Distribution Center for Segmentation Antibodies | Code#812 | Anti-Tailless (1:200) |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#mAbdac1-1, RRID: AB_579773 | Anti-Dac (1:100) |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#Elav-9F8A9, RRID: AB_528217 | Anti-Elav (1:200) |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#Rat-Elav-7E8A10 anti-elav, RRID: AB_528218 | Anti-Elav (1:50) |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#24B10, RRID: AB_528161 | Anti-Chaoptin (1:20) |
| Antibody | Guinea pig polyclonal | Gift from Matthew Pecot Lab (Xu et al., 2019) | Anti-DIP- β (1:300) | |
| Antibody | Mouse monoclonal | Bio-Rad Laboratories | Cat#MCA1360A647, RRID: AB_770156 | Anti-V5-TAG:Alexa Fluor 647 (1:300) |
| Antibody | Rat monoclonal | Sigma-Aldrich | Cat#12158167001, RRID: AB_390915 | Anti-HA (1:100) |
| Antibody | Guinea pig polyclonal | Gift from Richard Mann (Casares and Mann, 1998) | Anti-Hth (1:2000) | |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#nc-82, RRID: AB_2314866 | Anti-Brp (1:50) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#712-545-153, RRID: AB_2340684 | Alexa Fluor 488 anti-rat (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#703-545-155, RRID: AB_2340375 | Alexa Fluor 488 anti-chicken (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#706-545-148, RRID: AB_2340472 | Alexa Fluor 488 anti-guinea pig (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#711-545-152, RRID: AB_2313584 | Alexa Fluor 488 anti-rabbit (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#715-545-150, RRID: AB_2340846 | Alexa Fluor 488 anti-mouse (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#715-295-151, RRID: AB_2340832 | Rhodamine Red-X anti-mouse (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#712-295-153, RRID: AB_2340676 | Rhodamine Red-X anti-rat (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#711-295-152, RRID: AB_2340613 | Rhodamine Red-X anti-rabbit (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#706-295-148, RRID: AB_2340468 | Rhodamine Red-X donkey anti-guinea pig (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#711-605-152, RRID: AB_2492288 | Alexa Fluor 647 donkey anti-rabbit (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#715-605-151, RRID: AB_2340863 | Alexa Fluor 647 donkey anti-mouse (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#706-605-148, RRID: AB_2340476 | Alexa Fluor 647 anti-guinea pig (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#712-605-153, RRID: AB_2340694 | Alexa Fluor 647 anti-rat (1:400) |
| Sequence-based reagent | Oligonucloetide | Integrated DNA Technologies | DamID Adaptor (top strand): CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA | |
| Sequence-based reagent | Oligonucloetide | Integrated DNA Technologies | DamID Adaptor (bottom strand): TCCTCGGCCG | |
| Sequence-based reagent | Oligonucloetide | Integrated DNA Technologies | DamID Primer for PCR: GGTCGCGGCCGAGGATC | |
| Commercial assay or kit | QIAamp DNA Micro Kit | QIAGEN | Cat#56304 | |
| Commercial assay or kit | PCR Purification Kit | QIAGEN | Cat#28104 | |
| Chemical compound, drug | EDTA | Sigma-Aldrich | Cat#E6758 | |
| Chemical compound, drug | DpnI and CutSmart buffer | NEB | Cat#R0176S | |
| Chemical compound, drug | DpnII and DpnII buffer | NEB | Cat#R0543S | |
| Chemical compound, drug | MyTaq HS DNA Polymerase | Bioline | Cat#BIO-21112 | |
| Chemical compound, drug | AlwI | NEB | Cat#R0513S | |
| Chemical compound, drug | RNase A (DNase free) | Roche | Cat#11119915001 | |
| Chemical compound, drug | T4 DNA ligase and 10x buffer | NEB | Cat#M0202S | |
| Software, algorithm | Fiji | Schindelin et al., 2012 | https://imagej.nih.gov/ij/download.html | |
| Software, algorithm | FastQC (v0.11.9) | The Babraham Bioinformatics group | https://www.bioinformatics.babraham.ac.uk/projects/download.html#fastqc | |
| Software, algorithm | MATLAB | Mathworks | https://www.mathworks.com/products/matlab.html | |
| Software, algorithm | damidseq_pipeline | Marshall and Brand, 2015 | https://owenjm.github.io/damidseq_pipeline/ | |
| Software, algorithm | Bowtie2 (v2.4.5) | Langmead and Salzberg, 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml | |
| Software, algorithm | IGV (v.2.13.2) | Robinson et al., 2011 | https://software.broadinstitute.org/software/igv/download | |
| Software, algorithm | SAMtools (v1.15.1) | Li et al., 2009 | http://www.htslib.org/download/ | |
| Software, algorithm | deepTools (v3.5.1) | Ramírez et al., 2016 | https://deeptools.readthedocs.io/en/develop/content/installation.html | |
| Software, algorithm | Find_peaks | Marshall et al., 2016 | https://github.com/owenjm/find_peaks |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/90133/elife-90133-mdarchecklist1-v1.pdf
-
Supplementary file 1
Genes that are expressed in L4 neurons and exhibit Bsh binding peaks.
- https://cdn.elifesciences.org/articles/90133/elife-90133-supp1-v1.xlsx
-
Supplementary file 2
Genes that are expressed in L4 neurons but do not exhibit Bsh binding peaks.
- https://cdn.elifesciences.org/articles/90133/elife-90133-supp2-v1.xlsx
-
Supplementary file 3
Genes that exhibit Bsh binding peaks but are not expressed in L4 neurons.
- https://cdn.elifesciences.org/articles/90133/elife-90133-supp3-v1.xlsx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Homeodomain proteins hierarchically specify neuronal diversity and synaptic connectivity
eLife 12:RP90133.
https://doi.org/10.7554/eLife.90133.3
