Notch signaling and Bsh homeodomain activity are integrated to diversify Drosophila lamina neuron types

  1. Chundi Xu  Is a corresponding author
  2. Tyler B Ramos
  3. Owen J Marshall
  4. Chris Q Doe  Is a corresponding author
  1. Institute of Neuroscience, Howard Hughes Medical Institute, University of Oregon, United States
  2. Menzies Institute for Medical Research, University of Tasmania, Australia
8 figures, 1 table and 5 additional files

Figures

Figure 1 with 1 supplement
Notch signaling is activated in newborn L4 neurons but not L5.

(A) Schematic of Notch signaling pathway. (B-B”) Hey as a reporter of active Notch signaling is only expressed in newborn L4 neurons but no other lamina neurons at 15 hr APF. Here and below, scale …

Figure 1—figure supplement 1
E(spl)-mγ is not expressed in lamina neurons.

(A-A”) E(spl)-mγ-GFP is expressed in the LPC region but not in lamina neurons. Erm labels L3; Svp labels L1; Bsh labels Bsh+ LPCs, L4 and L5. A solid white line outlines the LPC region.

Figure 2 with 1 supplement
L1 neurons express Delta and activate Notch signaling in adjacent L4 neurons.

(A, A’) Svp+Zfh1+L1 neurons are adjacent to both newborn L3 and L4 neurons. Newborn L3 neurons (Erm+) are localized strictly above (distal to) L1 neurons (Svp+Zfh1+), and L1 neurons are localized …

Figure 2—figure supplement 1
Svp is not required to initiate or maintain Delta expression in L1 neurons.

(A–D) In Svp-KD (27G05-Gal4>UAS-Svp-RNAi), there is a loss of Svp while Hey expression remains unaffected at 19 hr APF. (C–D) Quantification (single optical section). Here and below, scale bar, 10 …

Figure 3 with 2 supplements
Bsh without Notch signaling activates Pdm3 and specifies L5 neuronal fate.

(A–D) N-KD in lamina (27G05-Gal4, tubP-GAL80[ts], UAS-Notch-RNAi) shows Hey expression is absent, and Bsh only activates Pdm3 and specifies L5 neuronal fate during lamina neurogenesis (19 hr APF). …

Figure 3—figure supplement 1
27G05-Gal4 is inserted in between two Notch target genes; Bsh without Notch signaling activates Pdm3 and specifies L5 morphology.

(A) Schematic of 27G05-Gal4 insertion site in between two Notch target genes (E(spl)m4-BFM and E(spl)m5-HLH). (B-C”) Bsh without Notch signaling activates Pdm3 and specifies L5 morphology. In N-KD …

Figure 3—figure supplement 2
Bsh specifies L5 neuronal fate over L4 following Delta-KD.

(A–C) Delta-KD (27G05-Gal4, tubP-GAL80[ts], UAS-Delta-RNAi) in lamina shows the increase of Pdm3+ L5 neurons at the expense of L4 at 3-4d APF. (C) Quantification (single optical section). Scale bar, …

Figure 4 with 3 supplements
Bsh with Notch signaling activates Ap and specifies L4 neuronal fate.

(A–D) Ectopic expression of N-ICD in newborn L5 neurons (Bsh-Gal4 >UAS-N-ICD) results in ectopic Hey and Ap activation and an increased number of L4 neurons at 19 hr APF. Here and below, scale bar, …

Figure 4—figure supplement 1
Temporally restricted activation of Notch signaling by 27G05-Gal4 enables Bsh to specify L4 neuronal fate over L5.

(A) Schematic of the genetics for temporally restricted activation of Notch signaling. (B-C”) Activation of Notch signaling from 0 hr APF (affected region circled) results in ectopic Hey expression …

Figure 4—figure supplement 2
Bsh-Gal4 is expressed in newborn L5 neurons; Bsh does not activate L5 marker Pdm3 when Notch signaling is activated in newborn L5 by Bsh-Gal4 and UAS-N-ICD.

(A-B”) Bsh-Gal4 is expressed in newborn L5 neurons. (A-A”) GFP+ cells (white line circle; Bsh-Gal4 >UAS-myrGFP) label L5 neurons which are in the bottom (proximal) row of Bsh+ cells during lamina …

Figure 4—figure supplement 3
Bsh-Gal4 activation of Notch signaling in newborn L5 neurons specifies L4-like morphology and presynaptic sites.

(A) Schematic of the genetics used to trace the morphology and presynaptic site (Brp) of Hey+ neurons. (B–E) In controls, Tomato+ neurons in lamina have L4 morphology and presynaptic sites labeled …

Notch activation and Bsh expression are mutually independent; Notch signaling without Bsh specifies L3 neuron type.

(A–F) Notch activation and Bsh expression are mutually independent. (A–C) N-KD in lamina (27G05-Gal4, tubP-GAL80[ts], UAS-Notch-RNAi) results in loss of Hey expression without affecting Bsh …

Figure 6 with 2 supplements
The NotchON L4 has correlated open chromatin, Bsh-bound loci, and transcription profile that is distinct from the NotchOFF L5.

(A) Schematic of the Targeted DamID method. Upon GAL4 induction, low levels of either Dam or Bsh:Dam are expressed, allowing genome-wide open chromatin and Bsh binding targets to be identified. (B) …

Figure 6—figure supplement 1
Six to 60 Gal4 used for TaDa experiment is specifically expressed in L5 neurons at 46 –76 hr APF.

(A) Schematic of the genetics used to perform targeted Dam ID experiments (see Figure 6). (B-B”) 6–60 Gal4, which is expressed at 46–76 hr APF, drives GFP expression in all Pdm3+ L5 neurons and weak …

Figure 6—figure supplement 2
L4-distinct open chromatin regions are more likely to contain the Su(H) binding motif; L5-specific transcribed genes are correlated with L5-distinct open chromatin regions but not L5-distinct Bsh-bound loci.

(A) L4 and L5 neurons show distinct open chromatin regions (yellow), and the Su(H) binding motif (blue) is more likely to be present in L4-distinct open chromatin regions. (B) L4 and L5 neurons show …

Model; see the discussion section for details.
Author response image 1

Tables

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (D. melanogaster)10xUAS-IVS- myristoylated-GFPBloomington Drosophila Stock CenterRRID: BDSC_32199w[1118]; P{y[+t7.7] w[+mC]=10XUAS-IVS-myr::GFP}su(Hw)attP5
Strain, strain background (D. melanogaster)R27G05GAL4Bloomington Drosophila Stock CenterRRID: BDSC_48073w[1118]; P{y[+t7.7] w[+mC]=GMR27 G05-GAL4}attP2
Strain, strain background (D. melanogaster)UAS-Bsh-RNAiBloomington Drosophila Stock CenterRRID: BDSC_29336y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02498}attP2
Strain, strain background (D. melanogaster)yw; UAS-mCD8-GFP, UAS-rCD2i, FRT40A/
CyO; TM3, Sb/TM6B, Tb
Bloomington Drosophila Stock CenterRRID: BDSC_56185y[1] w[*]; P{y[+t7.7] w[+mC]=UAS-mCD8.GFP.UAS-rCD2i}attP40 P{ry[+t7.2]=neoFRT}40 A/CyO; TM3, Sb[1]/TM6B, Tb[1]
Strain, strain background (D. melanogaster)yw, hsFlp122; frt40a, UAS-CD2-RFP, UAS-GFP-miRNAGift from Claude Desplan Labyw, hsFLP; uas-CD2::RFP, UAS-GFP-miRNA/cyo; tm2/tm6b,tb
Strain, strain background (D. melanogaster)UAS-Notch-RNAiBloomington Drosophila Stock CenterRRID: BDSC_33611y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS00001}attP2
Strain, strain background (D. melanogaster)UAS-Notch-ICDStruhl and Greenwald, 2001;UAS-Notch-ICD; +/+
Strain, strain background (D. melanogaster)Hey-ORF-T2A-FlpD5Mark et al., 2021w; Hey-ORF-T2A-FLP(RFP+)/cyo, wg-LacZ; +/+
Strain, strain background (D. melanogaster)UAS-FRT-STOP-FRT-myrGFPBloomington Drosophila Stock CenterRRID: BDSC_55810w[1118]; P{y[+t7.7] w[+mC]=10XUAS(FRT.stop)GFP.Myr}su(Hw)attP5
Strain, strain background (D. melanogaster)w; Brp-FRT-STOP-FRT-smGdP-v5-T2A-LexA; LexAop-TomatoPeng et al., 2018; Xu et al., 2019w; Brp-FRT-STOP-FRT-smGdP-v5-T2A-LexA/cyo; LexAop-myrtdTomato/tm6b
Strain, strain background (D. melanogaster)UAS-Svp-RNAiBloomington Drosophila Stock CenterRRID: BDSC_28689y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF03105}attP2
Strain, strain background (D. melanogaster)6–60 Gal4Gift from Lawrence ZipurskyW; Bl/cyo; 6–60 Gal4/tm6b
Strain, strain background (D. melanogaster)Bsh-L-Gal4Gift from Makoto Sato;Bsh-L-Gal4/cyo; +/+
Strain, strain background (D. melanogaster)tubP-GAL80[ts]Bloomington Drosophila Stock CenterRRID: BDSC_7017w[*]; P{w[+mC]=tubP-GAL80[ts]}2/TM2
Strain, strain background (D. melanogaster)UAS-Zfh1-RNAiVienna Drosophila Resource CenterVDRC 103205P{KK109931}VIE-260B
Strain, strain background (D. melanogaster)31C06-Gal4, UAS-myristoylated-tdTomatoGift from Lawrence Zipursky;Bl/cyo; 31c06-Gal4, UAS- myristoylated-tdTomato/tm6b
Strain, strain background (D. melanogaster)E(spl)-mγ-GFPGift from Sarah Bray (Almeida and Bray, 2005)w; +/+; E(spl)mγ-GFP/tm6b
Strain, strain background (D. melanogaster)VALIUM20-mCherryBloomington Drosophila Stock CenterRRID: BDSC_35785y[1] sc[*] v[1] sev[21]; P{y[+t7.7] v[+t1.8]=VALIUM20-mCherry}attP2
Strain, strain background (D. melanogaster)Bsh-ORF-3XHA (86Fb)FlyORF WebshopCat#F000054M{UAS-bsh.ORF.3xHA.GW}ZH-86Fb
Strain, strain background (D. melanogaster)flyORF-TaDaBloomington Drosophila Stock CenterRRID: BDSC_91637w[1118]; M{RFP[3xP3.PB] w[+mC]=FlyORF-TaDa}ZH-86Fb
Strain, strain background (D. melanogaster)hs-FlpD5; FlyORF-TaDaBloomington Drosophila Stock CenterRRID: BDSC_91638w[1118]; P{y[+t7.7] w[+mC]=hs-FLPD5}attP40; M{RFP[3xP3.PB] w[+mC]=FlyORF-TaDa}ZH-86Fb
Strain, strain background (D. melanogaster)Bsh-TaDaXu et al., 2023w; +/CyO; UAS-GFP-Bsh-DAM/tm6b
AntibodyChicken polyclonalAbcamCat#ab13970,
RRID_300798
Anti-GFP (1:1000)
AntibodyRabbit polyclonalMedical & Biological Laboratories Co.Code#PM005Anti-RFP (1:500)
AntibodyRabbit polyclonalGift from Claude Desplan
(Özel et al., 2021)
Anti-Bsh (1:1000)
AntibodyGuinea pig polyclonalGift from Lawrence Zipursky (Tan et al., 2015) & Makoto SotoAnti-Bsh (1:1000)
AntibodyRat monoclonalThis studyAnti-Bsh (1:750); see methods section- generating Bsh antibody
AntibodyRabbit polyclonalGift from Markus Affolter
(Bieli et al., 2015)
Anti-Apterous (1:1000)
AntibodyRat monoclonalGift from Cheng-Ting Chien (Chen et al., 2012)Anti-Pdm3 (1:200)
AntibodyRabbit polyclonalGift from Cheng-Yu Lee (Janssens et al., 2014)Anti-Erm (1:100)
AntibodyRat monoclonalGift from Jing Peng (Santiago et al., 2021)Anti-Erm (1:70)
AntibodyMouse monoclonalDevelopmental Studies Hybridoma BankCat#Seven-up D2D3, RRID_2618079Anti-Svp (1:10)
AntibodyRabbit polyclonalGift from James Skeath (Tian et al., 2004)Anti-Zfh1 (1:1000)
AntibodyRabbit polyclonalAsian Distribution Center for Segmentation AntibodiesCode#812Anti-Tailless (1:200)
AntibodyMouse monoclonalDevelopmental Studies Hybridoma BankCat#Elav-9F8A9,
RRID: AB_528217
Anti-Elav (1:200)
AntibodyMouse monoclonalBio-Rad LaboratoriesCat#MCA1360A647,
RRID: AB_770156
Anti-V5-TAG:Alexa Fluor 647 (1:300)
AntibodyMouse monoclonalDevelopmental Studies Hybridoma BankCat#nc-82,
RRID: AB_2314866
Anti-Brp (1:50)
AntibodyMouse monoclonalDevelopmental Studies Hybridoma BankCat#C594.9B,
RRID: AB_528194
Anti-Delta (1:10)
AntibodyMouse monoclonalTaKaRaCat#632543Anti-Cherry (1:500)
AntibodyDonkey polyclonalJackson ImmunoResearch LabCat# 711-475-152
AB_2340616
DyLight 405 anti-rabbit (1:400)
AntibodyDonkey polyclonalJackson ImmunoResearch LabCat#703-545-155, RRID: AB_2340375Alexa Fluor 488 anti-chicken (1:400)
AntibodyDonkey polyclonalJackson ImmunoResearch LabCat#706-545-148, RRID: AB_2340472Alexa Fluor 488 anti-guinea pig (1:400)
AntibodyDonkey polyclonalJackson ImmunoResearch LabCat#711-545-152, RRID: AB_2313584Alexa Fluor 488 anti-rabbit (1:400)
AntibodyDonkey polyclonalJackson ImmunoResearch LabCat#715-545-150, RRID: AB_2340846Alexa Fluor 488 anti-mouse (1:400)
AntibodyDonkey polyclonalJackson ImmunoResearch LabCat#715-295-151, RRID: AB_2340832Rhodamine Red-X anti-mouse (1:400)
AntibodyDonkey polyclonalJackson ImmunoResearch LabCat#712-295-153, RRID: AB_2340676Rhodamine Red-X anti-rat (1:400)
AntibodyDonkey polyclonalJackson ImmunoResearch LabCat#711-295-152, RRID: AB_2340613Rhodamine Red-X anti-rabbit (1:400)
AntibodyDonkey polyclonalJackson ImmunoResearch LabCat#706-295-148, RRID: AB_2340468Rhodamine Red-X donkey anti-guinea pig (1:400)
AntibodyDonkey polyclonalJackson ImmunoResearch LabCat#711-605-152, RRID: AB_2492288Alexa Fluor 647 donkey anti-rabbit (1:400)
AntibodyDonkey polyclonalJackson ImmunoResearch LabCat#715-605-151, RRID: AB_2340863Alexa Fluor 647 donkey anti-mouse (1:400)
AntibodyDonkey polyclonalJackson ImmunoResearch LabCat#706-605-148, RRID: AB_2340476Alexa Fluor 647 anti-guinea pig (1:400)
AntibodyDonkey polyclonalJackson ImmunoResearch LabCat#712-605-153, RRID: AB_2340694Alexa Fluor 647 anti-rat (1:400)
Sequence-based reagentOligonucloetideIntegrated DNA technologiesDamID Adaptor (top strand): CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA
Sequence-based reagentOligonucloetideIntegrated DNA technologiesDamID Adaptor (bottom strand): TCCTCGGCCG
Sequence-based reagentOligonucloetideIntegrated DNA technologiesDamID Primer for PCR: GGTCGCGGCCGAGGATC
Commercial assay or kitQIAamp DNA Micro KitQiagenCat#56304
Commercial assay or kitPCR Purification KitQiagenCat#28104
Chemical compound, drugEDTASigma-AldrichCat#E6758
Chemical compound, drugDpnI and CutSmart bufferNEBCat#R0176S
Chemical compound, drugDpnII and DpnII bufferNEBCat#R0543S
Chemical compound, drugMyTaq HS DNA PolymeraseBiolineCat#BIO-21112
Chemical compound, drugAlwINEBCat#R0513S
Chemical compound, drugRNase A (DNase free)RocheCat#11119915001
Chemical compound, drugT4 DNA ligase and 10 x bufferNEBCat#M0202S
Software, algorithmFijiSchindelin et al., 2012https://imagej.nih.gov/ij/download.html
Software, algorithmFastQC (v0.11.9)The Babraham Bioinformatics grouphttps://www.bioinformatics.babraham.ac.uk/projects/download.html#fastqc
Software, algorithmdamidseq_pipelineMarshall and Brand, 2015https://owenjm.github.io/damidseq_pipeline/
Software, algorithmBowtie2 (v2.4.5)Langmead and Salzberg, 2012http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
Software, algorithmIGV (v.2.13.2)Robinson et al., 2011https://software.broadinstitute.org/software/igv/download
Software, algorithmSAMtools (v1.15.1)Li et al., 2009http://www.htslib.org/download/
Software, algorithmdeepTools (v3.5.1)Ramírez et al., 2016https://deeptools.readthedocs.io/en/develop/content/installation.html
Software, algorithmFind_peaksMarshall et al., 2016https://github.com/owenjm/find_peaks; (Marshall, 2016)

Additional files

Download links