Control of meiotic entry by dual inhibition of a key mitotic transcription factor
- Department of Molecular and Cell Biology, University of California, Berkeley, United States
Figures
Figure 1 with 1 supplement
Swi4 subunit of the SBF and SBF targets are downregulated during early meiosis.
(A) A schematic of SBF and MBF complexes and the general functional groups of the genes they regulate. (B) Samples from strain UB35246 were collected between 0 and 6 hr (h) in sporulation medium (SPO) and immunoblots were performed using α-Swi4, α-Swi6, and α-Mbp1 respectively. Hxk2 was used a loading control. Representative blots from one of two biological replicates are shown. (C) Quantification of the immunoblots in (B). The signal at each time point was first normalized to Hxk2 loading control and then to the max signal. (D) Scatterplot of RNA-seq data (RPKM) from Brar et al., 2012 comparing 2 hr in SPO vs. mitotic growth of well characterized SBF targets (pink) and MBF targets (teal). (E) Wild type (UB22199) and pATG8-SWI4 (UB22226) cells were collected to perform RT-qPCR for CLN1, CLN2, CDC21, and RNR1 transcripts. Transcript abundance was quantified using primer sets specific for each respective gene from three technical replicates for each biological replicate. Quantification was performed in reference to PFY1 and then normalized to wild-type control. FC=fold change. Experiments were performed twice using biological replicates, mean value plotted with range. Differences in wild type versus pATG8-SWI4 transcript levels at 2 hr in SPO compared with a two-tailed t-test (*, p=0.0351 [CLN1]; **, p=0.0013 [CLN2]; ns, p=0.8488 [CDC21]; ns, p=0.0859 [RNR1]). (F) Live-cell imaging of strains containing the fluorescently tagged histone Htb1-mCherry for wild type (UB32085) and pATG8-SWI4 (UB32089). Experiments were performed twice using biological replicates, mean value plotted with range. Differences in meiotic progression tested by Mann Whitney test, two-tailed (**, p=0.0045).
-
Figure 1—source data 1
Original file for the immunoblot shown in Figure 1B (anti-Swi4, anti-Swi6, anti-Mbp1, anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig1-data1-v2.zip
-
Figure 1—source data 2
Original file for the immunoblot shown in Figure 1B with highlighted bands and sample labels (anti-Swi4, anti-Swi6, anti-Mbp1, anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig1-data2-v2.zip
Figure 1—figure supplement 1
Swi4 protein abundance in wild-type and pATG8-SWI4 cells.
Left: Wild type (UB22199) and pATG8-SWI4 (UB22226) cells collected between 0 and 4 hr in SPO. Immunoblot performed using α-V5 to quantify Swi4-3V5 abundance. Normalized to Hxk2 loading control. Right: Quantification of the immunoblots.
-
Figure 1—figure supplement 1—source data 1
Original file for the immunoblot shown in Figure 1—figure supplement 1 (anti-V5 [for detecting Swi4-3V5], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig1-figsupp1-data1-v2.zip
-
Figure 1—figure supplement 1—source data 2
Original file for the immunoblot shown in Figure 1—figure supplement 1 with highlighted bands and sample labels (anti-V5 [for detecting Swi4-3V5], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig1-figsupp1-data2-v2.zip
Figure 2 with 2 supplements
Regulation of Swi4 abundance is required for timely meiotic entry.
(A–B) Fixed imaging of cells marked with GFP-Ime1 and Htb1-mCherry. Wild type (UB22199) and pATG8-SWI4 (UB22226) cells were collected between 0 and 4 hr in SPO. (A) Representative images with merge at 0 hr and 2 hr in SPO. Representative cells outlined. Scale bar: 3μm. (B) Quantification as percent cells with nuclear Ime1. Experiments were performed twice using biological replicates, mean value plotted with range. Total of 200 cells analyzed per strain. Differences in the fraction of cells with nuclear Ime1 was compared using a two- tailed t-test (**, p=0.0099 [1 hr in SPO]; *, p=0.0169 [2 hr in SPO]; *, p=0.0315 [3 hr in SPO]; ns, two-tailed p=0.4595 [4 hr in SPO]). (C–E) Fixed imaging of cells marked with GFP-Ime1 and Swi4-mCherry. Wild type (UB31378) and pATG8-SWI4 (UB31381) cells were collected at 0 hr and 4 hr in SPO. (C) Example images with merge at 4 hr in SPO. Example cells outlined (*low nuclear GFP-Ime1 with high nuclear Swi4-mCherry, **high nuclear GFP-Ime1 with low nuclear Swi4-mCherry). Scale bar: 3 μm. (D) Scatterplot of GFP-Ime1 mean nuclear intensity and Swi4-mCherry mean nuclear intensity for wild type and pATG8-SWI4 cells at 0 hr in SPO. See Materials and methods for further details about image quantification. Dashed line is linear regression plotted for each condition and strain. A total number of 269 cells were analyzed. (E) Same as in (D) but for wild type and. pATG8-SWI4 cells at 4 hr in SPO. A total number of 341 cells were analyzed. Differences in mean nuclear GFP-Ime1 or Swi4-mCherry intensity between wild type and pATG8-SWI4 compared using a Mann-Whitney test, two-tailed (****, p<0.0001 [wild type vs. pATG8-SWI4 (GFP-Ime1)]; ****, p<0.0001 [wild type vs. pATG8-SWI4 (Swi4-mCherry)]). (F) Volcano plot of DE-Seq2 analysis for pATG8-SWI4 versus wild type. Dashed line indicates padj (p value)=0.05. Analysis was performed using mRNA-seq from two biological replicates. Wild type (UB22199) and pATG8-SWI4 (UB22226) cells were collected at 2 hr in SPO. SBF targets (pink) (Iyer et al., 2001) and early meiotic genes (blue) defined by Brar et al., 2012. Darker pink or darker blue, labeled dots are well studied targets in either gene set list. (G) GSEA analysis of mRNA-seq comparing wild type vs. pATG8-SWI4 collected at 2 hr in SPO. Vertical black bars represent the early meiotic cluster from Brar et al., 2012 or SBF cluster from Iyer et al., 2001. The heatmap indicates genes that are more enriched in pATG8-SWI4 (red, left-side) or genes that are enriched in wild type (blue, right-side). NES=normalized enrichment score. Enrichment was determined by comparing pATG8-SWI4 versus wild type. (H–I) Live-cell imaging of cells in meiosis marked by Rec8-GFP and nuclear marker Htb1-mCherry for wild type (UB32085) and pATG8-SWI4 (UB32089). (H) Movie montage with example images throughout meiosis for Rec8-GFP and Htb1-mCherry. Scale bar: 3 μm. (I) Quantification as percent of cells that entered meiosis assayed by nuclear Rec8 appearance. Experiments were performed using two biological replicates, mean value plotted with range. A total number of 452 cells were analyzed. Differences in meiotic progression compared by Mann Whitney test, two-tailed (***, p=0.0005 [wild type vs. pATG8-SWI4]).
Figure 2—figure supplement 1
Ime1 protein abundance in wild-type and pATG8-SWI4 cells.
Left: Wild type (UB22199) and pATG8-SWI4 (UB22226) cells collected between 0 and 4 hr in SPO. Immunoblot performed using α-GFP to quantify GFP-Ime1 abundance. Normalized to Hxk2 loading control. Right: Quantification of the immunoblots.
-
Figure 2—figure supplement 1—source data 1
Original file for the immunoblot shown in Figure 2—figure supplement 1 (anti-GFP [for detecting GFP-Ime1], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig2-figsupp1-data1-v2.zip
-
Figure 2—figure supplement 1—source data 2
Original file for the immunoblot shown in Figure 2—figure supplement 1 with highlighted bands and sample labels (anti-GFP [for detecting GFP-Ime1], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig2-figsupp1-data2-v2.zip
Figure 2—figure supplement 2
Gene ontology analysis for mRNA-seq comparing pATG8-SWI4 to wild type.
Top: Gene ontology analysis for genes that have significant increased expression by DESeq2 (see Materials and Methods) in pATG8-SWI4 (UB2226) and wild type (UB22199). Term size is the number of genes within a defined term. Enrichment score calculated for each term and plotted. Bottom: Same as in top panel but for genes that have significant decreased expression.
Figure 3 with 1 supplement
Removal of the SBF targets Cln1 or Cln2 partially rescues the meiotic entry delay in the pATG8-SWI4 mutant.
(A) Immunoblotting was performed on samples collected for wild type (UB29326) and pATG8-SWI4 (UB29328) between 0 and 6 hr in SPO using α-V5 antibody to track Cln1-3V5. Hxk2 was used a loading control. Representative blots from one of two biological replicates are shown. (B) Quantification of (A). (C) Same as in (A) but for wild type (UB29330) and pATG8-SWI4 (UB29332) cells using α-V5 antibody to track Cln2-3V5. Hxk2 was used a loading control. Representative blots from one of two biological replicates are shown. (D) Quantification of (C). (E) Live-cell imaging of meiotic cells marked by Rec8-GFP and nuclear marker Htb1-mCherry, with the following genotypes: wild type (UB32085), pATG8-SWI4 (UB32089), and pATG8-SWI4; cln1∆ (UB34536). Quantification of cells that entered meiosis assayed by the initial timing of nuclear Rec8 appearance. Experiments were performed using two biological replicates, mean value plotted with range. A total number of 883 cells were analyzed. Differences in meiotic progression compared by Mann-Whitney test, two-tailed (*, p=0.0111 [pATG8-SWI4 vs. pATG8-SWI4; cln1∆]). cln1∆ alone (not shown) has similar meiotic progression kinetics relative to wild type. (F) Same as (E) but with the following genotypes: wild type (UB32085), pATG8-SWI4 (UB32089), and pATG8-SWI4; cln2∆ (UB34165). A total number of 610 cells were analyzed. Differences in meiotic progression compared by Mann-Whitney test, two-tailed (*, p=0.0478 [pATG8-SWI4 vs. pATG8-SWI4; cln2∆]). cln2∆ alone (not shown) has similar meiotic progression kinetics relative to wild type.
-
Figure 3—source data 1
Original file for the immunoblot shown in Figure 3A (anti-V5 [for detecting Cln1-3V5], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig3-data1-v2.zip
-
Figure 3—source data 2
Original file for the immunoblot shown in Figure 3A with highlighted bands and sample labels (anti-V5 [for detecting Cln1-3V5], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig3-data2-v2.zip
-
Figure 3—source data 3
Original file for the immunoblot shown in Figure 3C (anti-V5 [for detecting Cln2-3V5], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig3-data3-v2.zip
-
Figure 3—source data 4
Original file for the immunoblot shown in Figure 3C with highlighted bands and sample labels (anti-V5 [for detecting Cln2-3V5], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig3-data4-v2.zip
Figure 3—figure supplement 1
Meiotic entry upon removal of either Cln1 or Cln2.
Live-cell imaging of meiotic cells marked by Rec8-GFP and nuclear marker Htb1-mCherry, with the following genotypes: wild type (UB32085), pATG8-SWI4 (UB32089), cln2∆ (UB35595), and cln1∆ (UB35597). Quantification of cells that entered meiosis assayed by the initial timing of nuclear Rec8 appearance. Experiments were performed using two biological replicates, mean value plotted with range. A total number of 800 cells were analyzed.
Figure 4 with 4 supplements
Tethering of Ime1 to Ume6 is sufficient to overcome the meiotic block exerted by G1 cyclin overexpression.
(A) Sporulation efficiency of cells at 24 hr in SPO media wild type (UB22199), pATG8-CLN1 (UB32820), pATG8-CLN2 (UB25959), pCUP-GFP-IME1 (UB34641), pCUP1-GFP-IME1; pATG8-CLN2 (UB35057), PUS1-αGFP (UB35593), PUS1-αGFP; pATG8-CLN2 (UB35982), UME6-αGFP (UB35300), and UME6-αGFP; pATG8-CLN2 (UB35177). Experiments shown in this figure were performed using two biological replicates, mean value plotted with range. Total of 200 cells counted per strain. See Supplementary file 2 for statistics. (B–C) Fixed imaging of cells marked with GFP-Ime1 and Htb1-mCherry. Wild type (UB22199) and pATG8-CLN2 (UB25959) cells were collected between 0 and 3 hr in SPO. (B) Representative images with merge at 2 hr in SPO. Representative cells outlined. Scale bar: 3 μm. (C) Quantification of cells with nuclear Ime1. Experiments were performed using two biological replicates, mean value plotted with range. Total of 200 cells analyzed per strain. Differences in percent of cells with nuclear Ime1 was compared by two-tailed t-test (**, p=0.00917 [1 hr in SPO]; **, p=0.0044 [2 hr in SPO]; *, p=0.0122 [3 hr in SPO]). (D) Schematic depicting use of pCUP1 promoter (pCUP1-GFP-IME1) to rescue Ime1 transcript and protein levels. (E–F) Fixed imaging of cells marked with GFP-Ime1 and Htb1-mCherry. Cells with the following genotypes were collected at 2 hr in SPO: wild type (UB22199), pATG8-CLN2 (UB35106), pCUP1-GFP-IME1 (UB34641), and pCUP1-GFP-IME1; pATG8-CLN2 (UB35057). (E) Representative images with merge and representative cells outlined. Scale bar: 3 μm. (F) GFP-Ime1 mean nuclear intensity measured for a single z-slice. A total number of 433 cells were analyzed. Differences in mean nuclear intensity compared by Mann-Whitney test, two tailed, (****, p<0.0001 [pCUP1-IME1 vs. pCUP1-IME1; pATG8-CLN2]). (G) Schematic of nanobody trap strategy with PUS1-αGFP and GFP-Ime1 to rescue Ime1 nuclear localization in meiosis. (H–I) Fixed imaging of cells marked with GFP-Ime1 and Htb1-mCherry. Cells with the following genotypes were collected at 2 hr in SPO: wild type (UB22199), pATG8-CLN2 (UB35106), PUS1-αGFP (UB35593), and PUS1-αGFP; pATG8-CLN2 (UB35982). (H) Representative images with merge and example cells outlined. Scale bar: 3 μm. (I) GFP-Ime1 mean nuclear intensity measured for a single z-slice. A total number of 934 cells were analyzed. Differences in mean nuclear intensity compared by Mann-Whitney test, two-tailed, (****, p<0.0001 [wild type vs. pATG8-CLN2]; not significant (ns), p=0.6563 [PUS1-αGFP vs. pATG8-CLN2; PUS1-αGFP]; not significant (ns), p=0.8881 [wildtype vs. pATG8-CLN2; PUS1-αGFP]). (J) Schematic of nanobody trap strategy with UME6-αGFP and GFP-Ime1 to rescue Ime1-Ume6 interaction in meiosis. (K–L) Fixed imaging of cells marked with GFP-Ime1 and Htb1-mCherry. Cells with the following genotypes were collected at 2 hr in SPO: wild type (UB22199), pATG8-SWI4 (UB35106), UME6-αGFP (UB35300), and UME6-αGFP; pATG8-CLN2 (UB35177). (K) Representative images with merge and representative cells outlined. Scale bar: 3 μm. (L) GFP-Ime1 mean nuclear intensity measured for a single z-slice. A total number of 1220 cells were analyzed. Differences in mean nuclear intensity compared by Mann-Whitney test, two-tailed (****, p<0.0001 [wild type vs. pATG8-CLN2]; ****, p<0.0001 [UME6-αGFP vs. pATG8-CLN2; UME6-αGFP]; *, p=0.0354 [wildtype vs. pATG8-CLN2; UME6-αGFP]).
Figure 4—figure supplement 1
IME1 transcript levels upon CLN2 overexpression.
RT-qPCR was performed on IME1 transcript for samples collected from wild type (UB22199) and pATG8-CLN2 (UB35106) cells between 0 and 6 hr in SPO. Quantification was performed in reference to levels of the meiotic housekeeping gene PFY1 and then normalized to wild type. FC=fold change. Experiments were performed in duplicate, mean value plotted with range.
Figure 4—figure supplement 2
Ime1 protein levels upon CLN2 overexpression.
Left: Immunoblot was performed on wild type (UB22199) and pATG8-CLN2 (UB35106) cells collected between 0 and 6 hr in SPO. Immunoblotted using α-GFP to quantify GFP-Ime1 abundance. Normalized to Hxk2 loading control. Representative blots from one of two biological replicates are shown. Right: Quantification of the immunoblots.
-
Figure 4—figure supplement 2—source data 1
Original file for the immunoblot shown in Figure 4—figure supplement 2 (anti-GFP [for detecting GFP-Ime1], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig4-figsupp2-data1-v2.zip
-
Figure 4—figure supplement 2—source data 2
Original file for the immunoblot shown in Figure 4—figure supplement 2 with highlighted bands and sample labels (anti-GFP [for detecting GFP-Ime1], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig4-figsupp2-data2-v2.zip
Figure 4—figure supplement 3
IME1 transcript levels upon CLN2 overexpression in pCUP1-GFP-IME1 background.
RT-qPCR was performed on IME1 transcript for samples collected from pCUP1-GFP-IME1 (UB34641) and pCUP1-GFP-IME1; pATG8-CLN2 (UB35057) cells between 0 and 4 hr in SPO. Quantification was performed in reference to levels of the meiotic housekeeping gene PFY1 and then normalized to wild type. FC=fold change. Experiments were performed in duplicate, mean value plotted with range.
Figure 4—figure supplement 4
Ime1 protein levels upon CLN2 overexpression in pCUP1-GFP-IME1 background.
Left: Immunoblot was performed on samples from wild type (UB22199), pATG8-CLN2 (UB35106), pCUP1-GFP-IME1 (UB34641), and pCUP1-GFP-IME1; pATG8-CLN2 (UB35057) strains collected between 0 and 4 hr in SPO. 50 µM CuSO4 after 2 hr in SPO was added to all cells. Representative blots from one of two biological replicates are shown. Right: Quantification of the immunoblots.
-
Figure 4—figure supplement 4—source data 1
Original file for the immunoblot shown in Figure 4—figure supplement 4 (anti-GFP [for detecting GFP-Ime1], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig4-figsupp4-data1-v2.zip
-
Figure 4—figure supplement 4—source data 2
Original file for the immunoblot shown in Figure 4—figure supplement 4 with highlighted bands and sample labels (anti-GFP [for detecting GFP-Ime1], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig4-figsupp4-data2-v2.zip
Figure 5 with 1 supplement
Ime1-dependent expression of a LUTI from the SWI4 locus leads to a reduction in Swi4 protein levels during meiotic entry.
(A) Genome browser views of RNA-seq data (Brar et al., 2012) of the SWI4 locus. SWI4LUTI transcription start site is ~1045 bp upstream of SWI4 ORF translation start site. (B) A schematic of LUTI-based gene regulation. Top: Mitotic growth, SWI4LUTI is repressed due to Ume6-Rpd3-Sin3 complex and SWI4canon is induced by one or more transcription factors including Ace2, Mbp1, and Swi5, leading to Swi4 protein production. Bottom: Meiosis-specific expression of SWI4LUTI by Ime1-Ume6 leads to downregulation of Swi4 protein production due to combined effect of transcriptional and translation interference. SWI4LUTI 5′ leader contains 7 AUG uORFs but only one is shown in the model for simplicity. Schematic is adapted from Tresenrider et al., 2021. (C) Representative smFISH images collected from premeiotic and meiotic cells for detecting SWI4canon and SWI4LUTI. Cells with pCUP1-IME1/pCUP1-IME4 meiotic synchronization system were induced to enter meiosis with 50 µM CuSO4 after 2 hr in SPO. Premeiotic cells were collected before IME1/4 induction and meiotic cells were collected 2 hr post IME1/4 induction from strain UB14273. Q 670 probes (green) hybridize to shared region within SWI4 CDS. CF590 probes hybridize to the unique 5′ leader region of SWI4LUTI (depicted on the schematic shown above the images). DNA was stained with DAPI. Scale bar: 3 μm. (D) Quantification of smFISH shown in (C), plotted as relative frequency histograms of cells with SWI4canon and SWI4LUTI transcripts per cell. Data pooled from two independent biological replicates. Dashed line indicates median number of transcripts per cell. Each histogram is normalized with maximum bin height being the same across all histograms. A total number of 44 cells counted for premeiotic and 102 cells counted in meiotic prophase. Differences in premeiotic versus meiotic were compared by Mann-Whitney test, two-tailed (***, p=0.0007 [SWI4canon]; ****, p<0.0001 [SWI4LUTI]). (E) RNA blot performed on cells collected between 0 and 6 hr in SPO. All strains carry a SWI4-3V5 tagged allele. Probe was specific for 3V5. Methylene blue staining of rRNA bands was used as a loading control. Matched immunoblotting was performed against Swi4-3V5 using α-V5 and normalized to Hxk2 loading control for each sample. Cells collected are wild type (UB22199) and ∆LUTI (UB23012). Representative blots from one of two biological replicates are shown. (F) Quantification of immunoblot in (E). (G) Performed as described in (E) for wild type (UB21386) and ∆uORF (UB23636) strains. Representative blots from one of two biological replicates are shown. (H) Quantification of immunoblot in (G). (I) Immunoblot using α-V5 performed on cells collected between 0 and 7 hr in SPO from a strain carrying pCUP1-IME1 and SWI4-3V5 alleles (UB34641). Swi4-3V5 abundance was normalized to Hxk2 loading control. Cells were induced to enter meiosis with 50 µM CuSO4 after 2 hr preincubation in SPO. Representative blots from one of two biological replicates are shown. (J) Quantification of immunoblot in (I). (K) Genome browser view of Ume6-ChIP at the SWI4 locus (adapted from Tresenrider et al., 2021).
-
Figure 5—source data 1
Original file for the RNA blot shown in Figure 5E (Probe was specific for 3V5, for detecting SWI4-3V5 canonical and LUTI transcripts).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig5-data1-v2.zip
-
Figure 5—source data 2
Original file for the RNA blot shown in Figure 5E (methylene blue staining for rRNA detection).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig5-data2-v2.zip
-
Figure 5—source data 3
Original file for the immunoblot shown in Figure 5E (anti-V5 [for detecting Swi4-3V5], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig5-data3-v2.zip
-
Figure 5—source data 4
Original files for the RNA blots and immunoblot shown in Figure 5E with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig5-data4-v2.zip
-
Figure 5—source data 5
Original file for the RNA blot shown in Figure 5G (Probe was specific for 3V5, for detecting SWI4-3V5 canonical and LUTI transcripts).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig5-data5-v2.zip
-
Figure 5—source data 6
Original file for the RNA blot shown in Figure 5G (methylene blue staining for rRNA detection).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig5-data6-v2.zip
-
Figure 5—source data 7
Original file for the immunoblot shown in Figure 5G (anti-V5 [for detecting Swi4-3V5], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig5-data7-v2.zip
-
Figure 5—source data 8
Original files for the RNA blots and immunoblot shown in Figure 5G with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig5-data8-v2.zip
-
Figure 5—source data 9
Original file for the immunoblot shown in Figure 5I (anti-V5 [for detecting Swi4-3V5], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig5-data9-v2.zip
-
Figure 5—source data 10
Original file for the immunoblot shown in Figure 5I with highlighted bands and sample labels (anti-V5 [for detecting Swi4-3V5], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig5-data10-v2.zip
Figure 5—figure supplement 1
Expression of SWI4LUTI in Ume6(T99N) mutant.
Fold change expression in wild type or Ume6(T99N) mutant between pre meiotic conditions and meiotic prophase (Tresenrider et al., 2021).
Figure 6 with 3 supplements
SWI4LUTI is integrated into a larger regulatory network to regulate SBF activity during meiotic entry.
(A) Volcano plot of DESeq2 analysis for ∆LUTI versus wild type. Dashed line indicates padj (p-value)=0.05. Analysis was performed with mRNA-seq in duplicate. Wild type (UB27083) and ∆LUTI (UB26874) collected at 2 hr in SPO. SBF targets (pink) and early meiotic genes (blue) defined by Iyer et al., 2001 and; Brar et al., 2012. Darker pink or darker blue, labeled dots are well studied targets in either gene set list. (B) Top: Schematic of the anchor-away system using WHI5-mCherry-FRB (WHI5-AA) and RPL13a-FKBP12 alleles. Bottom: Fixed imaging of cells marked with WHI5-mCherry-FRB (WHI5-AA) with DNA stained with DAPI. One µM rapamycin added at 0 hr in SPO to induce nuclear exclusion of Whi5 (UB25431) strain collected at 0.5 hr in SPO. Scale bar: 3 μm. Cells are rapamycin resistant due to mutated TOR1 (tor1-1) and frp1∆ (yeast FKBP12 homolog) to reduce competition between for binding of Frb and Fkbp12. (C) Same as in (A) but for wild type (UB27083) and WHI5-AA (UB25431) collected at 2 hr in SPO. (D) Same as in (A) but for wild type (UB27083) and ∆LUTI; WHI5-AA (UB25428) collected at 2 hr in SPO. (E) Live-cell imaging of cells in meiosis marked by Rec8-GFP and nuclear marker Htb1-mCherry. The following genotypes were imaged: wild type (UB35987), ∆LUTI (UB35989), WHI5-AA (UB35991), ∆LUTI; WHI5-AA (UB35989). Quantification as percent of cells that entered meiosis assayed by nuclear Rec8 appearance. Experiments were performed using two biological replicates, mean value plotted with range. Differences in meiotic progression compared by Mann-Whitney test, two-tailed (*, p=0.0112 [wild type vs. ∆LUTI; WHI5-AA]). (F) Model of SBF regulation during meiotic entry. Ime1 downregulates Swi4 protein expression via induction of SWI4LUTI while Whi5 represses SBF activity in parallel to LUTI-based mechanism to prevent expression of SBF targets, including G1 cyclins, which perturb meiotic entry via blocking interaction between Ime1 and its cofactor Ume6.
Figure 6—figure supplement 1
Whi5 localization in early meiosis.
Fixed imaging of cells marked with GFP-Ime1 and Whi5-mCherry with DNA stained with DAPI. Representative images with merge at 0 hr and 2 hr in SPO. Representative cells outlined. Scale bars: 2 µm.
Figure 6—figure supplement 2
Swi4 protein levels matching Figure 6A, C and D.
Left: Cells with the following genotypes were collected between 0 and 6 hr in SPO: wild type (UB27083), ∆LUTI (UB26874), WHI5-AA (UB25431), ∆LUTI; WHI5-AA (UB25428). Immunoblotted using α-V5 to quantify Swi4-3V5 abundance. Normalized to Hxk2 loading control. Representative blots from one of two biological replicates are shown. Right: Quantification of the immunoblots.
-
Figure 6—figure supplement 2—source data 1
Original file for the immunoblot shown in Figure 6—figure supplement 2 (WT and ∆LUTI; anti-V5 [for detecting Swi4-3V5], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig6-figsupp2-data1-v2.zip
-
Figure 6—figure supplement 2—source data 2
Original file for the immunoblot shown in Figure 6—figure supplement 2 (WHI5-AA and WHI5-AA, ∆LUTI; anti-V5 [for detecting Swi4-3V5], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig6-figsupp2-data2-v2.zip
-
Figure 6—figure supplement 2—source data 3
Original file for the immunoblot shown in Figure 6—figure supplement 2 with highlighted bands and sample labels (anti-V5 [for detecting Swi4-3V5], anti-Hxk2).
- https://cdn.elifesciences.org/articles/90425/elife-90425-fig6-figsupp2-data3-v2.zip
Figure 6—figure supplement 3
GSEA data for ∆LUTI; WHI5-AA.
GSEA analysis of mRNA-seq comparing wildtype vs. ∆LUTI; WHI5-AA (UB25428) cells collected at 2 hr in SPO. Vertical black bars represent early meiotic gene cluster from Brar et al., 2012 or SBF cluster from Iyer et al., 2001. The heatmap indicates genes that are more enriched in ∆LUTI; WHI5-AA (red, left-side) or genes that are enriched with wild type (blue, right-side). NES=normalized enrichment score. Enrichment was determined comparing wild type to ∆LUTI; WHI5-AA.
Author response image 1
Wild type (UB22199) and ∆LUTI;WHI5-AA (UB25428) cells were collected to perform RT-qPCR for CLN2 transcript abundance.
Transcript abundance was quantified using primer sets specific for each respective gene from three technical replicates for each biological replicate. Quantification was performed in reference to PFY1 and then normalized to wild-type control. FC=fold change. Experiments were performed twice using biological replicates, mean value plotted with range. Differences in wild type versus ∆LUTI; WHI5-AA transcript levels compared with a two-tailed t-test (*, p = 0.0288)
Author response image 2
Volcano plot of DE-Seq2 analysis for ∆LUTI;WHI5-AA versus wild type.
Dashed line indicates padj (p value) = 0.05. Analysis was performed using mRNA-seq from two biological replicates. Wild type (UB22199) and ∆LUTI;WHI5-AA (UB25428) cells were collected at 2 h in SPO. SBF targets (pink) (Iyer et al., 2001) and early meiotic genes (blue) defined by (Brar et al., 2012). Darker pink or darker blue, labeled dots are well studied targets in either gene set list.
Author response image 3
Samples from strain wild type (UB22199), pATG8-SWI4 (UB2226), pATG8-CLN2 (UB25959) and were collected between 0-4 hours (h) in sporulation medium (SPO) and immunoblots were performed using α-GFP.
Hxk2 was used a loading control.
Author response image 4
Wild type (UB22199), pATG8-SWI4 (UB2226), pATG8-CLN2 (UB25959) cells were collected to perform RT-qPCR for CLN2 transcript abundance.
Quantification was performed in reference to PFY1 and then normalized to wild-type control. FC=fold change.
Author response image 5
Wild type (UB22199), pATG8-SWI4 (UB35106), UME6-⍺GFP (UB35300), and UME6-⍺GFP; pATG8-CLN2 (UB35177) cells collected between 0-3 hours (h) in sporulation medium (SPO) and immunoblots were performed using α-GFP.
Hxk2 was used a loading control
Author response image 6
TL-seq data from Tresenrider et al. 2021 visualized on IGV at the SWI4 locus.
Two timepoints are plotted including premeiotic before IME1 induction (pink) and meiotic prophase or after IME1 induction (blue).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Saccharomyces cerevisiae) | wild type | Amon lab | SK1 | see Supplementary file 4 for strain genotypes |
| Antibody | anti-V5 (Mouse monoclonal) | ThermoFisher Scientific | R960-25, RRID:AB_2556564 | 1:2000 |
| Antibody | anti-GFP (Mouse monoclonal) | Takara | 632381, RRID:AB_2313808 | 1:2000 |
| Antibody | anti-Hxk2 (Rabbit monoclonal) | US Biological | H2035-01, RRID:AB_2629457 | 1:20000 |
| Antibody | anti-mouse conjugated to IRDye 800CW (Mouse monoclonal) | LI-COR Biosciences | 926–32212, RRID:AB_621847 | 1:20000 |
| Antibody | anti-rabbit conjugated to IRDye 680CW (Rabbit monoclonal) | LI-COR Biosciences | 926–68071, RRID:AB_10956166 | 1:20000 |
| Antibody | anti-rabbit conjugated to IRDye 800CW (Rabbit monoclonal) | LI-COR Biosciences | 926–68073, RRID:AB_10954442 | 1:20000 |
| Antibody | anti-Swi4 (Rabbit polyclonal) | Andrews and Herskowitz, 1989 | 1:2000 | |
| Antibody | anti-Swi6 (Rabbit polyclonal) | Harris et al., 2013 | 1:2000 | |
| Antibody | anti-Mbp1 (Rabbit polyclonal) | Harris et al., 2013 | 1:2000 | |
| Recombinant DNA reagent | pUB595_pFA6a-FRB-KanMX6 | Haruki et al., 2008 | ||
| Recombinant DNA reagent | pUB1585_LEU2-pATG8-SWI4-linker-3V5 | This paper | contact Ünal lab to obtain plasmid | |
| Recombinant DNA reagent | pUB1587_LEU2-pSWI4(−1200––1)-SWI4-3V5-3′UTR | This paper | contact Ünal lab to obtain plasmid | |
| Recombinant DNA reagent | pUB1588_LEU2-pSWI4(−1200 to –934)Δ-SWI4-3V5-3′UTR (LUTI∆) | This paper | contact Ünal lab to obtain plasmid | |
| Recombinant DNA reagent | pUB1734_LEU2-pSWI4(ATG >ATC mutant)-SWI4-3V5-3’UTR (uORF∆) | This paper | contact Ünal lab to obtain plasmid | |
| Recombinant DNA reagent | pUB1899_HIS3-pATG8-CLN2-linker-3V5 | This paper | contact Ünal lab to obtain plasmid | |
| Recombinant DNA reagent | pUB2144_TRP1-pATG8-CLN1-linker-3V5 | This paper | contact Ünal lab to obtain plasmid | |
| Sequence-based reagent | 6852_CLN2_F | This paper | TCGTGTTACGGGACCAAGCC | |
| Sequence-based reagent | 6853_CLN2_R | This paper | TACGTGCCCTTGGGTTGGGA | |
| Sequence-based reagent | 6887_CLN1_F | This paper | ACGTCTCCATCCCCACAGGT | |
| Sequence-based reagent | 6888_CLN1_R | This paper | CGGACCCGCCGCAATAATGA | |
| Sequence-based reagent | 3301_PFY1_F | This paper | ACGGTAGACATGATGCTGAGG | |
| Sequence-based reagent | 3302_PFY1_R | This paper | ACGGTTGGTGGATAATGAGC | |
| Sequence-based reagent | 2081_IME1_F | This paper | TCACCACCGCCATCACTACA | |
| Sequence-based reagent | 2082_IME1_R | This paper | TGAAGGAGTAAGCCGCAGCA | |
| Sequence-based reagent | 6854_CDC21_F | This paper | TTGGCCGGTGATACAGACGC | |
| Sequence-based reagent | 6855_CDC21_R | This paper | ACGGGCCCCAGATCTCCTAC | |
| Sequence-based reagent | 6858_RNR1_F | This paper | ACCCTAGCGGCCAGAATTGC | |
| Sequence-based reagent | 6859_RNR1_R | This paper | CATGGGAGCGGGCTTACCAG | |
| Sequence-based reagent | 2598_ACT1_F | This paper | GTACCACCATGTTCCCAGGTATT | |
| Sequence-based reagent | 2599_ACT1_R | This paper | AGATGGACCACTTTCGTCGT | |
| Sequence-based reagent | 5429_SWI4LUTI_F | This paper | ACAAGGACTAAGAAGCACGTCA | |
| Sequence-based reagent | 5430_SWI4LUTI_R | This paper | ACCAATGCTAAAGGATGGCA | |
| Sequence-based reagent | 5918_3 V5_probe_F | Tresenrider et al., 2021 | CTAGTGGATCCAGGTAAACCTAT | |
| Sequence-based reagent | 2921_3 V5_probe_R | Tresenrider et al., 2021 | TAATACGACTCACTATAGGCCAGTCCTAATAGAGGATTAGG | |
| Commercial assay, kit | NEXTflexTM Rapid Directional mRNA-Seq Kit | Perkin Elmer | NOVA-5138 | |
| Commercial assay, kit | Prime-It II Random Primer Labeling Kit | Agilent Technologies, Inc | 300385 | |
| Commercial assay, kit | MinElute PCR Purification Kit | QIAGEN | 28004 | |
| Commercial assay, kit | MAXIscript T7 Transcription Kit | Thermo Fisher Scientific | AM1312 | |
| Commercial assay, kit | TURBO DNA-free Kit | Thermo Fisher Scientific | AM1907 | |
| Commercial assay, kit | Superscript III kit | Thermo Fisher Scientific | 18080044 | |
| Commercial assay, kit | HiFi DNA Assembly Master Mix | New England Biolabs | E2621 | |
| Commercial assay, kit | Absolute Blue qPCR Mix | ThermoFisher Scientific | AB4162B | |
| Software, algorithm | FIJI | Schindelin et al., 2012 | ||
| Software, algorithm | softWoRx, 6.5.2 | Cytiva | ||
| Software, algorithm | Hisat2 | Kim et al., 2019 | ||
| Software, algorithm | StringTie | Pertea et al., 2015 | ||
| Software, algorithm | DESeq2, v1.34.0 | Love et al., 2014 | ||
| Software, algorithm | Image Studio Lite | LI-COR | RRID:SCR_013715 | |
| Software, algorithm | GraphPad Prism | GraphPad Software | RRID:SCR_002798 | |
| Software, algorithm | GSEA, v4.3.2 | Subramanian et al., 2005 | ||
| Software, algorithm | Go Slim Mapper | SGD | ||
| Software, algorithm | smFISH quantification | Chen et al., 2017 | ||
| Other | Semiwet Transfer Buffer | Bio-Rad | 10026938 | transfer buffer for immunoblot |
| Other | Intercept (PBS) Blocking Buffer | LI-COR Biosciences | 927–70001 | blocking buffer for immunoblot |
| Other | ULTRAhyb Ultrasensitive Hybridization Buffer | Thermo Fisher Scientific | AM8669 | buffer for northern blot |
| Other | Amersham Hybond-N+ | Cytiva | RPN203B | membrane for northern blot |
| Other | NucAway Spin Columns | ThermoFisher Scientific | AM10070 | columns for northern blot |
| Other | AMPure XP beads | Beckman Coulter | A63881 | beads for library prep. |
| Other | High Sensitivity D1000 Reagents | Agilent | 5067–5585 | tape station reagent |
| Other | High Sensitivity D1000 ScreenTape | Agilent | 5067–5584 | tape station reagent |
| Other | DAPI | Sigma | D9564 | fluorescence microscopy |
| Other | Concanavalin A | Sigma | C7642 | fluorescence microscopy |
Additional files
-
Supplementary file 1
Differentially expressed genes (DESeq2) plotted in Figure 2F for pATG8-SWI4 (UB22226) vs wild type (UB22199).
- https://cdn.elifesciences.org/articles/90425/elife-90425-supp1-v2.xlsx
-
Supplementary file 2
Sporulation efficiency of cells at 24 hr in SPO media for Rec8-GFP (UB32085), Rec8-GFP; pATG8-SWI4 (UB32089).
200 cells counted per strain. Second table is sporulation efficiency of cells at 24 hr in SPO media for the following genotypes: wild type (UB22199), pATG8-CLN1 (UB32820), pATG8-CLN2 (UB25959), pCUP-GFP-IME1 (UB34641), pCUP1-GFP-IME1; pATG8-CLN2 (UB35057), PUS1-αGFP (UB35593), PUS1-αGFP; pATG8-CLN2 (UB35982), UME6-αGFP (UB35300), and UME6-αGFP; pATG8-CLN2 (UB35177).
- https://cdn.elifesciences.org/articles/90425/elife-90425-supp2-v2.docx
-
Supplementary file 3
Differentially expressed genes (DESeq2) plotted in Figure 6A, C and D.
First tab is WHI5-AA; ∆LUTI vs. wild type. Second tab is WHI5-AA vs. wild type. Third tab is ∆LUTI versus wild type.
- https://cdn.elifesciences.org/articles/90425/elife-90425-supp3-v2.xlsx
-
Supplementary file 4
The genotypes of the strains used in this study.
- https://cdn.elifesciences.org/articles/90425/elife-90425-supp4-v2.docx
-
Supplementary file 5
Plasmids used in this study.
- https://cdn.elifesciences.org/articles/90425/elife-90425-supp5-v2.docx
-
Supplementary file 6
Primers used for qPCR and RNA blotting in this study.
- https://cdn.elifesciences.org/articles/90425/elife-90425-supp6-v2.docx
-
Supplementary file 7
Image acquisition information.
- https://cdn.elifesciences.org/articles/90425/elife-90425-supp7-v2.docx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/90425/elife-90425-mdarchecklist1-v2.pdf
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Control of meiotic entry by dual inhibition of a key mitotic transcription factor
eLife 12:RP90425.
https://doi.org/10.7554/eLife.90425.3
