Human receptive endometrial assembloid for deciphering the implantation window
- Department of Obstetrics and Gynecology, Qilu Hospital of Shandong University, China
- State Key Laboratory of Reproductive Medicine and Offspring Health, Center for Reproductive Medicine, Institute of Women, Children and Reproductive Health, Shandong University, China
- Key Laboratory of Reproductive Endocrinology (Shandong University), Ministry of Education, China
- Research Unit of Gametogenesis and Health of ART-Offspring, Chinese Academy of Medical Sciences (No. 2021RU001), China
- Center for Clinical Reproductive Medicine, the First Affiliated Hospital of Nanjing Medical University, China
- Department of Obstetrics and Gynecology, Shandong Provincial Hospital, Shandong First Medical University, China
Figures
Figure 1 with 5 supplements
Developing receptive endometrial assembloids in vitro.
(A) Human endometrial assembloids constructed from adult stem cells were treated with expansion medium (ExM) (CTRL) or subjected to hormonal stimulation. Timeline of endometrial assembloid cultured by ExM (CTRL), ovarian steroid hormones simulating secretory phase (SEC), ovarian steroid hormones combining PRL and placental hormones to mimic the window of implantation (WOI). (B) Endometrial assembloids from the CTRL, SEC, and WOI groups, which were subjected to hormone treatment on Days 0, 2, and 8, exhibited comparable growth patterns throughout the culture period. Scale bar = 200 μm. (C) The dynamic changes of the counts of assembloids over time in each hormone regimen. (D) The dynamic changes of the area of assembloids over time in each hormone regimen. (E) Heatmap showing receptivity-related gene expression profile of assembloids in each hormone regimen. The color represents log-transformed fold change of gene expression. (F) Validation of receptivity markers (IGFBP1, MAOA, and DPP4) with immunofluorescence (IF) in the CTRL, SEC, and WOI endometrial assembloids in vitro. Nuclei were counterstained with DAPI. Scale bar = 30 μm. The bar chart displays the quantitative comparison of receptivity markers among three groups. *p≤0.05, **p≤0.005, ***p≤0.0005, ****p≤0.0001.n=4 (CTRL) and 5 (SEC and WOI) (IGFBP1), n=4 (MAO-A and DPP4).
Figure 1—figure supplement 1
Developing receptive endometrial assembloids in vitro.
(A) Brightfield of endometrial assembloids on day 2, day 4, and day 11. Scale bar = 200 μm. (B) Brightfield of endometrial assembloids in the primary generation (P0) and first generation (P1). Scale bar = 200 μm. (C) Screenshot of Figure 1—video 1 showing endometrial glands gradually developing into a vesicular shape, and the surrounding stromal cells arranging in a fibrous pattern in the CTRL endometrial assembloids (100 x, up-left) (The yellow arrows indicate stromal cells and the white arrows indicate endometrial glands). Screenshot of Figure 1—video 2 displaying the stromal cells growing in fibrous pattern and forming an extensive network in the CTRL endometrial assembloids (200 x, up-right) (The white arrows indicate stromal cells). The epithelial cells arrange like paving stones (middle and down, left). Stromal cells formed an extensive network (middle and down, right) (The arrowhead indicates stromal cells). Scale bar = 100 μm (middle), Scale bar = 50 μm (down). (D) Validation of epithelial, stromal cell, and endometrial gland markers (E-cadherin, vimentin and FOXA2, respectively) with immunofluorescence (IF) in the endometrium in vivo and CTRL endometrial assembloids in vitro. Nuclei were counterstained with DAPI. Scale bar = 40 μm. Periodic acid-Schiff staining (PAS) of endometrium in vivo and endometrial assembloid in vitro. Scale bar = 20 μm. (E) IF analysis of proliferation and apoptosis indicated by Ki67 and cleaved caspase-3 in the CTRL assembloids, respectively. Nuclei were counterstained with DAPI. Scale bar = 40 μm. (F) Verification of hormone responsiveness by the expression levels of ERα and PRA/B (E-cadherin indicated the marker of epithelial cell). Scale bar = 40 μm. ***p≤0.0005. n = 5, with 4–7 sections collected from each sample. (G) Relative expression of PGR, PAEP, EGR1, and OLFM4 in the CTRL and hormone-treated assembloids by RT-qPCR. *p≤0.05, **p≤0.005, ***p≤0.0005.n=3. (H) The dynamic changes of the average intensity of assembloids over time in each hormone regimen. (I) Periodic acid-schiff staining (PAS) of CTRL, secretory (SEC), and window of implantation (WOI) assembloids. PAS staining with diastase digestion was Negative CTRL. Scale bar = 20 μm. Quantitative comparison of glycogen staining area in the CTRL, SEC, and WOI assembloids. *p≤0.05, ****p≤0.0001.n = 5, with 5–6 sections collected from each sample. (J) Endometrial receptivity evaluation of endometrium and their derived WOI assembloids through Endometrial Receptivity Analysis (ERA). Asterisks indicate individual samples.
Figure 1—video 1
Representative video of the endometrial glands gradually developing into a vesicular shape, and the surrounding stromal cells arranging in a fibrous pattern in the endometrial assembloids, as imaged at 100 x by time-lapse microscopy of KEYENCE BZ-X800E over 72 hr.
Figure 1—video 2
Representative video of the stromal cells growing in fibrous pattern and forming an extensive network in the endometrial assembloids, as imaged at 200 x by time-lapse microscopy of KEYENCE BZ-X800E over 48 hr.
Figure 1—video 3
A representative video showing that the endometrial assembloids grew and differentiated, the endometrial glands enlarged, and surrounding stromal cells formed an extensive network during the control environment (CTRL), as imaged at 100 x by time-lapse microscopy of KEYENCE BZ-X800E over 8 days.
Figure 1—video 4
A representative video showing that the endometrial assembloids grew and differentiated, the endometrial glands enlarged, and surrounding stromal cells formed an extensive network during the hormone treatment (window of implantation, WOI), as imaged at 100 x by time-lapse microscopy of KEYENCE BZ-X800E over 8 days.
Figure 2 with 2 supplements
Receptive endometrial assembloids mimicked the implantation window endometrium.
(A) T-SNE plot of scRNA-seq data from three individual endometrial assembloids of the CTRL, secretory (SEC), and window of implantation (WOI) groups (left). T-SNE plot of combined scRNA-seq data from the three kinds of assembloids and mid-secretory endometrium (right). (B) Exhibition of stromal cells marked by vimentin of CTRL assembloid through whole-mount clearing, immunostaining, and light sheet microscopy imaging. Nuclei were counterstained with DAPI. The arrowhead indicates stromal cells. Scale bar = 40 μm (left), Scale bar = 30 μm (right). (C) Whole-mount immunofluorescence showed that Vimentin+ F-actin+ cells (stromal cells) were arranged around the glandular spheres that were only F-actin+. Scale bar = 50 μm. (D) Exhibition of immune cell marked by CD45 and CD44, and endometrial gland marked by FOXA2 of CTRL assembloid through whole-mount clearing, immunostaining and light sheet microscopy imaging. Nuclei were counterstained with DAPI. The arrowhead indicates immune cells. Scale bar = 50 μm (left), Scale bar = 10 μm (right). (E) Flow cytometric analysis of T cells and macrophages in the CTRL endometrial assembloid. Gating strategy used for determining white blood cells (WBC) (CD45+ cells), T cells (CD45+CD3+ cells), and macrophages (CD45+CD68+CD11b+ cells). (F) Electron micrograph of the CTRL (top), SEC (middle), and WOI (bottom) endometrial assembloid showing pinopodes (P), glycogen granule (asterisk), microvilli (white arrows), and cilia (orange arrows). Scale bar = 1 μm. Quantitative comparison of pinopodes, glycogen, microvilli, and cilia in the CTRL, SEC, and WOI assembloids. *p≤0.05, **p≤0.005, ***p≤0.0005, ****p≤0.0001. n = 5, with 2–8 sections collected from each sample (Pinopodes). n = 5, with 2–3 sections collected from each sample (Glucogen). n = 5, with 4–7 sections collected from each sample.n = 5, with 10–13 sections collected from each sample (Microvilli). n=3 (Cilia). (G) Heatmap and bubble diagram illustrating highly expressed genes as well as GO functions enriched in both assembloids during the WOI and mid-secretory endometrial tissue in terms of SOX9+ proliferative epithelium, stem-derived epithelium, secretory epithelium, proliferative epithelium, unciliated epithelium, stromal cells and epithelial-mesenchymal transition (EMT)-derived cells. The color of the heatmap represents log-transformed fold change of gene expression. (H) Heatmaps showing differentially expressed transcription factors (TFs) of endometrial assembloids and endometrium in the secretory epithelium (left) and EMT-derived cells (right). The color represents log-transformed fold change of gene expression.
Figure 2—figure supplement 1
Various functions are performed by all kinds of cells identified with scRNA-seq.
(A) Box plot of the gene numbers detected, unique molecular identifier (UMI) numbers, and ratios of mitochondrial gene expression in single cells of the CTRL, secretory (SEC), and window of implantation (WOI) groups. (B) Bubble diagram showing the distribution of marker gene expression in each cluster. (C–D) Comparison of cell composition between CTRL, SEC, WOI endometrial assembloids and mid-secretory endometrium demonstrating samples (Stephen R. Quake in 2020) (C) and cell types (D). (E–F) Comparison of cell composition between CTRL, SEC, WOI endometrial assembloids and mid-secretory endometrium demonstrating samples (Garcia-Alonso in 2021) (E) and cell types (F). (G) Bubble diagram and heatmap showing the corresponding upregulated genes and GO function of each cluster of endometrial cells. (H) Bubble diagram and heatmap showing corresponding upregulated genes and KEGG functions of SOX9+ proliferative epithelium, stem-derived epithelium, secretory epithelium, proliferative epithelium, stromal cells, ciliated epithelium and unciliated epithelium. Color is proportional to log-transformed fold change of gene expression. (I) GSEA between the SEC and WOI groups for proliferative epithelium. (J) The single-cell pseudotime trajectory of SOX9+ proliferative epithelium, secretory epithelium, and proliferative epithelium. Cells start at proliferative epithelium and progress to SOX9+ proliferative epithelium and secretory epithelium (left). There are seven major states over pseudotime (right). The black spot indicates the differentiation node between state 5 and state 6, indicating the direction from proliferative epithelium to SOX9+ proliferative epithelium and secretory epithelium, respectively. (K) (N) The horizontal axis is the pseudotime point, and the vertical axis is the gene expression level. The solid line represents states 1, 2, 4, and 5 corresponding to Fig. S2L (K) or Fig. S2O (N). Different colors represent samples in the CTRL, SEC, and WOI groups. (L) (O) Heatmap of genes at the branch node regulating differentiation into SOX9+ proliferative epithelium or secretory epithelium (L), and ciliated epithelium or unciliated epithelium (O). The horizontal axis is the pseudo-time point (the pseudo-time point gradually increases from the middle to both sides). The vertical axis is the gene expression level, representing two differential directions on the left and right sides. Clusters represent the gene sets with a similar branch gene expression trend. Different colors represent the level of gene expression. (M) Pseudotime trajectory of ciliated and unciliated epithelium. Cells start at ciliated epithelium and progress to unciliated epithelium (left). There are seven major states over pseudotime (right). The black spot indicates the differentiation node between state 5 and state 6, indicating the direction of ciliated and unciliated epithelium, respectively. Arrows indicate the direction of the pseudotime trajectory.
Figure 2—figure supplement 2
Receptive endometrial assembloids experienced epithelial-mesenchymal transition (EMT).
(A) GSEA between the secretory (SEC) and window of implantation (WOI) groups for proliferative epithelium. (B) The single-cell pseudotime trajectory of proliferative epithelium, stromal cell, EMT-derived cell and stem-derived epithelium. Cells start at proliferative epithelium and progress to EMT-derived cell. There are seven major states over pseudotime. The black spot indicates the differentiation node between states 4, 5 and 6, indicating the direction from proliferative epithelium to EMT-derived cell. Arrows indicate the direction of the pseudotime trajectory. (C) The horizontal axis is the pseudotime point, and the vertical axis is the gene expression level. The solid line represents states 1, 2, 4, and 5 corresponding to Fig. S4B. Different colors represent samples in the CTRL, SEC, and WOI groups. (D) Heatmap of genes at the branch node regulating differentiation into EMT-derived cell and stem-derived epithelium. The horizontal axis is the pseudo-time point (the pseudo-time point gradually increases from the middle to both sides). The vertical axis is the gene expression level, representing two differential directions on the left and right sides. Clusters represent the gene sets with a similar branch gene expression trend. Different colors represent the level of gene expression. (E–F) Dot plots demonstrating the Cellphone DB analysis of relevant receptors and ligands of EMT-derived cell (E) or stromal cell (F) with other cell types. The size of the dot represents the level of significance. The color of the dot indicates the mean of the average expression level of interacting molecule 1 in EMT-derived cells (E) or stromal cells (F) and molecule 2 in other cell types. (G) Proximity ligation assay (PLA) validating the interactions of SEMA3A-NRP1 and CD46-JAG1 in the CTRL, SEC and WOI assembloids. Red signals the interaction of two proteins. Nuclei were counterstained with DAPI. Scale bar = 20 μm.
Figure 3 with 2 supplements
Receptive endometrial assembloids recapitulate window of implantation (WOI)-associated hormone response.
(A) Principal component analysis (PCA) plot computed with differentially expressed genes in the bulk transcriptome of endometrial assembloids belonging to the CTRL, secretory (SEC), and WOI groups. (B) Heatmap showing that enrichment of differentially expressed genes for the terms of hormone response, monocarboxylic acid metabolism, lipid metabolism, and negative regulation of cell differentiation. The color represents log-transformed fold change of gene expression. (C) Responsiveness to progesterone and estrogen was evaluated by IF to PRA/B and OLFM4 with immunofluorescence (IF), respectively. Scale bar = 40 μm, **p≤0.005. n=3. (D) Exhibition of implantation marker (FOXO1) and endometrial gland marker (FOXA2) through combination of assembloid clearing, IF, and light sheet microscopy. Nuclei were counterstained with DAPI. **p≤0.005. n = 3, with 3–4 sections collected from each sample.(E) Bar graph exhibiting various percentages of each cell type in the three groups. (F) GSEA between the SEC and WOI groups for secretory epithelium. (G) Pseudotime trajectory showing the transformation between proliferative and secretory epithelium in the CTRL, SEC, and WOI groups. Arrows indicate the direction of the pseudotime trajectory. The black dot indicates the key differentiation node.
Figure 3—figure supplement 1
Comparisons between CTRL, secretory (SEC), and window of implantation (WOI) assembloids at the level of transcriptome and proteome.
(A) Venn diagram showing differential genes in pairs among the three groups. Log2 FC (Fold Change) > 1.2 or < –1.2, q value < 0.05. (B) Histogram showing pairwise comparison of differential gene expression (DEG) from bulk RNA-seq among the CTRL, SEC, and WOI groups. q value < 0.05, |logFC| > 1. (C) PCA plot computed with differentially expressed proteins in the micro proteomics of endometrial assembloids belonging to the CTRL, SEC, and WOI groups. (D) Venn diagram showing differential proteins in pairs among the three groups. Log2 FC > 1.2 or < –1.2, q value < 0.05. (E) Histogram showing pairwise comparison of differential proteins in microproteomics among the CTRL, SEC, and WOI groups. (F) Scatterplot depicting the correlation between the transcriptome and proteome as for the WOI group and CTRL group. For the transcriptome, FC > 2 and p value < 0.05 were defined as significantly upregulated. For the proteome, FC > 1.2 and p value < 0.05 were defined as significantly upregulated. (G) Circle diagram showing the functions of genes upregulated in both the transcriptome and proteome as for the WOI group compared to the CTRL group. (H) Verification of hypoxia response by the expression levels of HIF1α. Scale bar = 50 μm. *p≤0.05, **p≤0.005.n = 5, with 4–5 sections collected from each sample. (I) Verification of lipid metabolism by the expression levels of SLC25A1. Scale bar = 50 μm. ****p≤0.0001. n = 5, with 3–5 sections collected from each sample.
Figure 3—video 1
Representative video showing that three-dimensional imaging of the chemically cleared CTRL and window of implantation (WOI) assembloids, as imaged by light-sheet microscope to detect the expression of FOXO1 and FOXA2.
Figure 4
Receptive endometrial assembloids possess enhanced energy metabolism.
(A) The Mfuzz trend analysis displayed the transcriptional variation trends of five clusters from CTRL, secretory (SEC), and window of implantation (WOI) groups (with a focus on the differences between SEC and WOI assembloids). The heatmap illustrated the corresponding gene expression profile (where color represents Z-score). The bubble plot showed the associated GO functions (with bubble size representing the number of genes and bubble color indicating the p-value). (B) The circular heatmap illustrated the functional differences of SEC and WOI assembloids at the proteomic level. The color represents protein expression levels, and the innermost circle color represents GO functions. (C) Transmission electron microscopy images displayed the mitochondrial morphology of CTRL, SEC, and WOI assembloids, along with a quantitative comparison of mitochondrial area. Scale bar = 1 μm. n = 5, with 4–6 sections collected from each sample. (D) RT-qPCR assessed the expression levels of mitochondrial function-related genes in the three assembloid groups. n=3. (E) Quantitative comparison of the concentration of ATP (left) and IL8 (right) released by CTRL, SEC, and WOI assembloids. *p<0.05，**p<0.005，***p<0.0005，****p<0.0001.n=4 (ATP). n=6 (CTRL) and 7 (SEC and WOI) for IL8 .
Figure 5
Receptive endometrial assembloids increased the ciliary assembly and motility.
(A) The heatmap illustrated the expression of cilia-related genes across the CTRL, secretory (SEC), and window of implantation (WOI) assembloids. The color represents Z-score, while the leftmost block indicates various characteristic functions related to cilia. (B) RT-qPCR assessed the expression levels of cilia-related genes in the three assembloids. n=4. (C) The histogram showed the expression of cilia-related proteins in the three groups of assembloids. The color of the longitudinal protein names corresponds to the color of cilia-related functional blocks in Fig 5A. (D) IF analysis of cilia assembly marked by acetyl-α-tubulin. Nuclei were counterstained with DAPI. The arrowhead indicates cilia. Scale bar = 50 μm. n = 5, with 4–6 sections collected from each sample. (E) GSEA between the SEC and WOI groups for ciliated epithelium. (F) Pseudotime trajectory showing the transformation between ciliated and unciliated epithelium in the CTRL, SEC, and WOI groups. Arrows indicate the direction of the pseudotime trajectory. (G) Dot plots demonstrating the Cellphone DB analysis of relevant receptors and ligands of ciliated epithelium with other cell types. The size of the dot represents the level of significance. The color of the dot indicates the mean of the average expression level of interacting molecule 1 in ciliated epithelium and molecule 2 in other cell types. (H) Proximity ligation assay (PLA) validating the interactions of ROR2-Wnt5A and CD74-COPA in the CTRL, SEC, and WOI assembloids. Red signals the interaction of two proteins. Nuclei were counterstained with DAPI. Scale bar = 20 μm. *p<0.05，**p<0.005，***p<0.0005，****p<0.0001. n = 5, with 4–5 sections collected from each sample.
Figure 6
The receptive endometrial assembloids possess the potential for embryo implantation.
(A) Diagram illustrated the co-culture model of endometrial assembloids with blastoids (the blastoid stage corresponds to a 6 day post-fertilization human embryo, referred to as Day 6 here). mIVC1: modified In Vitro Culture Medium 1, mIVC2: modified In Vitro Culture Medium 2. (B) Bright-field images of the co-culture of CTRL, secretory (SEC), and window of implantation (WOI) assembloids with blastoids (Day 9) (yellow arrows indicate the blastoids). Scale bar = 100 μm. (C) Whole-mount fluorescence staining of Day 9 co-cultured embryoid and assembloid. OCT4 indicates the epiblast, GATA6 indicates the hypoblast, and KRT18 indicates the trophoblast. Scale bar = 40 μm and 20 μm (the rightmost image). (D) Comparison of the survival rates of Day 9 embryoids in CTRL, SEC, and WOI assembloids. n=6. (E) Comparison of the interaction ratios between Day 9 embryoids and endometrial assembloids in the CTRL, SEC, and WOI groups. *p<0.05, **p<0.005. n=6.
Figure 7
Schematic diagram displaying the establishment and validation of receptive endometrial assembloids, and summarizing the characteristic biological events of implantation-window endometrium.
Author response image 1
Whole-mount immunofluorescence showed that CD45+ cells (immune cells) were arranged around the glandular spheres that were FOXA2+.
Scale bar = 50 μm (left) and 30 μm (right).
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Biological sample (Homo sapiens) | Primary human endometrium | This paper | - | See Materials and methods |
| Antibody | E-Cadherin (4A2) (Mouse monoclonal) | Cell Signaling | Cat#:14472 RRID:AB_2728770 | IF (1:200) |
| Antibody | Vimentin (D21H3) XP (Rabbit monoclonal) | Cell Signaling | Cat#: 5741 S RRID:AB_10695459 | IF (1:200) |
| Antibody | Ki-67 (D3B5) (Rabbit monoclonal) | Cell Signaling | Cat#: 9129 RRID:AB_2687446 | IF (1:400) |
| Antibody | Cleaved Caspase-3 (Asp175) Antibody (Rabbit monoclonal) | Cell Signaling | Cat#: 9661 S RRID:AB_2341188 | IF (1:400) |
| Antibody | Progesterone Receptor A/B (D8Q2J) XP (Rabbit monoclonal) | Cell Signaling | Cat#: 8757 S RRID:AB_2797144 | IF (1:800) |
| Antibody | FoxO1 (D7C1H) (Mouse monoclonal) | Cell Signaling | Cat#:14952 S RRID:AB_2722487 | IF (1:100) |
| Antibody | Rabbit anti-FOXA2 (Rabbit monoclonal) | Abcam | Cat#: ab108422 RRID:AB_11157157 | IF (1:500) |
| Antibody | Anti-PDGF (Rabbit polyclonal) | Abcam | Cat#: ab23914 RRID:AB_2162180 | IF (1:160) |
| Antibody | Anti-Integrin alpha 5 (Rabbit monoclonal) | Abcam | Cat#: ab150361 RRID:AB_2631309 | IF (1:250) |
| Antibody | Anti-CD44 (Mouse monoclonal) | Abcam | Cat#: ab254530 RRID:AB_2885131 | IF (1:500) |
| Antibody | Anti-IGFBP1 (Rabbit polyclonal) | Abcam | Cat#: ab228741 RRID:AB_3665797 | IF (1:400) |
| Antibody | Mouse anti-Estrogen Receptor alpha (Mouse monoclonal) | Santa Cruz | Cat#: sc-8002 RRID:AB_627558 | IF (1:50) |
| Antibody | Neuropilin-2 antibody (Mouse monoclonal) | Santa Cruz | Cat#: sc-13117 RRID:AB_628044 | IF (1:50) |
| Antibody | TPPP antibody (Mouse monoclonal) | Santa Cruz | Cat#: sc-515819 RRID:AB_10611323 | IF (1:50) |
| Antibody | MAO-A (Mouse monoclonal) | Santa Cruz | Cat#: sc-271123 RRID:AB_10609510 | IF (1:50) |
| Antibody | Goat anti-Human DPPIV/CD26 (Goat polyclonal) | R&D Systems | Cat#: AF1180 RRID:AB_354651 | IF (1:100) |
| Antibody | HIF-1 alpha antibody (Mouse monoclonal) | NOVUS | Cat#: NB 100–105 RRID:AB_350048 | IF (1:50) |
| Antibody | Acetyl-α-tubulin (Mouse monoclonal) | Sigma | Cat#: T7451 RRID:AB_609894 | IF (1:20000) |
| Antibody | Anti-ODF2 antibody (Rabbit polyclonal) | Sigma | Cat#: HPA 048841 RRID:AB_1079522 | IF (1:100) |
| Antibody | SLC25A1 Polyclonal antibody (Rabbit polyclonal) | Proteintech | Cat#: 15235–1-AP RRID:AB_2254794 | IF (1:500) |
| Antibody | CD45 Monoclonal Antibody (30-F11) (Mouse monoclonal) | eBioscience | Cat#: 14-0451-81 RRID:AB_467250 | IF (1:100) |
| Antibody | Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor Plus 488 | Thermo | Cat#: A32766 RRID:AB_2762823 | IF (1:1000) |
| Antibody | Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor Plus 555 | Thermo | Cat#: A32773 RRID:AB_2762848 | IF (1:10000) |
| Antibody | Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor Plus 555 | Thermo | Cat#: A32794 RRID:AB_2762834 | IF (1:1000) |
| Antibody | Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor Plus 488 | Thermo | Cat#: A32790 RRID:AB_2762833 | IF (1:1000) |
| Antibody | Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor Plus 647 | Thermo | Cat#: A32795 RRID:AB_2762835 | IF (1:1000) |
| Antibody | Donkey anti-Goat IgG (H+L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor Plus 647 | Thermo | Cat#: A32849 RRID:AB_2762840 | IF (1:1000) |
| Antibody | Goat anti-Rat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo | Cat#: A11006 RRID:AB_2534074 | IF (1:500) |
| Antibody | BD Pharmingen PerCP-Cy5.5 Mouse Anti-Human CD45 (Mouse monoclonal) | BD Bioscience | Cat#: 564105 RRID:AB_2744405 | FACS (1:200) |
| Antibody | BD Horizon V450 Mouse Anti-Human CD3 (Mouse monoclonal) | BD Bioscience | Cat#: 560365 RRID:AB_1645570 | FACS (1:200) |
| Antibody | BD Horizon BV510 Mouse Anti-Human CD4 (Mouse monoclonal) | BD Bioscience | Cat#: 562970 RRID:AB_2744424 | FACS (1:200) |
| Antibody | APC/Cyanine7 anti-human CD8 Antibody (Mouse monoclonal) | Biolegend | Cat#: 344714 RRID:AB_2044006 | FACS (1:200) |
| Antibody | CD127 Monoclonal Antibody (eBioRDR5), Alexa Fluor 700 (Mouse monoclonal) | invitrogen | Cat#: 56-1278-42 RRID:AB_2637327 | FACS (1:200) |
| Antibody | Brilliant Violet 785 anti-human CD68 Antibody (Mouse monoclonal) | Biolegend | Cat#: 333825 RRID:AB_2800879 | FACS (1:200) |
| Antibody | Brilliant Violet 650 anti-human CD11b Antibody (Mouse monoclonal) | Biolegend | Cat#: 301335 RRID:AB_2562761 | FACS (1:200) |
| Antibody | SEMA3A antibody (C-1) (Mouse monoclonal) | Santa Cruz | Cat#: sc-74555 RRID:AB_2185394 | PLA (1:50) |
| Antibody | Recombinant Anti-Neuropilin 1 antibody [EPR3113] (Rabbit monoclonal) | Abcam | Cat#: ab81321 RRID:AB_1640739 | PLA (1:250) |
| Antibody | Recombinant Anti-ROR2 antibody [EPR19980] (Rabbit monoclonal) | Abcam | Cat#: ab218105 RRID not registered | PLA (1:500) |
| Antibody | Wnt-5a antibody (A-5) (Mouse monoclonal) | Santa Cruz | Cat#: sc-365370 RRID:AB_10846090 | PLA (1:50) |
| Antibody | Monoclonal Anti-CD74 antibody produced in mouse (Mouse monoclonal) | Sigma | Cat#: SAB5201932 RRID not registered | PLA (1:100) |
| Antibody | Recombinant Anti-alpha COP I/COPA Antibody [EPR14273(B)] (Rabbit monoclonal) | Abcam | Cat#: ab181224 RRID:AB_2893196 | PLA (1:50) |
| Antibody | CD46 antibody (M177) (Mouse monoclonal) | Santa Cruz | Cat#: sc-52647 RRID:AB_629109 | PLA (1:50) |
| Antibody | Jagged1 (28H8) Rabbit mAb (Rabbit monoclonal) | Cell Signaling | Cat#: 2620T RRID:AB_10693295 | PLA (1:1000) |
| Sequence-based reagent | PGR_F | This paper | PCR primers | ACCCGCCCTATCTCAACTACC |
| Sequence-based reagent | PGR_R | This paper | PCR primers | AGGACACCATAATGACAGCCT |
| Sequence-based reagent | PAEP_F | This paper | PCR primers | GAGATCGTTCTGCACAGATGG |
| Sequence-based reagent | PAEP_R | This paper | PCR primers | CGTTCGCCACCGTATAGTTGAT |
| Sequence-based reagent | OLFM4_F | This paper | PCR primers | ACCTTTCCCGTGGACAGAGT |
| Sequence-based reagent | OLFM4_R | This paper | PCR primers | TGGACATATTCCCTCACTTTGGA |
| Sequence-based reagent | ESR1_F | This paper | PCR primers | CCCACTCAACAGCGTGTCTC |
| Sequence-based reagent | ESR1_R | This paper | PCR primers | CGTCGATTATCTGAATTTGGCCT |
| Peptide, recombinant protein | Noggin | Proteintech | Cat. #: HZ-1118 | 100 ng/ml |
| Peptide, recombinant protein | EGF | Peprotech | Cat. #: AF-100–15 | 50 ng/ml |
| Peptide, recombinant protein | FGF2 | Origene | Cat. #: TP750002 | 100 ng/ml |
| Peptide, recombinant protein | WNT-3A | Proteintech | Cat. #: HZ-1296 | 200 ng/ml |
| Peptide, recombinant protein | R-Spondin-1 | Peprotech | Cat. #: 120–38 | 200 ng/ml |
| Peptide, recombinant protein | A83-01 | MCE | Cat. #: HY-10432 | 0.5 uM |
| Peptide, recombinant protein | p38 inhibitor SB202190 | Sigma | Cat. #: SB202190 | 10 uM |
| Peptide, recombinant protein | Human Chorionic Gonadotropin (HCG) | Livzon Pharmaceutical Group Inc | Cat. #: 2000 U | 1 μg/ml |
| Peptide, recombinant protein | Human Placental Lactogen (HPL) | R&D Systems | Cat. #: 5757-PL | 20 ng/ml |
| Peptide, recombinant protein | Prolactin | Peprotech | Cat. #: 100–07 | 20 ng/ml |
| Commercial assay or kit | Periodic acid-Schiff staining | Solarbio | Cat. #: G1280 | |
| Commercial assay or kit | RNeasy Micro Kit | Qiagen | Cat. #: 74004 | |
| Commercial assay or kit | Qubit High Sensitivity RNA Kit | Thermo Fisher Scientific | Cat. #: Q32855 | |
| Commercial assay or kit | gDNA wiper Mix | Vazyme | Cat. #: R323 | |
| Commercial assay or kit | HiScript III qRT SuperMix | Vazyme | Cat. #: R323 | |
| Commercial assay or kit | SYBR Green Premix Pro Taq HS qPCR Kit | Accurate Biotechnology (human) Co., Ltd | Cat. #: AG11701 | |
| Commercial assay or kit | Duolink PLA | Sigma | Cat. #: DUO92008, DUO82049 | |
| Commercial assay or kit | ATP Test Kit | Beyotime | Cat. #: S0026 | |
| Commercial assay or kit | Human IL-8/CXCL8 ELISA Kit | ABclonal | Cat. #: RK00011 | |
| Chemical compound, drug | Antibiotic-Antimycotic (100 X) | Gibco | Cat. #: 15240062 | 1% |
| Chemical compound, drug | ITS | Gibco | Cat. #: 41400–045 | 1% |
| Chemical compound, drug | L-Glutamine | Gibco | Cat. #: 25030–081 | 2 mM |
| Chemical compound, drug | Nicotinamide | Sigma | Cat. #: N3376 | 1 mM |
| Chemical compound, drug | B27 | Gibco | Cat. #: 17504–044 | 2% |
| Chemical compound, drug | N2 | Gibco | Cat. #: 17502–048 | 1% |
| Chemical compound, drug | N-acetyl-L-cysteine | Sigma | Cat. #: A7250 | 1.25 mM |
| Chemical compound, drug | Estradiol | Sigma | Cat. #: E2758 | 10 nM |
| Chemical compound, drug | Medroxyprogesterone Acetate | Selleck | Cat. #: S2567 | 1 μM |
| Chemical compound, drug | N6,2′-O-dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP) | Sigma | Cat. #: D0627 | 1 μM |
| Chemical compound, drug | ITS-X | Gibco | Cat. #: 51500–056 | 1x |
| Chemical compound, drug | β-estradiol | Sigma | Cat. #: E8875 | 8 nM |
| Chemical compound, drug | progesterone | Sigma | Cat. #: P0130 | 200 ng/ml |
| Chemical compound, drug | sodium lactate | Sigma | Cat. #: L7900 | 0.22% |
| Chemical compound, drug | Sodium pyruvate | Sigma | Cat. #: P4562 | 1 mM |
| Chemical compound, drug | Y27632 | Selleck | Cat. #: S1049 | 10 μM |
| Chemical compound, drug | defined fetal bovine serum | Biosera | Cat. #: bs-0003 | 20% |
| Chemical compound, drug | KOSR | Gibco | Cat. #: A3181501 | 30% |
| Software, algorithm | Monocle | Trapnell et al 62 | Version 2.10.1 | |
| Software, algorithm | CellphoneDB | Efremova M et al43 | Version 4 | |
| Software, algorithm | Imaris x64 | Oxford Instruments | version 10.0.1 | |
| Software, algorithm | Prism 9 | GraphPad | ||
| Other | DAPI | Biotechnology | Cat. #: C1002 | |
| Other | 0.25% trypsin | HyClone | Cat. #: SH30042.01 | |
| Other | Matrigel | Corning | Cat. #: 536231 | |
| Other | collagenase V | Sigma | Cat. #: C-9263 | |
| Other | dispase II | Sigma | Cat. #: D4693 | |
| Other | DNase I | Worthington | Cat. #: LS002139 | |
| Other | 40 µm cell strainer | Corning | Cat. #: 352340 |
Additional files
-
Supplementary file 1
Composition of medium.
Table A Composition of expansion medium (ExM) of endometrial assembloid. Table B Composition of hormone regimen of endometrial assembloid. Table C Composition of modified In Vitro Culture Medium (mIVC1 and mIVC2) for co-culture of blastoids and endometrial assembloids.
- https://cdn.elifesciences.org/articles/90729/elife-90729-supp1-v1.docx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/90729/elife-90729-mdarchecklist1-v1.docx
-
Source data 1
Clinical information of patients and lists of key genes and proteins for focused analysis.
- https://cdn.elifesciences.org/articles/90729/elife-90729-data1-v1.zip
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Human receptive endometrial assembloid for deciphering the implantation window
eLife 12:RP90729.
https://doi.org/10.7554/eLife.90729.5
