Figures and data in The mTOR pathway genes MTOR, Rheb, Depdc5, Pten, and Tsc1 have convergent and divergent impacts on cortical neuron development and function

Figures
Tables
Additional files

4 figures, 2 tables and 1 additional file

Figures

Figure 1 with 2 supplements

Download asset Open asset

Expression of *Rheb^Y35L, MTOR^S2215Y*, *Depdc5^KO*, *Pten^KO*, and *Tsc1^KO* leads to varying magnitudes of neuronal enlargement and mispositioning in the cortex.

(a) Diagram of the PI3K-mTORC1 pathway. Activation of mTOR complex 1 (mTORC1) signaling is controlled by positive (blue) and negative (purple) regulators within the pathway. (b) Diagram of overall experimental timeline and approach. in utero electroporation (IUE) was performed at E15.5. A cohort of animals was used for patch clamp recording at P26-51 and another cohort was used for histology at P28-43. (c) Representative images of tdTomato+ cells (red) and p-S6 staining (green) in mouse medial prefrontal cortex (mPFC) at P28-43. (d) Quantification of p-S6 staining intensity (normalized to the mean control) in tdTomato+ neurons. (e) Quantification of tdTomato+ neuron soma size. (f) Representative images of tdTomato+ neuron (red) placement and distribution in coronal mPFC sections. Red square on the diagram denotes the imaged area for all groups. CC, corpus callosum. (g) Quantification of tdTomato+ neuron placement in layer 2/3. Left diagram depicts the approach for analysis: the total number of tdTomato+ neurons within layer 2/3 (white square) was counted and expressed as a % of total neurons in the imaged area. Right bar graphs show the quantification. (h) Quantification of tdTomato+ neuron distribution across cortical layers. Left diagram depicts the approach for analysis: the imaged area was divided into 10 equal-sized bins across the cortex, spanning the corpus callosum to the pial surface (white grids); the total number of tdTomato+ neurons within each bin was counted and expressed as a % of total neurons in the imaged area. Right bar graphs show the quantification. For graphs (**d, e**): n=4–8 mice per group, with 6–15 cells analyzed per animal. For graphs (**g, h**): n=3–7 mice per group, with 1 brain section analyzed per animal. Statistical comparisons were performed using (**d, e**) nested one-way ANOVA (fitted to a mixed-effects model) to account for correlated data within individual animals, (g) one-way ANOVA, or (h) two-way repeated measures ANOVA. Post-hoc analyses were performed using Holm-Šídák multiple comparison test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. All data are reported as the mean of all neurons or brain sections in each group ± SEM.

Figure 1—source data 1 Summary statistics for Figure 1.: https://cdn.elifesciences.org/articles/91010/elife-91010-fig1-data1-v1.docx
Download elife-91010-fig1-data1-v1.docx

Figure 1—figure supplement 1

Download asset Open asset

Distribution of p-S6 staining intensity and neuron soma size among individual animals at P28-43.

(a) Distribution of p-S6 staining intensity among individual animals. (b) Distribution of neuron soma size among individual animals.

Figure 1—figure supplement 2

Download asset Open asset

Neuron soma sizes at P7-9.

(a) Representative images of tdTomato+ cells (red) in mouse medial prefrontal cortex (mPFC) at P7-9. (b) Quantification of tdTomato+ neuron soma size. (c) Graph showing the distribution of neuron soma size among individual animals in each group. n=3–8 mice per group, with 30 cells analyzed per animal. Statistical comparisons were performed using a nested t-test (control vs. *MTOR^S2215Y*) or nested one-way ANOVA (control vs. *Depdc5^KO* vs. *Pten^KO*, vs. *Tsc1^KO*) (fitted to a mixed-effects model) to account for correlated data within individual animals. Post-hoc analyses were performed using Holm-Šídák multiple comparison test. *p<0.05, ***p<0.001, ****p<0.0001. Data are reported as the mean of all neurons in each group ± SEM.

Figure 1—figure supplement 2—source data 1 Summary statistics for Figure 1—figure supplement 2.: https://cdn.elifesciences.org/articles/91010/elife-91010-fig1-figsupp2-data1-v1.docx
Download elife-91010-fig1-figsupp2-data1-v1.docx

Figure 2 with 1 supplement

Download asset Open asset

Expression of *Rheb^Y35L, MTOR^S2215Y*, *Depdc5^KO*, *Pten^KO*, and *Tsc1^KO* universally leads to decreased depolarization-induced excitability, but only *Rheb^Y35L, MTOR^S2215Y*, and *Tsc1^KO* expression leads to depolarized resting membrane potentials (RMPs).

(a) Diagram of experimental approach for whole-cell patch clamp recording. Recordings were performed in layer 2/3 pyramidal neurons in acute coronal slices from P26-51 mice, expressing either control, *Rheb^Y35L, MTOR^S2215Y*, *Depdc5^KO*, *Pten^KO*, or *Tsc1^KO* plasmids. (**b–d**) Graphs of membrane capacitance, resting membrane conductance, and RMP. (e) Representative traces of the action potential (AP) firing response to a 300 pA depolarizing current injection. (f) Input-output curves show the mean number of APs fired in response to 500 ms-long depolarizing current steps from 0 to 400 pA. Arrows point to initial spike doublets. (**g–k**) Graphs of rheobase, first ISI, AP threshold, AP peak amplitude, and AP half-width. For all graphs: n=5–10 mice per group, with 16–50 cells analyzed per animal. Statistical comparisons were performed using (**b–d, g–k**) nested one-way ANOVA (fitted to a mixed-effects model) to account for correlated data within individual animals or (f) mixed-effects ANOVA accounting for repeated measures. Post-hoc analyses were performed using Holm-Šídák multiple comparison test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, for the input-output curves in (f): *p<0.05 (vs. control), #<0.05 (vs. *Depdc5^KO*), Ɏp<0.05 (vs. *Tsc1^KO*). All data are reported as the mean of all neurons in each group ± SEM.

Figure 2—source data 1 Summary statistics for Figure 2.: https://cdn.elifesciences.org/articles/91010/elife-91010-fig2-data1-v1.docx
Download elife-91010-fig2-data1-v1.docx

Figure 2—figure supplement 1

Download asset Open asset

Distribution of membrane and action potential (AP) properties among individual animals at P26-51.

(**a–c**) Distribution of membrane capacitance, conductance, and resting membrane potential (RMP) among individual animals. (**d-h**) Distribution of rheobase, first ISI, AP threshold, AP peak amplitude, and AP half-width among individual animals.

Figure 3 with 3 supplements

Download asset Open asset

Expression of *Rheb^Y35L, MTOR^S2215Y*, *Depdc5^KO*, *Pten^KO*, and *Tsc1^KO* leads to the abnormal presence of HCN4 channels with variations in functional expression.

(a) Representative images of tdTomato+ cells (red) and HCN4 staining (green) in mouse medial prefrontal cortex (mPFC) at P28-43. (b) Quantification of HCN4 intensity (normalized to the mean control) in tdTomato+ neurons. (c) Representative current traces in response to a series of 3 s-long hyperpolarizing voltage steps from –120 to –40 mV, with a holding potential of –70 mV. Current traces from the –40 and –50 mV steps were not included due to contamination from unclamped Na⁺ spikes. Orange lines denote the current traces at –90 mV. (d) IV curve obtained from I_ss amplitudes. (e) ΔIV curve obtained from I_h amplitudes (i.e. ΔI, where ΔI=I_ss – I_inst). (f) Graphs of I_h amplitudes at –90 mV. (g) Representative current traces in response to a series of 3 s long hyperpolarizing voltage steps from –110 mV to –50 mV in the *MTOR^S2215Y* condition pre- and post-zatebradine application. Orange lines denote the current traces at –90 mV. (h) IV curve obtained from I_ss amplitudes in the *MTOR^S2215Y* condition pre- and post-zatebradine application. (i) ΔIV curve obtained from I_h amplitudes (i.e. ΔI) in the *MTOR^S2215Y* condition pre- and post-zatebradine application. Arrow points to the post-zatebradine I_h amplitude at –90 mV. (j) Representative traces of the zatebradine-sensitive current obtained after subtraction of the post- from the pre-zatebradine current traces in response to –110 mV to –50 mV voltage steps. Orange lines denote the current traces at –90 mV. (k) IV curve of the zatebradine-sensitive current obtained after subtraction of the post- from the pre-zatebradine current traces. (l) Graph of RMP in the control and *MTOR^S2215Y* conditions pre- and post-zatebradine application. Connecting lines denote paired values from the same neuron. For graph (b): n=4–8 mice per group, with 4–15 cells analyzed per animal. For graphs **d, e, f**: n=5–10 mice per group, with 24–47 cells analyzed per animal. For graphs **h, i, k, l**: n=4–6 neurons (paired). Statistical comparisons were performed using (**b, f**) nested ANOVA (fitted to a mixed-effects model) to account for correlated data within individual animals, (**d, e**) mixed-effects ANOVA accounting for repeated measures, or (**h, i, l**) two-way repeated measures ANOVA. Post-hoc analyses were performed using Holm-Šídák multiple comparison test. *p<0.05, **p<0.01, ****p<0.0001, for the IV curves in **d, e, h, i**: *p<0.05 (vs. control), #p<0.05 (vs. *Rheb^Y35L* or *Depdc5^KO*), Ɏp<0.05 (vs. *Pten^KO*). All data are reported as the mean of all neurons in each group ± SEM.

Figure 3—source data 1 Summary statistics for Figure 3.: https://cdn.elifesciences.org/articles/91010/elife-91010-fig3-data1-v1.docx
Download elife-91010-fig3-data1-v1.docx

Figure 3—figure supplement 1

Download asset Open asset

Distribution of HCN4 staining intensity and hyperpolarization-activated cation current (I_h) amplitudes (at –90 mV) among individual animals at P28-43 and P26-51, respectively.

(a) Distribution of HCN4 staining intensity among individual animals. (**d-g**) Distribution of I_h amplitudes (at –90 mV) among individual animals.

Figure 3—figure supplement 2

Download asset Open asset

Additional images of HCN4 staining in medial prefrontal cortex (mPFC) sections from P28-43 mice expressing *MTOR^S2215Y*.

(a) Representative images of tdTomato+ cells (red) and HCN4 staining (green). Top panels show overlay images. Bottom panels show HCN4 single-channel images. (a1) and (a2) show the ipsilateral and contralateral cortex, respectively. (a3) and (a4) are high-magnification images demonstrating HCN4 staining within the cell. (b) Representative images of immunostaining with (left) or without (right) HCN4 primary antibodies (control for secondary antibody specificity).

Figure 3—figure supplement 3

Download asset Open asset

BaCl₂ application decreases overall inward currents without affecting hyperpolarization-activated cation current (I_h) in *Tsc1^KO* neurons.

(a) Representative current traces in response to a series of 3 s long hyperpolarizing voltage steps from –130 mV to –40 mV in the *Tsc1^KO* condition pre- and post-BaCl₂ application. Orange lines denote the current traces at –90 mV. (b) IV curve obtained from I_ss amplitudes in the *Tsc1^KO* condition pre- and post-BaCl₂ application. (c) IV curve obtained from I_h amplitudes (i.e. ΔI, where ΔI=I_ss – I_inst) in the *Tsc1^KO* condition pre- and post-BaCl₂ application. (d) Representative traces of the BaCl₂-sensitive current obtained after subtraction of the post- from the pre-BaCl₂ current traces. Orange lines denote the current traces at –90 mV. (e) IV curve of the BaCl₂ -sensitive current obtained after subtraction of the post- from the pre-BaCl₂ current traces. The isolated BaCl₂-sensitive current reversed near –80 mV. (f) Graph of conductances (at –500 pA) in the control and *Tsc1^KO* conditions pre- and post-BaCl₂ application. Connecting lines denote paired values from the same neuron. (g) Graph of % change in conductances pre- and post-BaCl₂ application in the control and *Tsc1^KO* conditions. (h) Graph of resting membrane potential (RMP) in the control and *Tsc1^KO* conditions pre- and post-BaCl₂ application. Connecting lines denote paired values from the same neuron. (i) Graph of % change in RMP pre- and post-BaCl₂ application in the control and *Tsc1^KO* conditions. For all graphs: n=10–13 neurons per group. Statistical comparisons were performed using (**b, c, e**) mixed-effects ANOVA, (**f, h**) two-way repeated measures ANOVA, or (**g, i**) unpaired t-test. Post-hoc analyses were performed using Holm-Šídák multiple comparison test. *p<0.05, **p<0.01, ****p<0.0001. All data are reported as the mean of all neurons or brain sections in each group ± SEM.

Figure 3—figure supplement 3—source data 1 Summary statistics for Figure 3—figure supplement 3.: https://cdn.elifesciences.org/articles/91010/elife-91010-fig3-figsupp3-data1-v1.docx
Download elife-91010-fig3-figsupp3-data1-v1.docx

Figure 4 with 1 supplement

Download asset Open asset

Expression of *Rheb^Y35L, MTOR^S2215Y*, *Depdc5^KO*, *Pten^KO*, and *Tsc1^KO* leads to different impacts on spontaneous excitatory postsynaptic current (sEPSC) properties.

(a) Representative sEPSC traces were recorded at a holding voltage of –70 mV. Top and bottom traces are from the same neuron. (**b–d**) Graphs of sEPSC frequency, amplitude, and total charge. For all graphs: n=5–9 mice per group, with 17–34 cells analyzed per animal. Statistical comparisons were performed using a nested ANOVA (fitted to a mixed effects model) to account for correlated data within individual animals. Post-hoc analyses were performed using Holm-Šídák multiple comparison test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. All data are reported as the mean of all neurons in each group ± SEM.

Figure 4—source data 1 Summary statistics for Figure 4.: https://cdn.elifesciences.org/articles/91010/elife-91010-fig4-data1-v1.docx
Download elife-91010-fig4-data1-v1.docx

Figure 4—figure supplement 1

Download asset Open asset

Distribution of spontaneous excitatory postsynaptic current (sEPSC) properties among individual animals at P26-51.

(**a–c**) Distribution of sEPSC properties among individual animals.

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Strain, strain background (Mus musculus)	CD1, wildtype (time-pregnant females)	Charles River Laboratories	Strain code: 022, RRID:IMSR_CRL:022	For in utero electroporation
Recombinant DNA reagent	pCAG-tdTomato (plasmid)	Addgene	Plasmid #83029, RRID:Addgene_83029	Deposited by Dr. Angelique Bordey (previously generated by our lab)
Recombinant DNA reagent	pCAG-GFP (plasmid)	Addgene	Plasmid #11150, RRID:Addgene_11150	Deposited by Dr. Connie Cepko
Recombinant DNA reagent	pCAG-tagBFP (plasmid)	Dr. Joshua Breunig, PMID:22776033	-	Gift from Dr. Joshua Breunig. The generation of this plasmid has previously been described (Breunig et al., 2012).
Recombinant DNA reagent	pCAG-Rheb^Y35L-T2A-tdTomato (plasmid)	This paper	-	The Rheb insert was synthesized and subcloned into a pCAG-Kir2.1Mut-T2A-tdTomato construct (Addgene plasmid #60644) via SmaI and BamHI sites, after excision of Kir2.1. Rheb insert sequence: NM_053075.3 (Mus musculus), mutation: Y35L
Recombinant DNA reagent	pCAG-MTOR^S2215Y (plasmid)	This paper	-	The MTOR insert was subcloned from a pcDNA3-FLAG-mTOR-SS2215Y construct (Addgene plasmid #69013) into a pCAG-tdTomato construct (Addgene plasmid #83029) via 5’AgeI and 3’NotI sites, after excision of tdTomato. MTOR insert sequence: NM_004958 (Homo sapiens), mutation: S2215Y
Recombinant DNA reagent	pX330-Control (pX330-empty) (plasmid)	Addgene	Plasmid #42230, RRID:Addgene_42230	Deposited by Dr. Feng Zhang
Recombinant DNA reagent	pX330-Depdc5 (plasmid)	Dr. Stéphanie Baulac, PMID:29708508	-	Gift from Dr. Stéphanie Baulac. The gRNA sequence (gRNA1) has previously been validated (Ribierre et al., 2018). gRNA sequence (5’ to 3’): GTCTGTGGTGATCACGC (17 nt) The gRNA targets exon 16 of Depdc5 (NM_001025426, Mus musculus), resulting in deleterious indels and inactivation of the gene
Recombinant DNA reagent	pX330-Pten (plasmid)	Addgene	Plasmid #59909, RRID:Addgene_59909	Deposited by Dr. Tyler Jacks. The gRNA sequence (gRNA1) has previously been validated (Xue et al., 2014). gRNA sequence (5’ to 3’): AGATCGTTAGCAGAAACAAA (20 nt) The gRNA targets Pten (NM_008960, Mus musculus), resulting in deleterious indels and inactivation of the gene
Recombinant DNA reagent	pX330-Tsc1 (plasmid)	This paper	-	The gRNA sequence was synthesized based on previously published sequences (Lim et al., 2017) and subcloned into a pX330-empty vector. The specificity of the gRNA (gRNA T4) has previously been described and validated (Lim et al., 2017). gRNA sequence (5’ to 3’): CAGTGTGGAGGAGTCCAGCA (20 nt) The gRNA targets exon 3 of Tsc1 (NM_001289575, Mus musculus), resulting in deleterious indels and inactivation of the gene
Antibody	anti-p-S6 S240/244 (rabbit monoclonal)	Cell Signaling Technology	Cat # 5364, RRID:AB_10694233	IF (1:1000)
Antibody	anti-HCN4 (rabbit polyclonal)	Alomone Labs	Cat # APC-052, RRID:AB_2039906	IF (1:500)
Antibody	goat anti-rabbit IgG, Alexa Fluor Plus 647	Invitrogen	Cat # A32733, RRID:AB_2633282	IF (1:500)
Software, algorithm	Image J	NIH	RRID:SCR_003070	-
Software, algorithm	Photoshop	Adobe	RRID:SCR_014199	Version CC
Software, algorithm	pClamp	Molecular Devices	RRID:SCR_011323	Version 10
Software, algorithm	Prism	GraphPad Software	RRID:SCR_002798	Version 9

Table 1

Plasmid concentrations for control and experimental conditions.

Group	Plasmid name	Plasmid concentration (µg/µl)*
Control (for Rheb^Y35L littermates)†	pCAG-tdTomato	3.5
Control (for MTOR^S2215Y littermates)†	pCAG-GFP	2.5
	pCAG-tdTomato	1.0
Rheb^Y35L	pCAG-Rheb^Y35L-T2A-tdTomato	2.5
Rheb^Y35L	pCAG-GFP	1.0
MTOR^S2215Y	pCAG-MTOR^S2215Y	2.5
MTOR^S2215Y	pCAG-tdTomato	1.0
Control	pX330-Control	2.5
	pCAG-tdTomato	1.0
	pCAG-tagBFP‡	0.5
Depdc5^KO	pX330-Depdc5	2.5
	pCAG-tdTomato	1.0
	pCAG-GFP‡	0.5
Pten^KO	pX330-Pten	2.5
	pCAG-tdTomato	1.0
	pCAG-GFP‡	0.5
Tsc1^KO	pX330-Tsc1	2.5
	pCAG-tdTomato	1.0
	pCAG-GFP‡	0.5

*

Working plasmid solutions were diluted in water and contained 0.03% Fast Green dye to visualize the injection. For each embryo, 1.5 µl of the plasmid mixture was injected into the right ventricle.
†

Control groups for Rheb^Y35L and MTOR^S2215Y contained pCAG tdTomato and pCAG-GFP +pCAG-tdTomato, respectively, to distinguish between control and experimental animals for each litter. The total plasmid concentration was kept equal between the two control groups. No differences were observed between the two groups, and therefore, they were combined into one control group.
‡

Equal concentrations of pCAG-tagBFP and pCAG-GFP were added into the control and experimental (Depdc5^KO, Pten^KO, and Tsc1^KO) groups, respectively, to distinguish the control and experimental animals for each litter.

Additional files

MDAR checklist: https://cdn.elifesciences.org/articles/91010/elife-91010-mdarchecklist1-v1.pdf
Download elife-91010-mdarchecklist1-v1.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Mendeley

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Lena H Nguyen
Youfen Xu
Maanasi Nair
Angelique Bordey

(2024)

The mTOR pathway genes MTOR, Rheb, Depdc5, Pten, and Tsc1 have convergent and divergent impacts on cortical neuron development and function

eLife 12:RP91010.

https://doi.org/10.7554/eLife.91010.3

Figures

Expression of Rheb^Y35L, MTOR^S2215Y, Depdc5^KO, Pten^KO, and Tsc1^KO leads to varying magnitudes of neuronal enlargement and mispositioning in the cortex.

Figure 1—source data 1

Distribution of p-S6 staining intensity and neuron soma size among individual animals at P28-43.

Neuron soma sizes at P7-9.

Figure 1—figure supplement 2—source data 1

Expression of Rheb^Y35L, MTOR^S2215Y, Depdc5^KO, Pten^KO, and Tsc1^KO universally leads to decreased depolarization-induced excitability, but only Rheb^Y35L, MTOR^S2215Y, and Tsc1^KO expression leads to depolarized resting membrane potentials (RMPs).

Figure 2—source data 1

Distribution of membrane and action potential (AP) properties among individual animals at P26-51.

Expression of Rheb^Y35L, MTOR^S2215Y, Depdc5^KO, Pten^KO, and Tsc1^KO leads to the abnormal presence of HCN4 channels with variations in functional expression.

Figure 3—source data 1

Distribution of HCN4 staining intensity and hyperpolarization-activated cation current (I_h) amplitudes (at –90 mV) among individual animals at P28-43 and P26-51, respectively.

Additional images of HCN4 staining in medial prefrontal cortex (mPFC) sections from P28-43 mice expressing MTOR^S2215Y.

BaCl₂ application decreases overall inward currents without affecting hyperpolarization-activated cation current (I_h) in Tsc1^KO neurons.

Figure 3—figure supplement 3—source data 1

Expression of Rheb^Y35L, MTOR^S2215Y, Depdc5^KO, Pten^KO, and Tsc1^KO leads to different impacts on spontaneous excitatory postsynaptic current (sEPSC) properties.

Figure 4—source data 1

Distribution of spontaneous excitatory postsynaptic current (sEPSC) properties among individual animals at P26-51.

Tables

Plasmid concentrations for control and experimental conditions.

Additional files

MDAR checklist

Download links

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Be the first to read new articles from eLife

Share this article

Cite this article

Expression of RhebY35L, MTORS2215Y, Depdc5KO, PtenKO, and Tsc1KO leads to varying magnitudes of neuronal enlargement and mispositioning in the cortex.

Figure 1—source data 1

Distribution of p-S6 staining intensity and neuron soma size among individual animals at P28-43.

Neuron soma sizes at P7-9.

Figure 1—figure supplement 2—source data 1

Expression of RhebY35L, MTORS2215Y, Depdc5KO, PtenKO, and Tsc1KO universally leads to decreased depolarization-induced excitability, but only RhebY35L, MTORS2215Y, and Tsc1KO expression leads to depolarized resting membrane potentials (RMPs).

Figure 2—source data 1

Distribution of membrane and action potential (AP) properties among individual animals at P26-51.

Expression of RhebY35L, MTORS2215Y, Depdc5KO, PtenKO, and Tsc1KO leads to the abnormal presence of HCN4 channels with variations in functional expression.

Figure 3—source data 1

Distribution of HCN4 staining intensity and hyperpolarization-activated cation current (Ih) amplitudes (at –90 mV) among individual animals at P28-43 and P26-51, respectively.

Additional images of HCN4 staining in medial prefrontal cortex (mPFC) sections from P28-43 mice expressing MTORS2215Y.

BaCl2 application decreases overall inward currents without affecting hyperpolarization-activated cation current (Ih) in Tsc1KO neurons.

Figure 3—figure supplement 3—source data 1

Expression of RhebY35L, MTORS2215Y, Depdc5KO, PtenKO, and Tsc1KO leads to different impacts on spontaneous excitatory postsynaptic current (sEPSC) properties.

Figure 4—source data 1

Distribution of spontaneous excitatory postsynaptic current (sEPSC) properties among individual animals at P26-51.

Plasmid concentrations for control and experimental conditions.

MDAR checklist

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Expression of Rheb^Y35L, MTOR^S2215Y, Depdc5^KO, Pten^KO, and Tsc1^KO leads to varying magnitudes of neuronal enlargement and mispositioning in the cortex.

Expression of Rheb^Y35L, MTOR^S2215Y, Depdc5^KO, Pten^KO, and Tsc1^KO universally leads to decreased depolarization-induced excitability, but only Rheb^Y35L, MTOR^S2215Y, and Tsc1^KO expression leads to depolarized resting membrane potentials (RMPs).

Expression of Rheb^Y35L, MTOR^S2215Y, Depdc5^KO, Pten^KO, and Tsc1^KO leads to the abnormal presence of HCN4 channels with variations in functional expression.

Distribution of HCN4 staining intensity and hyperpolarization-activated cation current (I_h) amplitudes (at –90 mV) among individual animals at P28-43 and P26-51, respectively.

Additional images of HCN4 staining in medial prefrontal cortex (mPFC) sections from P28-43 mice expressing MTOR^S2215Y.

BaCl₂ application decreases overall inward currents without affecting hyperpolarization-activated cation current (I_h) in Tsc1^KO neurons.

Expression of Rheb^Y35L, MTOR^S2215Y, Depdc5^KO, Pten^KO, and Tsc1^KO leads to different impacts on spontaneous excitatory postsynaptic current (sEPSC) properties.