The proteolysis of ZP proteins is essential to control cell membrane structure and integrity of developing tracheal tubes in Drosophila
- Research Group Molecular Organogenesis, Department of Molecular Developmental Biology, Max Planck Institute for Multidisciplinary Sciences, Germany
- Cell biology, Institute for Biology, Leipzig University, Germany
- Facility for electron microscopy, Max Planck Institute for Multidisciplinary Sciences, Germany
Figures
Figure 1 with 2 supplements
Pio supports structural continuity of the apical cell membrane.
(A) Model implicates the axial and longitudinal forces (arrows) acting apical on cell membrane and extracellular matrix of stage (st) 16 embryos when tracheal lumen expands in growing tubes. (B) …
-
Figure 1—source data 1
Bulge-like gaps between the Mega-marked cell membrane and apical matrix in stage 17 embryos.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig1-data1-v1.zip
-
Figure 1—source data 2
Bulge-like gaps between the Mega-marked cell membrane and apical matrix in stage 17 embryos.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig1-data2-v1.zip
-
Figure 1—source data 3
Uif marked unusual apical cell membrane deformations at the dorsal trunk in stage 16 embryos and quantification.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig1-data3-v1.zip
Figure 1—figure supplement 1
Generation and ultrastructure analysis of pio mutant embryos.
(A) Generation of three independent pio mutant alleles which lack all relevant protein domains. Schema of CRISPR/Cas9-mediated mutagenesis to generate frame shift mutations in the 5' region of the …
Figure 1—figure supplement 2
Cell membrane deformations in pio mutant embryos.
(A) Confocal images of wt and pio mutant stage 15 embryos. The lateral membrane of dorsal trunks is marked with Megatrachea (Mega; red, arrows), and transmission light visualizes the tracheal cells …
Figure 2 with 2 supplements
Pio localization depends on the apical membrane and supports tracheal air-filling.
Shown are stage 16 embryos. Maximum intensity projections of confocal Z-stacks are shown in A, single confocal images in B, and Airyscan microscopy in C–E. Scale bars indicate 10 µm. (A) Pio protein …
-
Figure 2—source data 1
Quantification of Pio distribution across the dorsal trunks in different stress situations in stage 16 embryos.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig2-data1-v1.zip
Figure 2—figure supplement 1
Tube luminal matrix and Pio turnover in tracheal cells.
(A) Confocal images of Pio and Crb in control and shrub mutant embryos and analyzed with the ZEN co-localization tool (lower panel, co-localization is indicated with white puncta). Pio is shown in …
Figure 2—figure supplement 2
Pio localization in mega mutant and Cht2 overexpressing embryos.
(A) 3D images (upper panel in A) of dorsal trunks of airyscan Z-stacks show Pio (red), Uif (blue), and chitin (chitin-binding probe; green). Lower panels in A show 3D visualization of Imaris …
Figure 3 with 2 supplements
Pio is required for taenidial fold morphology and airway gas-filling.
(A) Airyscan images (left) and orthogonal (middle) and 3D projections (right) of control and pio mutant late-stage 16 embryos. cbp (in green and gray) detects chitin at the taenidial folds and …
-
Figure 3—source data 1
Pattern of taenidial folds in stage 16 embryos.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig3-data1-v1.zip
-
Figure 3—source data 2
Quantification of tracheal air-filling in stage 17 embryos.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig3-data2-v1.zip
Figure 3—figure supplement 1
CRISPR-Cas9-mediated pio mutagenesis and caused phenotypes and mCherry:Pio generation and expression.
(A) The stage 17 pio loss-of-function embryos are able to clear chitin-matrix proteins from tracheal tube lumina, as indicated by Obst-A (red), Knk (red), and WGA (blue) stainings. Shown are …
Figure 3—figure supplement 2
Localization of chitin-matrix proteins in pio mutant embryos.
Confocal images and maximum intensity projections (3D) of pio loss-of-function (right) mutant stage 16 embryos and heterozygous control siblings (left).Yellow arrows point to luminal staining; white …
Figure 4 with 1 supplement
Apical polarity and AJs localization in pio and Np mutant embryos.
Confocal LSM Z-stacks of tracheal dorsal trunk show single layer (A) and 3D projections (B, C) of stage 16 and 17 embryos. (A) Control and pio mutant late-stage 16 embryos show Crb (red) staining at …
-
Figure 4—source data 1
Pattern of adherens junctions in dorsal trunk fusion cells in stage 16 pio mutant embryo and quantifications.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig4-data1-v1.zip
-
Figure 4—source data 2
Pattern of adherens junctions in dorsal trunk fusion cells in stage 16 Np mutant embryos.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig4-data2-v1.zip
-
Figure 4—source data 3
Quantification of pattern of adherens junctions in dorsal trunk fusion cells.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig4-data3-v1.zip
Figure 4—figure supplement 1
Tubulin and F-actin show normal distribution in pio null mutant embryos.
(A) Confocal images show tubulin in red staining and chitin (cbp) in blue. Single tubulin channels are indicated in gray below. Arrows point to cortical enrichment of tubulin in dorsal trunk cells …
Figure 5 with 5 supplements
Pio is dynamically localized at the membrane and controls Dumpy secretion.
(A) Confocal LSM images of dorsal trunks of embryos with endogenous mCherry:: Pio expression stained with anti-mCherry antibody (magenta) and cbp (chitin; green) at indicated embryonic stages. In …
-
Figure 5—source data 1
Confocal Z-stack images of dorsal trunk showing mCherry::Pio expression during stages 16 and 17 of embryogenesis.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig5-data1-v1.zip
-
Figure 5—source data 2
Confocal Z-stack images of dorsal trunk showing mCherry::Pio expression during late stages 16.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig5-data2-v1.zip
-
Figure 5—source data 3
Confocal Z-stack images of dorsal trunk showing mCherry::Pio expression during early stage 17.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig5-data3-v1.zip
-
Figure 5—source data 4
Confocal Z-stack images of dorsal trunk showing mCherry::Pio expression during mid stage 17.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig5-data4-v1.zip
-
Figure 5—source data 5
Confocal Z-stack images of dorsal trunk showing Dpy::YFP expression in control and pio mutant embryos.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig5-data5-v1.zip
-
Figure 5—source data 6
Confocal Z-stack images of dorsal trunk showing Dpy::YFP expression in pio mutant embryos.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig5-data6-v1.zip
-
Figure 5—source data 7
Uncropped western blots.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig5-data7-v1.pdf
Figure 5—figure supplement 1
The mCherry::Pio shows localization at the apical cell surface and in the tube lumen.
(A) Confocal images of cbp (chitin, green) and Crb (red) antibody stainings in stage 16 embryos analyzed with the ZEN profile tool. The cbp stained chitin of taenidial folds overlap with Crb, which …
Figure 5—figure supplement 2
Pio is involved in Dpy secretion and Notopleural and Matriptase activity controls Pio localization.
(A) Confocal images of single or co-expression of FLAG-tagged Pio, and RFP-tagged Dpy C-terminal region (ZPD domain, transmembrane domain, cytoplasmic region) in the Drosophila S2R+ (Schneider) …
Figure 5—figure supplement 3
Tracheal phenotypes and Pio mislocalization in dpy mutant embryos Airyscan images (left), orthogonal (middle) and 3D projections (right) of of late-stage 16 dpyolvr mutant embryos (n=8).
(A) Dorsal view of dorsal trunks tubes. Chitin (cbp) is visualized in green (left) and gray (middle) and Pio antibody staining in red and gray (right). The mutant embryo showed characteristic dorsal …
Figure 5—video 1
Confocal time-lapse movie of endogenously expressed Dpy::eYFP (magenta) and mCherry::Pio (green) in wt.
The wt shows tracheal Pio and Dumpy localization in the dorsal trunk from stage 16 until mid of stage 17. The mCherry::Pio dynamic trafficking reveals ongoing secretion, apical localization, and …
Figure 5—video 2
Representative confocal time-lapse movie of a fluorescence recovery after photobleaching (FRAP) experiment in a wt control embryo with endogenous expression of Dpy::eYFP (green) and mCherry::Pio (magenta).
The bleached area is indicated by a white box. The first frame is before bleaching and subsequent images were obtained every 2 min as indicated in the middle panel. mCherry::Pio shows fast recovery …
Figure 6 with 3 supplements
Np-mediated ZP domain shedding controls Pio dynamics at the apical cell membrane.
(A) Left: Immunoblot of protein lysates from embryos of stages 16 and 17 stained with anti-mCherry antibody show three specific bands in samples from mCherry::Pio expressing embryos. Middle: …
-
Figure 6—source data 1
Confocal Z-stack images of dorsal trunk showing mCherry::Pio expression in Np mutant embryos during stages 16 and 17.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig6-data1-v1.zip
-
Figure 6—source data 2
Confocal Z-stack images of dorsal trunk showing mCherry::Pio expression in Np mutant late stage 16 embryo.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig6-data2-v1.zip
-
Figure 6—source data 3
Confocal Z-stack images of dorsal trunk showing mCherry::Pio expression in Np mutant early stage 17 embryo.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig6-data3-v1.zip
-
Figure 6—source data 4
Confocal Z-stack images of dorsal trunk showing mCherry::Pio expression in Np mutant mid stage 17 embryo.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig6-data4-v1.zip
-
Figure 6—source data 5
Confocal Z-stack images of dorsal trunk showing mCherry::Pio expression in flz mutant embryos during stages 16 and 17.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig6-data5-v1.zip
-
Figure 6—source data 6
Confocal Z-stack images of dorsal trunk showing mCherry::Pio expression in flz mutant stage 17 embryo.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig6-data6-v1.zip
-
Figure 6—source data 7
Uncropped western blots (Figure 6A).
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig6-data7-v1.pdf
-
Figure 6—source data 8
Uncropped western blots (Figure 6B).
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig6-data8-v1.pdf
Figure 6—figure supplement 1
The tracheal expression and localization of the serine protease Filzig (Flz).
(A) The flz allele includes YFP coding sequence (green box) flanked by splice acceptor (SA) and donor (SD) sites. (B) Bright-field microscopy of stainings of in situ RNA hybridization of DIG-labeled …
Figure 6—video 1
In Np mutant embryo, mCherry::Pio foci are visible intracellularly as in wt, but almost no mCherry::Pio is detectable in the tracheal lumen.
After bleaching, mCherry::Pio shows no recovery in the lumen and only minor intracellular recovery compared to wt. Dumpy:eYFP showed no recovery after bleaching, similar to wt embryos. The scale bar …
Figure 6—video 2
Confocal time-lapse movie of endogenously expressed Dpy::eYFP (magenta) and mCherry::Pio (green) in Np mutant embryo.
The wt shows tracheal Pio and Dumpy localization in the dorsal trunk from stage 16 until mid of stage 17. The mCherry::Pio dynamic trafficking reveals ongoing secretion, apical localization, and …
Figure 7 with 1 supplement
Np supports structural cell membrane integrity.
(A) Bulge-like tracheal apical membrane deformations appeared in Np mutant embryos as stable structures that grow during late stage 16. Confocal images of dorsal trunks of wt embryos and NpP6/NpC2 …
-
Figure 7—source data 1
Quantification and confocal Z-stack images of bulges at dorsal trunks of Np mutant embryos.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig7-data1-v1.zip
-
Figure 7—source data 2
Quantification of bulges at dorsal trunks of Np mutant embryos.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig7-data2-v1.zip
Figure 7—figure supplement 1
Tracheal expression of myr-RFP in Np mutant embryos.
Confocal images of btl-Gal4-driven expression of UAS-myr-RFP in stage 17 Np mutant embryos. Antibody stainings show RFP (red) and chitin (cbp; green) in mid to late (left to right) stage 17 embryos. …
Figure 8 with 1 supplement
Pio and Np control tube size and their regulatory mechanisms of ZP domain shedding is conserved.
(A) Confocal Z-stack projections of whole-mount stage 16 embryos stained with cbp (chitin) focusing on the tracheal system and close-ups at the right. In contrast to straight branches of control …
-
Figure 8—source data 1
Quantification of dorsal trunks lengths.
- https://cdn.elifesciences.org/articles/91079/elife-91079-fig8-data1-v1.zip
Figure 8—figure supplement 1
Np controls Pio shedding into the tube lumen during tube expansion.
(A) Z-stack Airsycan projection of dorsal trunks of stages 14, 15, and 16 btl-G4-driven UAS-Np embryos. In stages 14 and 15, Pio shows luminal staining predominantly at the chitin cable. Upon Np …
Figure 9
Model of apical Pio and Dpy matrix at the apical cell surface and Pio proteolysis and release.
(A) The simplified model shows a Pio-mediated Dpy secretion, the apical ZP domain protein matrix formation, and subsequent Pio ectodomain shedding by Np at wt tracheal cells. In pio null mutant …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Mouse, anti-Crb, monoclonal | DSHB | Cq4 | 1:10 |
| Antibody | Mouse anti-Flag, monoclonal | Merck | F3165 | 1:500 |
| Antibody | Mouse anti-Gasp/Obst-C, monoclonal | DSHB | 2A12 | 1:5 |
| Antibody | Chicken anti-GFP, polyclonal | Abcam | ab13970 | 1:1000 |
| Antibody | Rabbit anti-GFP, polyclonal | Synaptic Systems132003 | 132003 | IF: 1:500 WB: 1:10,000 CIF: 1:1000 |
| Antibody | Rabbit anti-Knk, polyclonal | Moussian et al., 2006 | Moussian | 1:50 |
| Antibody | Mouse anti-Mega, monoclonal | Jaspers et al., 2012 | Schuh | 1:50 |
| Antibody | Rabbit anti-mCherry, polyclonal | Rockland | 600-401P16 | IF: 1:500 WB: 1:10,000 |
| Antibody | Rabbit anti-Obst-A, polyclonal | Petkau et al., 2012 | Behr | 1:50 |
| Antibody | Rabbit anti-Pio, polyclonal | Jaźwińska et al., 2003 | Affolter | 1:100 |
| Antibody | Rabbit anti-Serp, polyclonal | Luschnig et al., 2006 | Luschnig | 1:50 |
| Antibody | Rabbit anti-Spalt, polyclonal | Kühnlein et al., 1994 | Schuh | 1:25 |
| Antibody | Mouse anti-α-Spectrin, monoclonal | DSHB | 3A9 | 1:10 |
| Antibody | Anti-Strep-HRP, mouse monoclonal | IBA | 1-1509-001 | 1:10,000 |
| Antibody | Mouse anti-β-Tubulin, monoclonal | DSHB | E7 | 1:100 |
| Antibody | Guinea pig ani-Uif, polyclonal | Zhang and Ward, 2009 | Ward | 1:100 |
| Antibody | Rabbit anti-Verm, polyclonal | Luschnig et al., 2006 | Luschnig | 1:50 |
| Antibody | Donkey anti-goat Alexa488, polyclonal | Dianova | 705-545-003 | 1:400 |
| Antibody | Donkey anti-guinea pig Cy3, polyclonal | Dianova | 706-165-148 | 1:400 |
| Antibody | Donkey anti-mouse Alexa647, polyclonal | Dianova | 715-605-020 | 1:400 |
| Antibody | Donkey anti-mouse Alexa647, polyclonal | Dianova | 715-605-020 | 1:400 |
| Antibody | Donkey anti-rabbit Cy3, polyclonal | Dianova | 711-167-003 | 1:400 |
| Antibody | Donkey anti-rabbit-AlexaFluor488, polyclonal | Thermo Fisher Scientific | A-11034 | 1:500 |
| Antibody | Donkey anti-rabbit-AlexaFluor568, polyclonal | Thermo Fisher Scientific | A-21069 | 1:500 |
| Antibody | Goat anti-mouse-HRP, polyclonal | Thermo Fisher Scientific | G-21040 | WB: 1:10,000 |
| Antibody | Goat anti-rabbit-HRP, polyclonal | Thermo Fisher Scientific | Thermo Fisher ScientificG-21234 | 1:10,000 |
| Reagent | WGA, Alexa Flour 633 | Invitrogen | W21404 | 1:100 |
| Reagent | Cbp, Alexa488 | New England Biolabs | 1:200 | |
| Reagent | Phalloidin- PromoFluor-488 | PromoKine, VWR | PROMOPK-PF488P-7 | 1:75 |
| Genetic reagent | btl-Gal4 | Bloomington Drosophila Stock Center (BDSC) | ||
| Genetic reagent | crb2 (crb11A22) | BDSC | Stock ID 3448 | https://flybase.org/reports/FBal0001817.html |
| Genetic reagent | dpyolvR/SM5 | BDSC | Stock ID 280 | https://flybase.org/reports/FBal0002971#phenotypic_data_sub |
| Genetic reagent | Dumpy::eYFP [CPTI-001769] | Lye et al., 2014 | Sanson | |
| Genetic reagent | megaG0012/FM7, act-GFP | Behr et al., 2003 | Schuh; U Schäfer | |
| Genetic reagent | shrub4/Cyo | Dong et al., 2014 | Hayashi | |
| Genetic reagent | w1118 | BDSC | https://flybase.org/reports/FBal0018186.html | |
| Genetic reagent | w*; mCherry::pio/CyO, dfd-eYFP | This manuscript | Drees | Generation as described in the supplement, available from MB |
| Genetic reagent | w*; flzC1 | This manuscript | Drees | Generation as described in the supplement, available from MB |
| Genetic reagent | w*; flzC1, mCherry::pio/CyO, dfd-eYFP | This manuscript | Drees | Generation as described in the supplement, available from MB |
| Genetic reagent | w1118;PBac{681 .P.FSVS-1}flzCPTI001902 | Kyoto Stock Center | Stock ID 115246 | https://flybase.org/reports/FBti0143804 |
| Genetic reagent | w*; pio5M/CyO, dfd-eYFP | This manuscript | Drees | Generation as described in the supplement, available from MB |
| Genetic reagent | w*; pio17C/CyO, dfd-eYFP | This manuscript | Dress | Generation as described in the supplement, available from MB |
| Genetic reagent | w*; NpP6/CyO, dfd-eYFP | Drees et al., 2019 | Drees | Available from MB |
| Genetic reagent | w*; NpP6, P{Gal4-btl}/CyO, dfd-eYFP | Drees et al., 2019 | Drees | Available from MB |
| Genetic reagent | w*; NpC2, P{UAS-NpS990A}/CyO, dfd-eYFP | Drees et al., 2019 | Drees | Available from MB |
| Genetic reagent | w*; NpC2/CyO, dfd-eYFP; P{UASp-GFPS65C-alphaTub84B}3/TM3, Sb1 | Drees et al., 2019 | Drees | Available from MB |
| Genetic reagent | w*; NpP6, mCherry::pio/CyO, dfd-eYFP | Drees et al., 2019 | Drees | Available from MB |
| Genetic reagent | w*; P{UAS-NpS990A}/P{UAS-NpS990A} | Drees et al., 2019 | Drees | Available from MB |
| Genetic reagent | w*; P{UAS-Np}/P{UAS-Np} | Drees et al., 2019 | Drees | Available from MB |
| Genetic reagent | wurst162/FM7-actin-GFP | Behr et al., 2007 | Behr | Available from MB |
| Genetic reagent | UAS-Cht2 | Tonning et al., 2005 | Uv | |
| Genetic reagent | w[1118]; P{w[+mC]=UAS-myr-mRFP}1 | BDSC | Stock ID 7118 | https://flybase.org/reports/FBst0007118.html |
| Genetic reagent | UAS-wurst-RNAi | Stümpges and Behr, 2011 | VDRC | |
| Cell line (D. melanogaster) | S2R+ cells | Drees et al., 2019 | DGRC | https://flybase.org/reports/FBtc0000150.html#:~:text = S2R%2B%20is%20an%20isolate%20of,to %20the%20original%20S2%20line.&text = S2R%2B%20is%20an%20isolate%20of%20S2 %20that%20has%20receptors%20for%20wg%20signalling. |
| Cell line (D. melanogaster) | Kc167 | Drees et al., 2019 | DGRC | https://flybase.org/reports/FBtc0000001.html |
| Sequence-based reagent | pio-sgRNA-sense | Eurofins Genomic | CTTCGATTGGGACACCGAGCCACT | |
| Sequence-based reagent | pio-sgRNA-antisense | Eurofins Genomics | AAACAGTGGCTCGGTGTCCCAATC | |
| Sequence-based reagent | flz-sgRNA-sense | Eurofins Genomics | CTTCGTGGGTTACGCCGG CCTCAA | |
| Sequence-based reagent | flz-sgRNA-antisense | Eurofins Genomics | AAACTTGAGGCCGGCGTA ACCCAC | |
| Sequence-based reagent | UAS-mCherry::pio-for | Eurofins Genomics | GAATTCATGAAGACAGGCACTCGAATGGACGCTTTCCACACGGCGCTGCACTTAATCACAATCGCAGCTCTGACGACG | |
| Sequence-based reagent | UAS-mCherry::pio-rev | Eurofins Genomics | CTCGAGGCCGCCTTTGTAAAGCTCATCC | |
| Sequence-based reagent | Pio-5’-HA1-for | Eurofins Genomics | ACTAGTCCGAATTCGCAGG TGATTATCGCCTCTCGGCC ATCAG | |
| Sequence-based reagent | Pio-5’-HA1-rev | Eurofins Genomics | AAGCTTCTTTAATTAAAGG GGAAATTTCG | |
| Sequence-based reagent | Pio-5’-HA2-for | Eurofins Genomics | ACTAGTGGCAAGCTTACTG GCGATGGATTAGGCC | |
| Sequence-based reagent | Pio-5’-HA2-rev | Eurofins Genomics | CACCTGCGATCTTAATCTT GCCAGCGTCTGTC | |
| Sequence-based reagent | Pio-3’-HA-for | Eurofins Genomics | TTAAGGAAGAGCACACAG TTGGGCGCTTTGTTAGTCG | |
| Sequence-based reagent | Pio-3’-HA-rev | Eurofins Genomics | CGGGGAAGAGCGACGAGA TTGCGCCGGAAAATAAG | |
| Sequence-based reagent | UAS-pio-ORF-for | Eurofins Genomics | CTCGAGCCAACGGCAATGAAAGATGCCC | |
| Sequence-based reagent | UAS-pio-ORF-rev | Eurofins Genomics | TCTAGATTAGCTGCTGTGCGAGAAG | |
| Sequence-based reagent | Dpy-ZP-for | Eurofins Genomics | GCTTTACAAAGGTTACACGGGTAATCCG | |
| Sequence-based reagent | Dpy-CT-for | Eurofins Genomics | GCTTTACAAAGGTGGAAATGCCAGGATTG | |
| Sequence-based reagent | Dpy-CTZP-rev | Eurofins Genomics | GTGGAGCCGGCCACCATTTATGGAGGTTTC | |
| Sequence-based reagent | Dpy-ZP-for | Eurofins Genomics | GGCCACCATTTATGGAGGTTTC | |
| Sequence-based reagent | Dpy-ZP-rev | Eurofins Genomics | GGTTCCTTCACAAAGATCCTTTAGGATATGTAATCCGGCG | |
| Sequence-based reagent | Strep::TGFBR3::GFP1-for | Eurofins Genomics | CTGAATAGGGAATTGGGAATTCATGACTTCCCATTATG | |
| Sequence-based reagent | Strep::TGFBR3::GFP1-rev | Eurofins Genomics | CACCGCTGCCACCTCCTGATCCGCCACCCTTTTCAAACTGCGGATGACTCCATGCACTTTGCACCTCTTCTGGCTCTC | |
| Sequence-based reagent | Strep::TGFBR3::GFP2-for | Eurofins Genomics | ATCAGGAGGTGGCAGCGGTGGAAGTGCATGGAGCCATCCCCAATTCGAGAAGGGGAGCGTGGATATTGCCCTG | |
| Sequence-based reagent | Strep::TGFBR3::GFP2-rev | Eurofins Genomics | TCACCATACCGCCGCTAGCGGCCGTGCTGCTGCTG | |
| Plasmid | pJet1.2 | Thermo Fisher Scientific | ||
| Plasmid | pUAST | GAL4/UAS-mediated overexpression; Brand and Perrimon, 1993 | ||
| Plasmid | pBFv-U6.2 | Expression of single sgRNA; Kondo and Ueda, 2013 | ||
| Plasmid | pBFv-U6.2B | Expression of two sgRNAs; Kondo and Ueda, 2013 | ||
| Plasmid | pHD-ScarlessDsRed | Scarless genome editing via HDR | DGRC | |
| Plasmid | actin5C-Gal4 | Expression of Gal4 in cultured cells; Usui et al., 1999 | ||
| Software, algorithm | Clustal omega algorithm | https://www.ebi.ac.uk/Tools/msa/clustalo/ | ||
| Software, algorithm | DNASTAR software suite | Lasergene Software | Lasergene Software | |
| Software, algorithm | Flybase | https://www.flybase.org | https://www.flybase.org | BLASTP algorithm |
| Software, algorithm | Huygens professional | SVI | 20.10 | |
| Software, algorithm | Illustrator | Adobe | CS6 | https://www.adobe.com |
| Software, algorithm | Imaris 9.7.2 | Oxford Instruments | Oxford Instruments | https://imaris.oxinst.com/ |
| Software, algorithm | NetOGlyc | DTU Health Tech | https://services.healthtech.dtu.dk/ | |
| Software, algorithm | Office 365 (Word, Excel) | Microsoft | Microsoft | https://www.microsoft.com |
| Software, algorithm | ProP | DTU Health Tech | https://services.healthtech.dtu.dk/ | |
| Software, algorithm | SignalP | DTU Health Tech | https://services.healthtech.dtu.dk | |
| Software, algorithm | Photoshop CS6 | Adobe | CS6 | https://www.adobe.com |
| Software, algorithm | SMART | EMBL | EMBL | |
| Software, algorithm | Serial Cloner | Serial basics | 2.6.1 | |
| Software, algorithm | TMHMM 2.0 algorithm | DTU Health Tech | https://services.healthtech.dtu.dk/ | |
| Software, algorithm | ZEN 2.3 | Zeiss | Zeiss | 2.3, black |
