Antibody | AF647 (mouse monoclonal) Anti-Human CD34 (clone 581) | Cedarlane | 343508 | 1:200 |
Antibody | V450 (mouse monoclonal) Anti-Human CD45RA (clone HI100) | BD Biosciences | 560362 | 1:100 |
Antibody | PE-CF594 (mouse monoclonal) Anti-Human CD90 (clone 5E10) | BD Biosciences | 562385 | 1:200 |
Antibody | FITC anti-human, CD49c (Clone REA360) | Miltenyi | 130-105-364 | 1:50 |
Genetic reagent (AAV2/6) | Custom AAV6 – pssAAV_SRSF2P95H | Canadian Neurophotonics Platform – Viral Vector Core | Custom AAV | See annotated sequences in Supplementary file 2 |
Genetic reagent (AAV2/6) | Custom AAV6 – pssAAV_SF3B1 K700E | Canadian Neurophotonics Platform – Viral Vector Core | Custom AAV | See annotated sequences in Supplementary file 2 |
Biological sample (Homo sapiens) | Human Cord Blood for CD34 + cells harvest | Héma Québec via St Justine hospital | NA | |
Cell line (Mus musculus) | M210B4 expressing human IL-3 and G-CSF | Gift from Connie J Eaves | NA | *special request |
Cell line (Mus musculus) | sl/sl mouse fibroblasts expressin human SCF and IL-3 | Gift from Connie J Eaves | NA | *special request |
Cell line (Mus musculus) | sl/sl mouse fibroblasts expressin human FLT3L | Gift from Connie J Eaves | NA | *special request |
Chemical compound, drug | UM 171 | ExcellThera | NA | *special request |
Chemical compound, drug | RS-1 | Cedarlane | 21037–5 | |
Chemical compound, drug | Nedisertib (M3814) | Cedarlane | A17055 | |
Chemical compound, drug | AZD 7648 | Cedarlane (Cayman) | 28598–1 | |
Chemical compound, drug | DIMETHYL SULFOXIDE (DMSO), Sterile | BioShop | DMS666.100 | |
Chemical compound, drug | Hydrocortisone | BioShop | HYD400.5 | |
Chemical compound, drug | 1 M buffer | Homemade | Homemade | |
Commercial assay, kit | PLATINUM SUPERFI II MASTER MIX | Life Technologies | 12368050 | |
Commercial assay, kit | StemSpan CC100 | STEMCELL Technologies | 2690 | |
Commercial assay, kit | MyeloCult H5100 | STEMCELL Technologies | 05150 | |
Commercial assay, kit | Blunt/TA Ligase Master Mix | NEB | M0367S | |
Commercial assay, kit | NEBNext Quick Ligation Module | NEB | E6056S | |
Commercial assay, kit | NEBNext Ultra II End Repair/dA-Tailing Module | NEB | E7546S | |
Commercial assay, kit | EasySep Human CD34 Positive Selection Kit II | STEMCELL Technologies | 17896 | |
Commercial assay, kit | MethoCult H4034 Optimum | STEMCELL Technologies | 4034 | |
Commercial assay, kit | Flongle Sequencing Expansion | Oxford Nanopore | FLO-FLG114 | |
Commercial assay, kit | Flongle Flow Cell (R10.4.1) | Oxford Nanopore | FLO-FLG114 | |
Commercial assay, kit | Native Barcoding Kit 24 V14 | Oxford Nanopore | SQK-NBD114.24 | |
Commercial assay, kit | FBS Canadien | Thermo | 12483020 | |
Commercial assay, kit | RPMI1640 | LifeTech | 11875119 | |
Commercial assay, kit | StemSpan SFEM II | STEMCELL Technologies | 9655 | |
Peptide, recombinant protein | Alt-R S.p. Cas9 Nuclease V3, 500 µg | IDT | 1081058 | |
Peptide, recombinant protein | T7 Endonuclease I - 250 units | NEB | M0302S | |
Peptide, recombinant protein | Proteinase K, Molecular Biology Grade | NEB | P8107S | |
Peptide, recombinant protein | Alt-R Cas9 Electroporation Enhancer, 2 nmol | IDT | 1075915 | |
Peptide, recombinant protein | BspEI Enzyme | NEB | R0540S | |
Peptide, recombinant protein | IL-3, Human (CHO-expressed), 100 ng/ul | Cedarlane (GeneScript) | Z02991-10 | |
Peptide, recombinant protein | SCF, Human (P. pastoris-expressed), 100 ng/ul | Cedarlane (GeneScript) | Z02692-10 | |
Peptide, recombinant protein | EPO 100 ng/ul (~16 IU/uL) | Cedarlane (GeneScript) | Z02975-10 | |
Peptide, recombinant protein | Flt-3L 100 ng/ul | Cedarlane (GeneScript) | Z02926-10 | |
Peptide, recombinant protein | GM-CSF, Human (CHO-expressed), 100 ng/uL | Cedarlane (GeneScript) | Z02983-10 | |
Peptide, recombinant protein | IL-6, Human (CHO-expressed), 100 ng/uL | Cedarlane (GeneScript) | Z03134-50 | |
Peptide, recombinant protein | G-CSF, Human (CHO-expressed), 100 ng/uL | Cedarlane (GeneScript) | Z02980-10 | |
Peptide, recombinant protein | CellAdhere Type I Collagen, Bovine, Solution | STEMCELL Technologies | 7001 | |
Recombinant DNA reagent | p53 siRNA id s605 | Thermo | 4390824 | |
Sequence-based reagent | SRSF2_gRNA1 | IDT | /AlTR1/rCrGrGrCrUrGrUrG rGrUrGrUrGrArGrUrCrCr GrGrGrUrUrUrUrArGrAr GrCrUrArUrGrCrU/AlTR2/ | crRNA SRSF2 |
Sequence-based reagent | pri0077-F | IDT | AGCGATATAAACGGGCGCAG | Outer PCR SRSF2 |
Sequence-based reagent | pri0077-R | IDT | TCGCGACCTGGATTTGGATT | Outer PCR SRSF2 |
Sequence-based reagent | pri0002-H3 | IDT | CTATGGATGCCATGGACGGG | Inner PCR SRSF2 |
Sequence-based reagent | pri0002-H4 | IDT | CAAGCACAGCGGGGTTAATTC | Inner PCR SRSF2 |
Sequence-based reagent | pri0261-F | IDT | TCATTGGCAAACAGCAAGCC | SRSF2 gRNA1 off-target 1 |
Sequence-based reagent | pri0261-R | IDT | AGAAGTATGTGCCTACGCGG | SRSF2 gRNA1 off-target 1 |
Sequence-based reagent | pri0262-F | IDT | GAGAGTCACCGACCATGACG | SRSF2 gRNA1 off-target 2 |
Sequence-based reagent | pri0262-R | IDT | TGTAAAACGTGCTGGAGGCT | SRSF2 gRNA1 off-target 2 |
Sequence-based reagent | pri0263-F | IDT | CAGAAAGCACAAGCAACGCT | SRSF2 gRNA1 off-target 3 |
Sequence-based reagent | pri0263-R | IDT | TCTCTTCCGGACACAAGTGC | SRSF2 gRNA1 off-target 3 |
Sequence-based reagent | pri0285 | IDT | CTCCTTCTTCACGTCTTCCT | SRSF2 off-target 2 sequencing |
Sequence-based reagent | pri0286 | IDT | CACCACATCTGGGATCCTCA | SRSF2 off-target 3 sequencing |
Sequence-based reagent | SF3B1 Cas9 gRNA K700 | IDT | /AlTR1/rUrGrGrArUrGrArGrCrArGr CrArGrArArArGrUrUrGrUrUrUrUrAr GrArGrCrUrArUrGrCrU/AlTR2/ | crRNA SF3B1 |
Sequence-based reagent | Alt-R CRISPR-Cas9 tracrRNA | IDT | 1072533 | tracrRNA |
Sequence-based reagent | pri0078-F | IDT | GCTGCTGGTCTGGCTACTAT | Outer PCR SF3B1 |
Sequence-based reagent | pri0078-R | IDT | ATACTCATTGCTGATTACGTGATTT | Outer PCR SF3B1 |
Sequence-based reagent | pri0002-H1 | IDT | TGGGCTACTGATTTGGGGAG | Inner PCR SF3B1 |
Sequence-based reagent | pri0002-H2 | IDT | CTGTGTTGGCGGATACCCTT | Inner PCR SF3B1 |
Sequence-based reagent | SRSF2 Silent ssODN | IDT | t*g*gacggccgcgagctgcgggtgcaaatg gcgcgctacggccgcccTccAgaTtcacacca cagccgccggggaccgccaccccgcag*g*t | |
Sequence-based reagent | SRSF2 P95H ssODN | IDT | t*g*gacggccgcgagctgcgggtgcaaatggcg cgctacggccgccATccggactcacaccacag ccgccggggaccgccaccccgcag*g*t | |
Sequence-based reagent | SRSF2 long ssODN donor | IDT | Ttcacgacaagcgcgacgctgaggacgctatgga Tgccatggacggggccgtgctggacggccgcga gctgcgggtgcaaatggcgcgctacgg ccgccATccggactcacaccacagccgccggg gaccgccaccccgcaggtacgggggcggtggcta cggacgccggagccgcaggtaaacgg ggctgaggggaccg | ordered as ALT-R HDR Donor Oligo |
Sequence-based reagent | SRSF2 P95H ssODN with additional silent mutations | IDT | t*g*gacggccgcgagctgcgggtgcaaatggcgcgctac ggccgccATccAgaTtcacaccacagccgccggg gaccgccaccccgcag*g*t | |
Software and algorithms | GelAnalyzer 19.1 | Istvan Lazar Jr. and Istvan Lazar Sr. | https://www.gelanalyzer.com | |
Software and algorithms | Synthego Performance Analysis V3 | ICE Analysis | https://www.synthego.com | |
Software and algorithms | FlowJo Software 10.8.1 | BD Life Sciences | https://www.flowjo.com | |
Software and algorithms | R (version 4.1.2) | R Core Team | https://www.r-project.org/ | |
Software and algorithms | MinKNOW (version 23.11.3) | Oxford Nanopore | https://community.nanoporetech.com/downloads | |
Software and algorithms | minimap2 (version 2.26) | Dana-Farber Cancer Institute | https://github.com/lh3/minimap2 | |
Software and algorithms | samtools (version 1.10) | Genome Research Ltd. | http://www.htslib.org/ | |
Software and algorithms | bcftools (version 1.10.2) | Genome Research Ltd. | https://samtools.github.io/bcftools/ | |
Software and algorithms | Biopython (version 1.83) | Biopython | https://biopython.org/ | |
Software and algorithms | Python (version 3.9.7) | Python | https://www.python.org/ | |