Eye-specific differences in active zone addition during synaptic competition in the developing visual system
- Department of Biology, University of Maryland, United States
Figures
Figure 1
Retinogeniculate boutons form multiple active zones (mAZ) during eye-specific competition.
(A) Experimental design. CTB-Alexa 488 was injected into the right eye of wild-type and β2KO mice. One day after the treatment, tissue was collected from the left dorsal lateral geniculate nucleus (dLGN) at P2, P4, and P8. Red squares indicate the stochastic optical reconstruction microscopy (STORM) imaging regions that were analyzed. (B) Representative examples of individual single-active-zone (sAZ) and mAZ inputs, with corresponding active zone counts ranging from one to three. Upper panels show Z-projections of inputs and lower panels show the corresponding 3D volume. Arrowheads point to individual Bassoon clusters (active zones) paired with postsynaptic Homer1 labels within each input. All examples are from a WT P8 sample. (C) Electron micrographs of mAZ retinogeniculate inputs in a P8 SLC6A4Cre::ROSA26LSL-Matrix-dAPEX2 mouse. Darkly stained dAPEX2(+) mitochondria are present within ipsilaterally projecting retinal ganglion cell (RGC) terminals. Arrowheads point to electron-dense material at the postsynaptic density, apposed to individual active zones with clustered presynaptic synaptic vesicles.
Figure 2 with 1 supplement
Changes in eye-specific input density during synaptic competition.
(A) Representative Z-projection images of multi-active-zone (mAZ) and single-active-zone (sAZ) inputs across ages and genotypes. Arrowheads point to individual Bassoon/Homer1 cluster pairs indicating release sites. (B) Representative CTB(+) dominant-eye (top panels) and CTB(−) non-dominant-eye (bottom panels) mAZ inputs in a WT P8 sample, showing synaptic (left panels), CTB (middle panels), and merged labels (right panels). Arrowheads point to individual Bassoon/Homer1 paired clusters. (C) Eye-specific mAZ (left) and sAZ (right) input density across development in WT (top panels) and β2KO mice (bottom panels). Black dots represent mean values from separate biological replicates and black lines connect eye-specific measurements within each replicate (N = 3 for each age and genotype). Error bars represent group means ± SEMs. Statistical significance between eye-specific measurements was assessed for each genotype using two-tailed paired T-tests with Benjamini–Hochberg false discovery rate (FDR) correction (α = 0.05) at each age. *p(adj) < 0.05.
Figure 2—figure supplement 1
Fraction of multi-active-zone (mAZ) inputs across development, related to Figure 2.
Eye-specific mAZ input fraction across development in WT (top panel) and β2KO mice (bottom panel). Black dots represent mean values from separate biological replicates, and black lines connect measurements within each replicate (N = 3 for each age and genotype). Error bars represent group means ± SEMs. Statistical significance between eye-specific measurements was assessed for each genotype using two-tailed paired T-tests with Benjamini–Hochberg false discovery rate (FDR) correction (α = 0.05) at each age. *p(adj) < 0.05.
Figure 3 with 2 supplements
Dominant-eye inputs show larger vesicle pools that scale with active zone number.
Violin plots showing the distribution of VGluT2 cluster volume for (A) multi-active-zone (mAZ) and (B) single-active-zone (sAZ) inputs in WT (filled) and β2KO mice (striped) at each age. The width of each violin plot reflects the relative synapse proportions across the entire grouped dataset at each age (N = 3 biological replicates) and the maximum width was normalized across all groups. The black dots represent the median value of each biological replicate (N = 3), and the black horizontal lines represent the median value of all inputs grouped across replicates. Black lines connect measurements of CTB(+) and CTB(−) populations from the same biological replicate. Statistical significance was determined using a linear mixed model ANOVA with a post hoc Bonferroni correction, followed by Benjamini–Hochberg false discovery rate (FDR) correction (α = 0.05) for multiple comparisons at each age/genotype. Black asterisks indicate significant eye-specific differences at each age. *p(adj) < 0.05. (C) Eye-specific VGluT2 signal volume for all inputs separated by number of AZs in WT (left panel) and β2KO mice (right panel) at P4. (D) Average VGluT2 volume per AZ for all inputs separated by number of AZs in WT (left panel) and β2KO mice (right panel) at P4. In panels (C) and (D), error bars indicate group means ± SEMs (N = 3 biological replicates for each age and genotype). Black dots represent mean values from separate biological replicates and black lines connect eye-specific measurements within each replicate. Statistical significance between eye-specific measurements was assessed for each genotype using two-tailed paired T-tests with Benjamini–Hochberg FDR correction (α = 0.05): *p(adj) < 0.05.
Figure 3—figure supplement 1
Quantification of docked vesicle pool volume and AZ number in multi-active-zone (mAZ) and single-active-zone (sAZ) inputs, related to Figure 3.
Violin plots show the distribution of VGluT2 cluster volume within a 70-nm shell surrounding individual Bassoon clusters at (A) P2, (B) P4, and (C) P8. The width of each violin plot reflects the relative synapse proportions at each volume across the entire grouped dataset (N = 3 biological replicates). The maximum width of the violin plots was normalized across all groups. Black horizontal lines represent the median value of all inputs grouped across replicates. The black dots represent the median value of each biological replicate and black lines between dots connect measurements from the same biological replicate. Statistical significance was determined using a linear mixed model ANOVA with post hoc Bonferroni correction. See Supplementary file 3 for 5/95% confidence intervals. Average AZ number per mAZ input in (D) WT and (E) β2KO mice. Black dots represent mean values from separate biological replicates (N = 3), and black lines connect measurements within each replicate. Error bars represent means ± SEMs. Statistical significance was assessed for each genotype using two-tailed paired T-tests with Benjamini–Hochberg false discovery rate (FDR) correction (α = 0.05) at each age. *p(adj) < 0.05.
Figure 3—figure supplement 2
Relationship between vesicle pool volume and active zone number, related to Figure 3.
(A) Total VGluT2 volume per input and (B) average VGluT2 volume per AZ for all inputs separated by number of AZs in WT (filled bars) and β2KO mice (striped bars) at P2. (C) Total VGluT2 volume per input and (D) average VGluT2 volume per AZ for all inputs separated by number of AZs in WT (filled bars) and β2KO mice (striped bars) at P8. In all panels, error bars indicate group means ± SEMs (N = 3 biological replicates for each age and genotype). Black dots represent mean values from separate biological replicates, and black lines connect measurements within each replicate. Statistical significance between eye-specific measurements was assessed for each genotype using two-tailed paired T-tests with Benjamini–Hochberg false discovery rate (FDR) correction (α = 0.05) at each age: *p(adj) < 0.05.
Figure 4 with 1 supplement
Eye-specific synapse clustering before eye-opening.
(A) Representative multi-active-zone (mAZ, left panels) and single-active-zone (sAZ, right panels) inputs in a WT P8 sample with nearby sAZ synapses (arrowheads) clustered within 1.5 μm (dashed yellow ring). Arrows point to the centered mAZ or sAZ inputs. (B) Ratio of clustered and isolated mAZ and sAZ inputs for CTB(+) (upper panels) and CTB(−) (lower panels) inputs in WT and β2KO mice at P4. (C) Comparison of the clustered input ratio between mAZ and sAZ inputs across different ages, genotypes, and eyes of origin. (D) Comparison of the average number of nearby sAZ synapses for clustered mAZ and sAZ inputs across different ages, genotypes, and eyes of origin. In panels B–D, black dots represent mean values from separate biological replicates and black lines connect measurements within each replicate (N = 3 for each age and genotype). Error bars represent group means ± SEMs. For each genotype, two-tailed paired T-tests with Benjamini–Hochberg false discovery rate (FDR) correction (α = 0.05) were used to test statistical significance between mAZ and sAZ inputs at each age. *p(adj) < 0.05.
Figure 4—figure supplement 1
Single-active-zone (sAZ) synapse clustering near like-eye multi-active-zone (mAZ) inputs, related to Figure 4.
(A) The ratio of CTB(+) dominant-eye and (B) CTB(–) non-dominant-eye sAZ synapses nearby like-eye mAZ inputs within increasing distance cutoffs in WT samples across ages. At distances of 1–2 μm across all ages, the observed ratios (filled bars) are higher than a reshuffling of the data (open bars) where the position of sAZ inputs was randomized within the neuropil. (C, D) Percentage of sAZ synapses within 1.5 μm of opposite-eye mAZ inputs across ages in WT and β2KO mice. Data are compared against a randomization of sAZ positions (open bars) as in panels A and B. For all panels, error bars represent group means ± SEMs (N = 3 biological replicates for each age and genotype). Black dots represent mean values from separate biological replicates, and black lines connect measurements within each replicate. Statistical significance was assessed for each genotype using two-tailed paired T-tests with Benjamini–Hochberg false discovery rate (FDR) correction (α = 0.05) at each age: *p(adj) < 0.05.
Figure 5 with 2 supplements
Clustered multi-active-zone (mAZ) inputs are closer than isolated inputs during competition.
Distance between clustered and isolated mAZ inputs and the closest like-eye clustered mAZ input, shown for (A) CTB(+) and (B) CTB(−) projections at P4 in WT and β2KO mice. Boxes indicate the 25–75% distribution of input measurements from N = 3 biological replicates, and whiskers extend to 1.5 times the interquartile range. Gray dots represent individual distance measurements for all mAZ inputs. Black and red dots represent mean values from separate biological replicates, and black lines connect measurements within each replicate (N = 3 for each age and genotype). Statistical significance was determined using a linear mixed model ANOVA with post hoc Bonferroni correction. For each genotype, p-values were corrected for multiple testing with Benjamini–Hochberg false discovery rate (FDR) correction (α = 0.05) at each age. Black asterisks indicate significant differences. *p(adj) < 0.05.
Figure 5—figure supplement 1
Clustered and isolated multi-active-zone (mAZ) inputs show similar spacing after competition, related to Figure 5.
Distance between clustered and isolated mAZ inputs and the closest like-eye clustered mAZ input, shown for (A) CTB(+) and (B) CTB(−) projections at P8 in WT and β2KO mice. Boxes indicate the 25–75% distribution of input measurements from N = 3 biological replicates, and whiskers extend to 1.5 times the interquartile range. Gray dots represent individual distance measurements for all mAZ inputs. Black and red dots represent mean values from separate biological replicates, and black lines connect measurements within each replicate (N = 3 for each age and genotype). Statistical significance was determined using a linear mixed model ANOVA with post hoc Bonferroni correction (see Supplementary file 3 for 5/95% confidence intervals). For each genotype, p-values were corrected for multiple testing with Benjamini–Hochberg false discovery rate (FDR) correction (α = 0.05) at each age.
Figure 5—figure supplement 2
Single-active-zone (sAZ) synapse vesicle pool volume is independent of distance to multi-active-zone (mAZ) inputs, related to Figure 5.
(A) Cumulative distributions of VGluT2 volume for CTB(+) dominant-eye or (B) CTB(−) non-dominant-eye sAZ synapses near (<1.5 μm) or far from (>1.5 μm) like-eye mAZ inputs. The distributions show merged data across all ages (P2/P4/P8; N = 3 biological replicates at each time point). A nonparametric Kolmogorov–Smirnov test was used for statistical analysis (see Supplementary file 3 for 5/95% confidence intervals). For each genotype, p-values were corrected for multiple testing with Benjamini–Hochberg false discovery rate (FDR) correction (α = 0.05) at each age.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus, male/female) | C57BL/6J; wild-type; WT | The Jackson Laboratory | RRID:IMSR_JAX:000664 | Ages P2–P8 |
| Genetic reagent (Mus musculus, male/female) | β2-nAChR−/−; CHRNB2 KO; β2KO | PMC4258148 | Ages P2–P8 | |
| Genetic reagent (Mus musculus, male/female) | Tg(Slc6a4-cre)ET33Gsat/Mmucd; BAC-Cre Slc6a4-33 | MMRRC | RRID:MMRRC_017260-UCD | Age P8 |
| Genetic reagent (Mus musculus, male/female) | Gt(ROSA)26Sortm1.1(CAG-COX4I1/APX1*)Ddg/J; ROSA26LSL-Matrix-dAPEX2 | The Jackson Laboratory | RRID:IMSR_JAX:032765 | Age P8 |
| Antibody | Donkey anti-Guinea pig IgG unconjugated | Jackson ImmunoResearch | Cat# 706-005-148; RRID:AB_2340443 | (1:100) |
| Antibody | Donkey anti-Mouse IgG unconjugated | Jackson ImmunoResearch | Cat# 715-005-150; RRID:AB_2340758 | (1:100) |
| Antibody | Donkey anti-Rabbit IgG unconjugated | Jackson ImmunoResearch | Cat# 711-005-152; RRID:AB_2340585 | (1:100) |
| Antibody | Guinea pig polyclonal anti-VGluT2 | Millipore Sigma | AB2251-I; RRID:AB_2665454 | (1:100) |
| Antibody | Mouse monoclonal anti-Bassoon | Abcam | Ab82958; RRID:AB_1860018 | (1:100) |
| Antibody | Rabbit polyclonal anti-Homer1 | Synaptic Systems | Cat# 160 003; RRID:AB_887730 | (1:100) |
| Sequence-based reagent | CHRNB2_F | PMC4258148 | PCR primers | CAGGCGTTATCCACAAAGACAGA |
| Sequence-based reagent | CHRNB2_R | PMC4258148 | PCR primers | TTGAGGGGAGCAGAACAGAATC |
| Sequence-based reagent | CHRNB2_mutant_R | PMC4258148 | PCR primers | ACTTGGGTTTGGGCGTGTTGAG |
| Sequence-based reagent | SLC6A4_F | MMRRC | PCR primers | GGTCCTTGGCAGATGGGCAT |
| Sequence-based reagent | SLC6A4_R | MMRRC | PCR primers | CGGCAAACGGACAGAAGCATT |
| Sequence-based reagent | ROSA26LSL-Matrix-dAPEX2 _WT_F | The Jackson Laboratory | PCR primers | CTGGCTTCTGAGGACCG |
| Sequence-based reagent | ROSA26LSL-Matrix-dAPEX2 _WT_R | The Jackson Laboratory | PCR primers | AATCTGTGGGAAGTCTTGTCC |
| Sequence-based reagent | ROSA26LSL-Matrix-dAPEX2 _mutant_F | The Jackson Laboratory | PCR primers | CCATCAGCACCAGCGTGT |
| Sequence-based reagent | ROSA26LSL-Matrix-dAPEX2 _mutant_R | The Jackson Laboratory | PCR primers | GAACCCTTAGTGGGATCGGG |
| Peptide, recombinant protein | Catalase from bovine liver | Sigma-Aldrich | C1345 | |
| Peptide, recombinant protein | Normal donkey serum | Jackson ImmunoResearch | Cat# 017-000-121 | |
| Peptide, recombinant protein | Glucose oxidase | Sigma-Aldrich | G2133 | |
| Commercial assay or kit | EMbed 812 embedding kit with BDMA | Electron Microscopy Sciences | Cat# 14121 | |
| Commercial assay or kit | UltraBed Kit | Electron Microscopy Sciences | Cat# 14310 | |
| Chemical compound, drug | Alexa Fluor 405 NHS-ester | Thermo Fisher Scientific | Cat# A30000 | |
| Chemical compound, drug | Alexa Fluor 647 NHS-ester | Thermo Fisher Scientific | Cat# A20006 | |
| Chemical compound, drug | Atto 488 NHS-ester | ATTO-TEC GmbH | AD 488-31 | |
| Chemical compound, drug | Cacodylic acid- sodium cacodylate, trihydrate | Electron Microscopy Sciences | Cat# 12300 | |
| Chemical compound, drug | Calcium chloride | Electron Microscopy Sciences | Cat# 12340 | |
| Chemical compound, drug | Chloroform | Sigma-Aldrich | 288306 | |
| Chemical compound, drug | Cy-3B mono NHS-ester | Cytiva | PA63101 | |
| Chemical compound, drug | Cysteamine | Sigma-Aldrich | 30070 | |
| Chemical compound, drug | DY-749P1 NHS-ester | Dyomics GmbH | Cat# 749P1-01 | |
| Chemical compound, drug | Dulbecco’s phosphate buffered saline | Sigma-Aldrich | D8662 | |
| Chemical compound, drug | Ethanol | Pharmco | Cat# 111000200C1GL | |
| Chemical compound, drug | FluoSpheres Infrared (715/755) | Invitrogen | Cat# F8799 | |
| Chemical compound, drug | FluoSpheres Orange (540/560) | Invitrogen | Cat# F8809 | |
| Chemical compound, drug | d-(+)-Glucose | Sigma-Aldrich | G7528 | |
| Chemical compound, drug | DAB (diaminobenzidine) | Sigma-Aldrich | RES2041D | |
| Chemical compound, drug | Glutaraldehyde 70%, EM Grade | Electron Microscopy Sciences | Cat# 16360 | |
| Chemical compound, drug | Glycine | Sigma-Aldrich | G7126 | |
| Chemical compound, drug | Hydrogen peroxide, 30% | Thermo Fisher Scientific | Cat# BP2633500 | |
| Chemical compound, drug | l-Aspartic acid | Fisher Scientific | Cat# A13520 | |
| Chemical compound, drug | Lead nitrate | Electron Microscopy Sciences | Cat# 17900 | |
| Chemical compound, drug | Osmium tetroxide 4% aqueous solution | Electron Microscopy Sciences | Cat# 19140 | |
| Chemical compound, drug | Paraformaldehyde 16%, EM Grade | Electron Microscopy Sciences | Cat# 15710 | |
| Chemical compound, drug | Potassium ferricyanide | Electron Microscopy Sciences | Cat# 20150 | |
| Chemical compound, drug | Propylene oxide | Electron Microscopy Sciences | Cat# 20401 | |
| Chemical compound, drug | Sodium azide | Sigma-Aldrich | S2002 | |
| Chemical compound, drug | Sodium chloride | Sigma-Aldrich | S9888 | |
| Chemical compound, drug | Sodium hydroxide pellets | Sigma-Aldrich | 567530 | |
| Chemical compound, drug | Thiocarbohydrazide | Electron Microscopy Sciences | Cat# 21900 | |
| Chemical compound, drug | Tris-base (Trizma-base) | Sigma-Aldrich | T8524 | |
| Chemical compound, drug | Triton X-100 | Sigma-Aldrich | X100PC | |
| Chemical compound, drug | Uranyl acetate | Electron Microscopy Sciences | Cat# 22400 | |
| Software, algorithm | 3D-DAOSTORM analysis (single-molecule localization fitting code); version 2.1 | PMC:PMC4243665 | https://github.com/ZhuangLab/storm-analysis | |
| Software, algorithm | Fiji (ImageJ) | PMC:PMC3855844 | https://fiji.sc | |
| Software, algorithm | MATLAB | MathWorks | https://mathworks.com | |
| Software, algorithm | Python3 | Python | https://www.python.org | |
| Software, algorithm | Rstudio | Posit | https://posit.co/ | |
| Software, algorithm | SPSS | IBM | https://www.ibm.com/products/spss-statistics | |
| Software, algorithm | STORM acquisition control code (packages include hal4000.py, steve.py, and dave.py); version V2019.06.28 | Zhuang Laboratory, Harvard University | https://github.com/ZhuangLab/storm-control | |
| Other | 5 min epoxy in DevTube | Jenson Tools | Cat# 14250 | |
| Other | BEEM embedding capsules | Electron Microscopy Sciences | Cat# 70020-B | |
| Other | Coverslip No. 1.5 (24 mm × 30 mm) | VWR | Cat# 48404-467 | |
| Other | Custom-built STORM microscope | PMC:PMC8637648 | Information on our build is available from the Corresponding Author | |
| Other | Gilder thin bar hexagonal mesh grids | Electron Microscopy Sciences | Cat# T200H-Cu | |
| Other | Microscope slides | VWR | Cat# 16004-422 |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/91431/elife-91431-mdarchecklist1-v1.pdf
-
Supplementary file 1
mAZ and sAZ synapses numbers for all biological replicates.
- https://cdn.elifesciences.org/articles/91431/elife-91431-supp1-v1.xlsx
-
Supplementary file 2
Statistical analyses for all figures.
- https://cdn.elifesciences.org/articles/91431/elife-91431-supp2-v1.xlsx
-
Supplementary file 3
Confidence interval analyses.
- https://cdn.elifesciences.org/articles/91431/elife-91431-supp3-v1.xlsx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Eye-specific differences in active zone addition during synaptic competition in the developing visual system
eLife 12:RP91431.
https://doi.org/10.7554/eLife.91431.5
