Gcn5 and mTORC1 mediated regulation of autophagy controls Drosophila blood cell homeostasis
- Stem Cell and Tissue Homeostasis Laboratory, Advanced Centre for Treatment, Research and Education in Cancer (ACTREC), Tata Memorial Centre, India
- Champalimaud Research, Champalimaud Foundation, Portugal
- Homi Bhabha National Institute, Training School Complex, India
- Center for Genomic Medicine, Massachusetts General Hospital, United States
Figures
Figure 1 with 1 supplement
Gcn5 is expressed in all compartments of the Drosophila larval LG.
Cartoon of the third instar larval LG, indicating the anterior primary lobes and the posterior lobes (A). The primary lobe of the LG depicting different subpopulations: the Posterior Signaling Center (PSC: blue) functioning as the niche, medullary zone (MZ: green) houses the progenitors, Intermediate progenitor zone (IZ: yellow) which contains the cells transitioning from progenitors to specific lineages, and the cortical zone (CZ: brown) containing the differentiated hemocytes population – plasmatocytes and crystal cells (B). Gcn5 expression in different compartments of lymph gland (C–F’). Gcn5 (red) expression in the – PSC using Col-GFP (green) (C, C’, E, E’), medullary zone prohemocytes using Dome-GFP (green) (D, D’, F, F’). Nuclei are stained with DAPI (blue). Scale bar: 50 µm (C–D’), 30 µm (E–F’).
Figure 1—figure supplement 1
GCN5 positively regulates crystal cell differentiation cell-autonomously.
GCN5 (magenta) expression in lz-GFP (green) positive crystal cells in larval LGs where lz-Gal4 drives UAS-GFP in wildtype genetic background (A, B). Crystal cell differentiation marked by Hindsight (Hnt, magenta) upon GCN5 over-expression using lz-Gal4GFP (D) as compared to control (C) and quantitated as crystal cell differentiation index per LG lobe represented by n, where n = 31 for wildtype and n = 36 for GCN5 over-expression. (G). GCN5 (magenta) expression in posterior LG lobes marked by GFP (green) driven by tep4-Gal4 (E, F). Nuclei = DAPI (blue) and GFP driven by either lz-Gal4 or tep4-Gal4. Values are mean ± SD, and asterisk marks statistically significant differences with *** as p < 0.001 analyzed by Student’s t-test with Welch’s correction. Scale bar: 30 µm (A, B), 50 µm (C–F).
-
Figure 1—figure supplement 1—source data 1
Related to Figure 1—figure supplement 1G.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig1-figsupp1-data1-v1.pdf
Figure 2 with 1 supplement
Whole animal gcn5 mutants show defective LG homeostasis.
Posterior Signaling Center (PSC) cell numbers marked by Antennapedia (red) in gcn5[C137Y/C137Y] (B, B’), gcn5[E333st/E333st] (C, C’), and gcn5[E333st/C137Y] (D, D'’), as compared to wildtype (A, A’). Graphical representation of PSC cell numbers of the gcn5 mutants as compared to the wildtype (E), n = 24 for wildtype, n = 37 for gcn5[C137Y/C137Y], n = 29 for gcn5[E333st/E333st], and n = 20 for gcn5[E333st/C137Y] for PSC cell number quantification. Plasmatocyte differentiation was marked by P1 (red) in gcn5[C137Y/C137Y] (G, G’), gcn5[E333st/E333st] (H, H’), and gcn5[E333st/C137Y] (I, I’), as compared to the wildtype (F, F’). Graphical representation of plasmatocyte differentiation index of the gcn5 mutants compared to wildtype (J), n = 20 for wildtype, n = 29 for gcn5[C137Y/C137Y], n = 33 for gcn5[E333st/E333st], and n = 26 for gcn5[E333st/C137Y] for quantification. Crystal cell differentiation marked by Hnt (red) in gcn5[C137Y/C137Y] (L, L’), gcn5[E333st/E333st] (M, M’), and gcn5[E333st/C137Y] (N, N’), as compared to wildtype (K, K’). Graphical representation of crystal cell differentiation index for gcn5 mutants compared to wildtype (O), n = 34 for wildtype, n = 29 for gcn5[C137Y/C137Y], n = 38 for gcn5[E333st/E333st], and n = 28 for gcn5[E333st/C137Y] for quantification. Cells undergoing DNA damage marked by γH2AX (red) in gcn5[C137Y/C137Y] (Q, Q’), gcn5[E333st/E333st] (R, R’), and gcn5[E333st/C137Y] (S, S’), as compared to wildtype (P, P’). Graphical representation of γH2AX positive cells undergoing DNA damage in the gcn5 mutants compared to the wildtype (T), n = 24 for wildtype, n = 54 for gcn5[C137YC137Y], n = 41 for gcn5[E333st/E333st], and n = 31 for gcn5[E333st/C137Y] for quantification. Nuclei are stained with DAPI (blue). n represents the number of individual primary lobes of the LG. Individual data points in the graphs represent individual primary lobes of the LG. Values are mean ± SD, and asterisk marks statistically significant differences (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001, Student’s t-test with Welch’s correction). Scale bar: 50 µm (A–S’). Nuclei are stained with DAPI (blue). Scale bar: 50 µm (A–S’).
-
Figure 2—source data 1
Related to Figure 2E, J, O and T.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig2-data1-v1.pdf
Figure 2—figure supplement 1
Blood cell homeostasis is affected in the whole animal gcn5 heterozygous mutants.
PSC cell numbers marked by Antennapedia (red) in gcn5[C137Y/+] (B, B’) or gcn5[E333st/+] (C, C’), as compared to wildtype (A, A’). Graphical representation of PSC cell numbers of the gcn5 mutants compared to the wildtype (D), n = 24 for wildtype, n = 33 for gcn5[C137Y/+], and n = 41 for gcn5[E333st/+] for PSC cell numbers quantification. Plasmatocyte differentiation was marked by P1 (red) in gcn5[C137Y/+] (F, F’) or gcn5[E333st/+] (G, G’), compared to the wildtype (E, E’). Graphical representation of plasmatocyte differentiation index of the gcn5 heterozygous mutants compared to wildtype (H), n = 24 for wildtype, n = 20 for gcn5[C137Y/+], and n = 24 for gcn5[E333st/+] for quantification. Crystal cell differentiation marked by Hnt (red) in gcn5[C137Y/+] (J, J’) or gcn5[E333st/+] (K, K’), compared to wildtype (I, I’). Graphical representation of crystal cell differentiation index for gcn5 heterozygous mutants compared to wildtype (L), n = 22 for wildtype, n = 28 for gcn5[C137Y/+], and n = 23 for gcn5[E333st/+] for quantification. Cells undergoing DNA damage marked by γH2AX (red) in gcn5[C137Y/+] (N, N’) or gcn5[E333st/+] (O, O’), as compared to wildtype (M, M’). Graphical representation of γH2AX marked DNA damage of the heterozygous gcn5 mutants compared to the wildtype (P), n = 31 for wildtype, n = 42 for gcn5[C137Y/+], and n = 28 for gcn5[E333st/+] for quantification. Nuclei are stained with DAPI (blue). n represents the number of individual primary lobes of the LG. Individual data points in the graphs represent individual primary lobes of the LG. Values are mean ± SD, and asterisk marks statistically significant differences (*p < 0.05; **p <0.01; ****p < 0.0001, Student’s t-test with Welch’s correction). Scale bar: 50 µm (A–O’).
-
Figure 2—figure supplement 1—source data 1
Related to Figure 2—figure supplement 1D, H, L and P.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig2-figsupp1-data1-v1.pdf
Figure 3 with 3 supplements
Modulation of Gcn5 levels in the prohemocytes alters blood cell homeostasis in the lymph gland.
Posterior Signalling Center (PSC) population marked by Antennapedia (red) upon dome-Gal4 mediated knockdown (B, B’) or over-expression (C, C’) of Gcn5 as compared to wildtype (A, A’). Plasmatocyte differentiation marked by P1 (red) upon dome-Gal4 mediated knockdown (E, E’) or over-expression (F, F’) of Gcn5 as compared to wildtype (D, D’). Crystal cell differentiation marked by Hnt (red) upon dome-Gal4 mediated knockdown (H, H’) or over-expression (I, I’) of Gcn5 as compared to wild type (G, G’). Cells undergoing DNA damage marked by γH2AX (red) upon dome-Gal4 mediated knockdown (K, K’) or over-expression (L, L’) of Gcn5 as compared to wild type (J, J’). Graphical representation of PSC numbers upon modulation of Gcn5 levels in the Dome positive population compared to wildtype (M), n = 28 for wildtype, n = 28 for Gcn5 knockdown, and n = 20 for Gcn5 over-expression. Graphical representation of prohemocyte index upon modulation of Gcn5 levels in dome population compared to wildtype (N), n = 30 for wildtype, n = 30 for Gcn5 knockdown, and n = 30 for Gcn5 over-expression. Graphical representation of plasmatocyte differentiation index upon modulation of Gcn5 levels in dome population compared to wildtype (O), n = 35 for wildtype, n = 23 for Gcn5 knockdown, and n = 25 for Gcn5 over-expression. Graphical representation of crystal cell differentiation index upon modulation of Gcn5 levels in the dome population compared to wildtype (P), n = 36 for wildtype, n = 26 for Gcn5 knockdown, and n = 34 for Gcn5 over-expression. Graphical representation of γH2AX positive cells upon modulation of Gcn5 levels in the dome population compared to wildtype (Q), n = 33 for wildtype, n = 27 for Gcn5 knockdown, and n = 38 for Gcn5 over-expression. Nuclei are stained with DAPI (blue). Dome>GFP positive population (green) indicates the expression domain of dome-Gal4 activity in the LG. n represents the number of individual primary lobes of the LG. Individual data points in the graphs represent individual primary lobes of the lymph gland. Values are mean ± SD, and asterisk marks statistically significant differences (**p < 0.01; ***p < 0.001; ****p < 0.0001, Student’s t-test with Welch’s correction). Scale bar: 50 µm (A–L’).
-
Figure 3—source data 1
Related to Figure 3M, N, O, P and Q.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig3-data1-v1.pdf
Figure 3—figure supplement 1
Validation of Gcn5 knockdown and over-expression constructs.
Gcn5 (red) expression upon hml-Gal4 mediated Gcn5 knockdown (B, B’) or over-expression (C, C’) in the hml population, compared to wildtype (A, A’). FLAG (red) expression upon Gcn5 over-expression (E, E’) in the hml population, compared to wildtype (D, D’). Nuclei are stained with DAPI (blue). Scale bar: 50 µm (A–E’).
Figure 3—figure supplement 2
Col mediated modulation of Gcn5 levels in the PSC alters LG homeostasis.
PSC cell population marked by Antennapedia (red) upon knockdown (B, B’) or over-expression (C, C’) of Gcn5 in the Col population (green) compared to wildtype (A, A’). Plasmatocyte differentiation marked by P1 (red) upon knockdown (E, E’) or over-expression (F, F’) of Gcn5 in the Col population (green) compared to wildtype (D, D’). Crystal cell differentiation marked by Hnt (red) upon knockdown (H, H’) or over-expression (I, I’) of Gcn5 in the Col population (green) compared to wild type (G, G’). Cells undergoing DNA damage marked by γH2AX (red) upon knockdown (K, K’) or over-expression (L, L’) of Gcn5 in the Col population (green) compared to wild type (J, J’). Graphical representation of PSC cell numbers upon modulation of Gcn5 levels in the Col population compared to wildtype (M), n = 21 for wildtype, n = 29 for Gcn5 knockdown, and n = 22 for Gcn5 over-expression. Graphical representation of plasmatocyte differentiation Index upon modulation of Gcn5 levels in Col population compared to wildtype (N), n = 23 for wildtype, n = 23 for Gcn5 knockdown, and n = 20 for Gcn5 over-expression. Graphical representation of crystal cell differentiation index upon modulation of Gcn5 levels in the Col population compared to wildtype (O), n = 34 for wildtype, n = 24 for Gcn5 knockdown, and n = 24 for Gcn5 over-expression. Graphical representation of γH2AX positive cells upon modulation of Gcn5 levels in the Col population compared to wildtype (P), n = 29 for wildtype, n = 27 for Gcn5 knockdown, and n = 21 for Gcn5 over-expression. Nuclei are stained with DAPI (blue). PSC cell-specific Gcn5 modulation was performed using col-Gal4. n represents the number of individual primary lobes of the LG. Individual data points in the graphs represent individual primary lobes of the LG. Values are mean ± SD, and asterisk marks statistically significant differences (*p < 0.05; *p < 0.01; ***p < 0.001, Student’s t-test with Welch’s correction). Scale bar: 50 µm (A–L’).
-
Figure 3—figure supplement 2—source data 1
Related to Figure 3—figure supplement 2M, N, O and P.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig3-figsupp2-data1-v1.pdf
Figure 3—figure supplement 3
HmlΔ mediated modulation of Gcn5 levels in the differentiated blood cell population results in altered hematopoiesis.
PSC cell population marked by Antennapedia (red) upon knockdown (B, B’) or over-expression (C, C’) of Gcn5 in the HmlΔ population (green) compared to wildtype (A, A’). Plasmatocyte differentiation marked by P1 (red) upon knockdown (E, E’) or over-expression (F, F’) of Gcn5 in the HmlΔ population (green) compared to wildtype (D, D’). Crystal cell differentiation marked by Hnt (red) upon knockdown (H, H’) or over-expression (I, I’) of Gcn5 in the HmlΔ population (green) compared to wildtype (G, G’). Cells undergoing DNA damage marked by γH2AX (red) upon knockdown (K, K’) or over-expression (L, L’) of Gcn5 in the HmlΔ population (green) compared to wildtype (J, J’). Graphical representation of PSC cell numbers upon modulation of Gcn5 levels in the HmlΔ population compared to wildtype (M), n = 24 for wildtype, n = 25 for Gcn5 knockdown, and n = 36 for Gcn5 over-expression. Graphical representation of plasmatocyte differentiation Index upon modulation of Gcn5 levels in HmlΔ population compared to wildtype (N), n = 20 for wildtype, n = 20 for Gcn5 knockdown, and n = 21 for Gcn5 over-expression. Graphical representation of crystal cell differentiation index upon modulation of Gcn5 levels in the HmlΔ population compared to wildtype (O), n = 20 for wildtype, n = 20 for Gcn5 knockdown, and n = 23 for Gcn5 over-expression. Graphical representation of γH2AX positive cells upon modulation of Gcn5 levels in the HmlΔ population compared to wildtype (P), n = 23 for wildtype, n = 29 for Gcn5 knockdown, and n = 27 for Gcn5 over-expression. Nuclei are stained with DAPI (blue). hmlΔ-Gal4 was used for differentiated blood cells specific Gcn5 modulation. n represents the number of individual primary lobes of the LG. Individual data points in the graphs represent individual primary lobes of the LG. Values are mean ± SD, and asterisk marks statistically significant differences (*p < 0.05; ***p < 0.001; ****p < 0.0001, Student’s t-test with Welch’s correction). Scale bar: 50 µm (A–L’).
-
Figure 3—figure supplement 3—source data 1
Related to Figure 3—figure supplement 3M, N, O and P.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig3-figsupp3-data1-v1.pdf
Figure 4 with 1 supplement
Prohemocyte-specific expression of Gcn5 domain deletion constructs affects LG homeostasis.
Schematic of the SAGA HAT complex containing different modules – Sgf29, Ada2, Gcn5, and Ada3. Gcn5 is an 813 aa protein in Drosophila containing the Pcaf homology domain, HAT domain, Ada domain, and Bromodomain (A). Posterior Signalling Center (PSC) numbers marked by Antennapedia (red) upon expression of different Gcn5 domain deletion constructs in the tep-GFP (green) population using tep4-Gal4 (C–F), compared to wildtype (B). Progenitor index marked by tep (green) upon expression of different Gcn5 domain deletion constructs (C’–F’), compared to wildtype (B’). Plasmatocyte differentiation marked by P1 (red) upon expression of different Gcn5 domain deletion constructs in the tep-GFP population using tep4-Gal4 (green) (C”–F”), compared to wildtype (B”). Crystal cell differentiation marked by Hnt (red) upon expression of different Gcn5 domain deleted constructs in the tep-GFP population using tep4-Gal4 (green) (C”’–F”’), compared to wildtype (B”’). Graphical representation of PSC numbers upon expression of Gcn5 domain deletion constructs, compared to wildtype (G), n = 40 for wildtype, n = 29 for Gcn5ΔHAT expression, n = 35 for Gcn5ΔPcaf expression, n = 33 for Gcn5ΔBromo expression, and n = 26 for Gcn5ΔAda expression in the tep population. Graphical representation of prohemocyte index upon expression of Gcn5 domain deletion constructs, compared to wildtype (H), n = 24 for wildtype, n = 24 for Gcn5ΔHAT expression, n = 34 for Gcn5ΔPcaf expression, n = 24 for Gcn5ΔBromo expression, and n = 24 for Gcn5ΔAda expression in the tep population. Graphical representation of plasmatocyte differentiation index upon expression of Gcn5 domain deleted constructs, compared to wildtype (I), n = 38 for wildtype, n = 30 for Gcn5ΔHAT expression, n = 29 for Gcn5ΔPcaf expression, n = 27 for Gcn5ΔBromo expression, and n = 27 for Gcn5ΔAda expression in the tep population. Graphical representation of crystal cell numbers upon expression of Gcn5 domain deleted constructs, compared to wildtype (J), n = 23 for wildtype, n = 35 for Gcn5ΔHAT expression, n = 26 for Gcn5ΔPcaf expression, n = 26 for Gcn5ΔBromo expression, and n = 26 for Gcn5ΔAda expression in the tep population. Graphical representation of cystal cell differentiation index upon expression of Gcn5 domain deleted constructs, compared to wildtype (K), n = 20 for wildtype, n = 34 for Gcn5ΔHAT expression, n = 25 for Gcn5ΔPcaf expression, n = 15 for Gcn5ΔBromo expression, and n = 27 for Gcn5ΔAda expression in the tep population. Nuclei are stained with DAPI (blue). n represents the number of individual primary lobes of the LG. Individual data points in the graphs represent individual primary lobes of the LG. Values are mean ± SD, and asterisk marks statistically significant differences (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001, Student’s t-test with Welch’s correction). Scale bar: 50 µm (B–F’’’).
-
Figure 4—source data 1
Related to Figure 4G, H, I , J and K .
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig4-data1-v1.pdf
Figure 4—figure supplement 1
Prohemocyte-specific expression of Gcn5 domain deletion constructs leads to increased DNA damage.
Cells undergoing DNA damage marked by γH2AX (red) upon expression of different Gcn5 domain deletion constructs in the tep-GFP population using tep4-Gal4 (green) (B–E’) as compared to wildtype (A, A’). Graphical representation of Cells undergoing DNA damage marked by γH2AX (F), where n = 27 for wildtype, n = 26 for Gcn5ΔHAT expression, n = 27 for Gcn5ΔPcaf expression, n = 23 for Gcn5ΔBromo expression, and n = 25 for Gcn5ΔAda expression in the tep population. Nuclei are stained with DAPI (blue). n represents the number of individual primary lobes of the LG. Individual data points in the graphs represent individual primary lobes of the LG. Values are mean ± SD, and asterisk marks statistically significant differences (**p < 0.01; ***p < 0.001; ****p < 0.0001, Student’s t-test with Welch’s correction). Scale bar: 50 µm (A–E’).
-
Figure 4—figure supplement 1—source data 1
Related to Figure 4—figure supplement 1F .
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig4-figsupp1-data1-v1.pdf
Figure 5 with 1 supplement
Autophagic flux in Drosophila blood cells is negatively regulated by Gcn5.
p62 (red) labeling the autophagy adaptor protein upon hml-Gal4 mediated Gcn5 knockdown (B), or over-expression (C) as compared to wildtype (A). Atg8 (red), the autophagosomal marker upon hml-Gal4 mediated Gcn5 knockdown (B’) or over-expression (C’) as compared to wildtype (A’). Nuclei were stained with DAPI (blue). Graphical representation of the p62 positive puncta/cell (D). Graphical representation of Atg8 positive puncta/cell (E). Values are mean ± SD, and asterisk marks statistically significant differences (***p < 0.001; ****p < 0.0001, Student’s t-test with Welch’s correction). Scale bar: 20 µm (A–E’).
-
Figure 5—source data 1
Related to Figure 5D.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig5-data1-v1.pdf
-
Figure 5—source data 2
Related to Figure 5E.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig5-data2-v1.pdf
Figure 5—figure supplement 1
Gcn5 over-expression leads to suppression of autophagy-related genes.
Transcript levels of different autophagy effector genes in hml-Gal4 mediated Gcn5 over-expression genetic background as compared to the hml-Gal4 X wt control. rp49 was used as an endogenous control to normalize the mRNA expression.
-
Figure 5—figure supplement 1—source data 1
Related to Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig5-figsupp1-data1-v1.pdf
Figure 6 with 2 supplements
Genetic and chemical ablation of autophagy leads to aberrant blood cell differentiation.
Plasmatocyte differentiation marked by P1 (red) upon tep4-Gal4 mediated knockdown of TFEB (C, C’), Atg8a (E, E’), Atg5 (G, G’), or Atg18 (I, I’) in the tep population (green) as compared to wildtype (A, A’). Crystal cell differentiation marked by Hnt (red) upon tep4-Gal4 mediated knockdown of TFEB (D, D’), Atg8a (F, F’), Atg5 (H, H’), or Atg18 (J, J’) in the tep population (green) as compared to wildtype (B, B’). Graphical representation of the plasmatocyte differentiation index upon knockdown of TFEB (n = 33), Atg8a (n = 28), Atg5 (n = 24), or Atg18 (n = 22) in the tep population, compared to the wildtype (n = 22) (K). Graphical representation of the crystal cell differentiation index upon knockdown of TFEB (n = 22), Atg8a (n = 35), Atg5 (n = 24), or Atg18 (n = 22) in the tep population, compared to the wildtype (n = 19) (L). Plasmatocyte differentiation (red) upon Chloroquine treatment (N) as compared to control (M). Crystal cell differentiation upon Chloroquine treatment (P) as compared to control (O). Graphical representation of the plasmatocyte differentiation Index upon Chloroquine treatment (n = 30), compared to control (n = 25) (Q). Graphical representation of crystal cell differentiation index upon Chloroquine treatment (n = 26), compared to control (n = 23) (R). Nuclei are stained with DAPI (blue). n represents the number of individual primary lobes of the LG. Individual data points in the graphs represent individual primary lobes of the LG. Values are mean ± SD, and asterisk marks statistically significant differences (*p < 0.05; ***p < 0.001; ****p < 0.0001, Student’s t-test with Welch’s correction). Scale bar: 50 µm (A–P).
-
Figure 6—source data 1
Related to Figure 6K, L, Q and R.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig6-data1-v1.pdf
Figure 6—figure supplement 1
Prohemocyte-specific genetic abrogation of autophagy affects the niche cell numbers and induces DNA damage.
PSC/niche cells marked by Antennapedia (red) upon tep4-Gal4 mediated knockdown of TFEB (C, C’), Atg8a (E, E’), Atg5 (G, G’), or Atg18 (I, I’) in the tep population (green) as compared to wildtype (A, A’). DNA damage marked by Gamma-H2Ax (red) upon tep4-Gal4 mediated knockdown of TFEB (D, D’), Atg8a (F, F’), Atg5 (H, H’), or Atg18 (J, J’) in the tep population (green) as compared to wildtype (B, B’). Graphical representation of niche cell numbers upon knockdown of TFEB (n = 40), Atg8a (n = 36), Atg5 (n = 39), and Atg18 (n = 41) in the tep population, compared to the wildtype (n = 33) (K). Graphical representation of Gamma-H2Ax positive foci upon knockdown of TFEB (n = 37), Atg8a (n = 34), Atg5 (n = 33), or Atg18 (n = 36) in the tep population, compared to the wildtype (n = 35) (L). Graphical representation of prohemocyte index upon knockdown of TFEB (n = 30), Atg8a (n = 30), Atg5 (n = 30), and Atg18 (n = 30) in the tep population, compared to the wildtype (n = 33) (M). Nuclei are stained with DAPI (blue). n represents the number of individual primary lobes of the LG. Individual data points in the graphs represent individual primary lobes of the LG. Values are mean ± SD, and asterisk marks statistically significant differences (*p < 0.05; ***p < 0.001; ****p < 0.0001, Student’s t-test with Welch’s correction). Scale bar: 50 µm (A–J’).
-
Figure 6—figure supplement 1—source data 1
Related to Figure 6—figure supplement 1K, L and M.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig6-figsupp1-data1-v1.pdf
Figure 6—figure supplement 2
Autophagy levels in the LG hemocytes are affected upon systemic Chloroquine treatment.
Chloroquine treated tep4-Gal4GFP X wt larvae expressing GFP (green) driven by tep4-Gal4 showing p62 or Atg8 positive puncta (magenta) in LG hemocytes (B, B’, D, D’) as compared to vehicle treated (A, A’, C, C’) and represented as number of p62 or Atg8 positive puncta per cell (n), where n = 255 cells for vehicle treated and n = 300 cells for Chloroquine treated p62 positive cells and n = 360 cells for vehicle treated and n = 390 cells for Chloroquine treated Atg8 positive cells, respectively. (E, F) Nuclei = DAPI (blue) and GFP driven by tep4-Gal4. Values are mean ± SD, and asterisk marks statistically significant differences with **** as p < 0.0001 analyzed by Student’s t-test with Welch’s correction. Scale bar: 30 µm (A–D’).
-
Figure 6—figure supplement 2—source data 1
Related to Figure 6—figure supplement 2E and F.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig6-figsupp2-data1-v1.pdf
Figure 7 with 2 supplements
Modulation of mTORC1 activity regulates blood cell differentiation in the lymph gland.
Plasmatocyte differentiation marked by P1 (red) upon 3BDO treatment (B, B’) as compared to control (A, A’). Crystal cell differentiation marked by Hnt (red) upon 3BDO treatment (D, D’) compared to control (C, C’). Graphical representation of plasmatocyte differentiation index upon 3BDO treatment (n = 28) compared to control (n = 24) (E). Graphical representation of crystal cell differentiation index upon 3BDO treatment (n = 19) compared to control (n = 21) (F). Plasmatocyte differentiation marked by P1 (red) upon Rapamycin treatment (H, H’) compared to control (G, G’). Crystal cell differentiation marked by Hnt (red) upon Rapamycin treatment (J, J’) compared to control (I, I’). Graphical representation of plasmatocyte differentiation index upon Rapamycin treatment (n = 28) compared to control (n = 20) (K). Graphical representation of crystal cell differentiation index upon Rapamycin treatment (n = 23) compared to control (n = 22) (L). Immunoblot showing GCN5 (93 kDa) protein levels in different diet conditions – fed, starved, and high-fat diet (M). Immunoblot showing GCN5 (93 kDa) protein levels upon Rapamycin treatment compared to wildtype (N). β-Actin (42 kDa) was used as the loading control. Nuclei are stained with DAPI (blue). Quantification of GCN5 protein levels in the fed, starved, and high-fat diet scenario (O). Quantification of GCN5 protein levels in the wildtype as compared to Rapamycin treatment (P). n represents the number of individual primary lobes of the LG. Individual data points in the graphs represent individual primary lobes of the LG. Values are mean ± SD, and asterisk marks statistically significant differences (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001, Student’s t-test with Welch’s correction). Scale bar: 50 µm (A–J’).
-
Figure 7—source data 1
Related to Figure 7E, F, K, L, O and P.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig7-data1-v1.pdf
-
Figure 7—source data 2
The original files of the full raw uncropped related to Figure 7M and N.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig7-data2-v1.zip
-
Figure 7—source data 3
PPT with the uncropped blots with the relevant bands clearly labeled related to Figure 7M and N.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig7-data3-v1.zip
Figure 7—figure supplement 1
Genetic modulation of mTORC1 activity in the hematopoietic progenitors regulates blood cell differentiation.
Plasmatocyte differentiation marked by P1 (magenta) upon tep4-Gal4 mediated depletion of tor (B) or raptor (C) or over-expression of Rheb (D) as compared to the wild type control (A) quantitated as plasmatocyte differentiation index per LG lobe where n represents the number of primary lobes of LG, n = 45 for wildtype, n = 39 for tor knockdown, n = 43 for raptor knockdown, and n = 44 for Rheb over-expression. (I). Crystal cell differentiation marked by Hindsight (Hnt, magenta) upon tep4-Gal4 mediated depletion of tor (F) or raptor (G) or over-expression of Rheb (H) as compared to the wild type control (E) quantitated as crystal cell differentiation index per LG lobe (n), where n represents the number of primary lobes of LG, n = 31 for wildtype, n = 42 for tor knockdown, n = 30 for raptor knockdown, n = 28 for Rheb over-expression. (J) Nuclei = DAPI (blue) and GFP is driven by tep4-Gal4. n = number of individual primary lobes of the LG. Individual data points in the graphs represent individual primary lobes of the LG. Values are mean ± SD, and asterisk marks statistically significant differences (*p < 0.05; ***p < 0.001; ****p < 0.0001, ns = non-significant. Student’s t-test with Welch’s correction). Scale bar: 50 µm (A–H).
-
Figure 7—figure supplement 1—source data 1
Related to Figure 7—figure supplement 1I and J.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig7-figsupp1-data1-v1.pdf
Figure 7—figure supplement 2
Genetic modulation of mTORC1 activity in the hematopoietic progenitors alters niche cell numbers and causes DNA damage.
PSC/niche cell numbers marked by Antennapedia (Antp, magenta) upon tep4-Gal4 mediated depletion of tor (B) or raptor (C) or over-expression of Rheb (D) as compared to the wild type control (A) quantitated as Antp positive niche cell numbers per LG lobe represented by n, where n = 38 for wildtype, n = 37 for tor knockdown, n = 42 for raptor knockdown, n = 37 for Rheb over-expression. (I). γ-H2Ax foci positive cells showing DNA damage (magenta) upon tep4-Gal4 mediated depletion of tor (F) or raptor (G) or over-expression of Rheb (H) as compared to the wildtype control (E) quantitated as total number of γ-H2Ax positive foci per LG lobe represented by n, where n = 40 for wildtype, n = 43 for tor knockdown, n = 34 for raptor knockdown, n = 37 for Rheb over-expression. (J). Nuclei = DAPI (blue) and GFP is driven by tep4-Gal4. n = number of individual primary lobes of the LG. Individual data points in the graphs represent individual primary lobes of the LG. Values are mean ± SD, and asterisk marks statistically significant differences (*p < 0.05; ***p < 0.001; ****p < 0.0001, ns = non-significant. Student’s t-test with Welch’s correction). Scale bar: 50 µm (A–H).
-
Figure 7—figure supplement 2—source data 1
Related to Figure 7—figure supplement 2I and J.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig7-figsupp2-data1-v1.pdf
Figure 8
mTORC1 can override the effect of Gcn5 level modulation over autophagy.
Plasmatocyte differentiation marked by P1 (red) upon 3BDO treatment in tep4-Gal4 mediated (green) Gcn5 knockdown background (B, B’) compared to control treatment in the same genetic background (A, A’). Crystal cell differentiation marked by Hnt (red) upon 3BDO treatment in the tep-mediated (green) Gcn5 knockdown background (D, D’) compared to control treatment in the same genetic background (C, C’). Plasmatocyte differentiation marked by P1 (red) upon Rapamycin treatment in Dome-mediated (green) Gcn5 over-expression background (F, F’) compared to control treatment in the same genetic background (E, E’). Crystal cell differentiation marked by Hnt (red) upon Rapamycin treatment in dome-Gal4 mediated (green) Gcn5 over-expression background (H, H’) as compared to control treatment in the same genetic background (G, G’). Graphical representation of plasmatocyte differentiation index upon 3BDO treatment (n = 21) and control treatment (n = 20) in the tep-mediated Gcn5 knockdown background (I). Graphical representation of crystal cell differentiation index upon 3BDO treatment (n = 19) and control treatment (n = 21) in the tep-mediated Gcn5 knockdown background (J). Graphical representation of plasmatocyte differentiation index upon Rapamycin treatment (n = 27) and control treatment (n = 21) in the Dome-mediated Gcn5 over-expression background (K). Graphical representation of crystal cell differentiation index upon Rapamycin treatment (n = 43) and control treatment (n = 21) in the Dome-mediated Gcn5 over-expression background (L). Nuclei are stained with DAPI (blue). n represents the number of individual primary lobes of the LG. Individual data points in the graphs represent individual primary lobes of the LG. Values are mean ± SD, and asterisk marks statistically significant differences (**p < 0.01; ***p < 0.001, Student’s t-test with Welch’s correction). Scale bar: 50 µm (A–H’).
-
Figure 8—source data 1
Related to Figure 8I, I, J, K and L.
- https://cdn.elifesciences.org/articles/91615/elife-91615-fig8-data1-v1.pdf
Figure 9
Gcn5–mTORC1 mediated autophagy regulation controls blood cell homeostasis.
A cartoon summarizing how Gcn5–mTORC1 signaling axis regulates autophagy to control blood cell homeostasis in the Drosophila LG. Lab, R. (2026). Figure 9. Gcn5–mTORC1 mediated autophagy regulation controls blood cell homeostasis. Created in BioRender.com.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Drosophila melanogaster) | Gcn5 | Flybase:FB2026_01 | FLYB:FBgn0020388 | |
| Gene (Drosophila melanogaster) | Collier/kn | Flybase:FB2026_01 | FLYB:FBgn0001319 | |
| Gene (Drosophila melanogaster) | Dome | Flybase:FB2026_01 | FLYB:FBgn0043903 | |
| Gene (Drosophila melanogaster) | Tep4 | Flybase:FB2026_01 | FLYB:FBgn0041180 | |
| Gene (Drosophila melanogaster) | Hml | Flybase:FB2026_01 | FLYB:FBgn0029167 | |
| Gene (Drosophila melanogaster) | Atg8a | Flybase:FB2026_01 | FLYB:FBgn0052672 | |
| Gene (Drosophila melanogaster) | Atg5 | Flybase:FB2026_01 | FLYB:FBgn0029943 | |
| Gene (Drosophila melanogaster) | Atg18a | Flybase:FB2026_01 | FLYB:FBgn0035850 | |
| Gene (Drosophila melanogaster) | Tor/mTor | Flybase:FB2026_01 | FLYB:FBgn0021796 | |
| Gene (Drosophila melanogaster) | Rheb | Flybase:FB2026_01 | FLYB:FBgn0041191 | |
| Gene (Drosophila melanogaster) | Raptor | Flybase:FB2026_01 | FLYB:FBgn0029840 | |
| Genetic reagent (D. melanogaster) | gcn5E333st/TM3 | Bloomington Drosophila Stock Center | BDSC: BL-9333 RRID:BDSC_9333 | |
| Genetic reagent (D. melanogaster) | gcn5C137Y/TM3 | Bloomington Drosophila Stock Center | BDSC: BL-9335 RRID:BDSC_9335 | |
| Genetic reagent (D. melanogaster) | UAS-Gcn5RNAi | Bloomington Drosophila Stock Center | BDSC: BL-9332 RRID:BDSC_9332 | |
| Genetic reagent (D. melanogaster) | UAS-Gcn5FLAG | Gift from Clement Carre, Sorbonne Université, Paris | ||
| Genetic reagent (D. melanogaster) | UAS-Gcn5ΔHAT | Gift from Clement Carre, Sorbonne Université, Paris | ||
| Genetic reagent (D. melanogaster) | UAS-Gcn5ΔPcaf | Gift from Clement Carre, Sorbonne Université, Paris | ||
| Genetic reagent (D. melanogaster) | UAS Gcn5ΔBromo | Gift from Clement Carre, Sorbonne Université, Paris | ||
| Genetic reagent (D. melanogaster) | UAS-Gcn5ΔAda | Gift from Clement Carre, Sorbonne Université, Paris | ||
| Genetic reagent (D. melanogaster) | UAS-TFEB RNAi | Gift from Bhupendra Shravage, Agharkar Research Institute Pune, India | ||
| Genetic reagent (D. melanogaster) | UAS-Atg8aRNAi | Bloomington Drosophila Stock Center | BDSC: BL-34340 RRID:BDSC_34340 | |
| Genetic reagent (D. melanogaster) | UAS-Atg5RNAi | Bloomington Drosophila Stock Center | BDSC: BL-34899 RRID:BDSC_34899 | |
| Genetic reagent (D. melanogaster) | UAS-Atg18aRNAi | Bloomington Drosophila Stock Center | BDSC: BL-34714 RRID:BDSC_34714 | |
| Genetic reagent (D. melanogaster) | tep4Gal4GFP | Gift from Lucas Waltzer, Université Clermont Auvergne, France | ||
| Genetic reagent (D. melanogaster) | collierGal4mCD8GFP | Gift from Lucas Waltzer, Université Clermont Auvergne, France | ||
| Genetic reagent (D. melanogaster) | DomeGal4mCD8GFP | Gift from Lucas Waltzer, Université Clermont Auvergne, France | ||
| Genetic reagent (D. melanogaster) | HHLTGal4GFP | Gift from Lucas Waltzer, Université Clermont Auvergne, France | ||
| Genetic reagent (D. melanogaster) | HmlGal4GFP | Gift from Lucas Waltzer, Université Clermont Auvergne, France | ||
| Genetic reagent (D. melanogaster) | HmldeltaGal4GFP | Gift from Lucas Waltzer, Université Clermont Auvergne, France | ||
| Genetic reagent (D. melanogaster) | LozengeGal4Mcd8gfp | Gift from Lucas Waltzer, Université Clermont Auvergne, France | ||
| Genetic reagent (D. melanogaster) | UAS-TOR RNAi | Bloomington Drosophila Stock Center | BDSC: BL-33951 RRID:BDSC_33951 | |
| Genetic reagent (D. melanogaster) | UAS-raptor RNAi | Bloomington Drosophila Stock Center | BDSC: BL-41912 RRID:BDSC_41912 | |
| Genetic reagent (D. melanogaster) | UAS-rheb | Gift from Mohit Prasad | ||
| Antibody | Anti-P1 (Mouse monoclonal) | Gift from Dr. Istvan Ando | Cat#21F3 RRID:AB_1552772 | (1:100) Immunofluorescence |
| Antibody | Anti-Hnt (Mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat#1G9 RRID:AB_528278 | (1:25) Immunofluorescence |
| Antibody | Anti-Antp (Mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat#8C11 RRID:AB_528083 | (1:25) Immunofluorescence |
| Antibody | Anti-γ2AX (Mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat#UNC93-5.2.1 RRID:AB_2618077 | (1:400) Immunofluorescence |
| Antibody | Anti-FLAG (Mouse monoclonal) | Thermo Fisher | RRID:AB_1957945 | (1:100) Immunofluorescence |
| Antibody | Anti-P62/SQSTM1 | Proteintech | RRID:AB_10694431 | (1:250) Immunofluorescence (1:3000) Western blotting |
| Antibody | Anti-ATG8 | Sigma-Aldrich | RRID:AB_2939040 | (1:200) Immunofluorescence (1:4000) Western blotting |
| Antibody | Anti-dGcn5 (Rabbit monoclonal) | Gift from Clement Carre | (1:100) Immunofluorescence (1:4000) Western blotting | |
| Antibody | Goat anti-mouse 568 (Alexa-Fluor 568 conjugated secondary antibody) | Invitrogen | RRID:AB_144696 | (1:400) Immunofluorescence |
| Antibody | Goat anti-rabbit 568 (Alexa-Fluor 568 conjugated secondary antibody) | Invitrogen | RRID:AB_10563566 | (1:400) Immunofluorescence |
| Antibody | Anti-β-actin | (1:5000) Western blotting | ||
| Antibody | Goat anti-Mouse (HRP conjugated secondary antibody) | Invitrogen | RRID:AB_228307 | (1:5000) Western blotting |
| Antibody | Goat anti-Rabbit (HRP conjugated secondary antibody) | Invitrogen | RRID:AB_228341 | (1:5000) Western blotting |
| Chemical compound, drug | Normal Goat Serum | HIMEDIA | RM10701 | (20x) Immunofluorescence |
| Chemical compound, drug | Rapamycin | Sigma-Aldrich | R0395 | |
| Chemical compound, drug | Chloroquine diphosphate salt | Sigma-Aldrich | C6628 | |
| Chemical compound, drug | 3BDO | Sigma-Aldrich | SML1687 | |
| Sequence-based reagent | Atg1 | Forward: GGCAGTGGATCGGAGAACAA Reverse: CATCAGCGTCTCTTCGGACA | PCR primers | |
| Sequence-based reagent | Atg4a | Forward: TGGTTCTGTTGAAGCTGACC Reverse: CCTCATTGGGTGCTCCACTT | PCR primers | |
| Sequence-based reagent | Atg4b | Forward: TTGCACGAGTAAGTTCAAGCA Reverse: CAAGGCACATGGGGTTTTGG | PCR primers | |
| Sequence-based reagent | Atg5 | Forward: AGGGAAAAGGTGCCAGTCAG Reverse: GATTTTTCGGTTCGGCTCGG | PCR primers | |
| Sequence-based reagent | Atg7 | Forward: CCGAAGGCGTCATCTTTGTT Reverse: GTTGGATACTCCGGGTCGTG | PCR primers | |
| Sequence-based reagent | Atg9 | Forward: TCAGTACCAGCAGAAGCACG Reverse: GCAGTGCATCACAAAGGCAA | PCR primers | |
| Sequence-based reagent | Atg10 | Forward: GGCTTGTTTCCCACGCAAAA Reverse: TCCGCACTGCGAGATACCTTT | PCR primers | |
| Sequence-based reagent | Atg13 | Forward: GGCGTTGCACAAATGACAGT Reverse: CGTTCCGCTGCATTTAGACG | PCR primers | |
| Sequence-based reagent | Atg14 | Forward: ACTGATGCTGATGCCTTTCCA Reverse: GCGATGGTAGACTGCTGGTT | PCR primers | |
| Sequence-based reagent | Atg10 | Forward: TAAATGCCGAGGTGGCAAGG Reverse: TCTGTGTGCCTGGAAGAACAA | PCR primers | |
| Sequence-based reagent | Atg18a | Forward: GCACGCCAAGACCATGATTC Reverse: TTTAGTCCCCGTCGCAGTTC | PCR primers | |
| Software, algorithm | Fiji | Fiji | RRID:SCR_002285 | |
| Software, algorithm | Photoshop CC | Adobe | RRID:SCR_014199 | |
| Software, algorithm | GraphPad Prism Version 9 Software | GraphPad Prism | RRID:SCR_002798 |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Gcn5 and mTORC1 mediated regulation of autophagy controls Drosophila blood cell homeostasis
eLife 13:RP91615.
https://doi.org/10.7554/eLife.91615.4
