SMAD4 promotes somatic-germline contact during murine oocyte growth
- Research Institute, McGill University Health Centre, Canada
- Present address: Cancer CIBER (CIBERONC), Spain
- Present address: Pathology Department, Medical School, University of Valencia-INCLIVA, Spain
- Departments of Obstetrics and Gynecology and Biology, Division of Experimental Medicine, McGill University, Canada
Figures
Figure 1
SMAD4 is efficiently depleted in granulosa cells of granulosa cell-oocyte complexes (GOCs) in vitro using tamoxifen-induced Cre recombinase.
(A) Immunoblot of primordial follicles, growing follicles, and granulosa cells and oocytes isolated from antral follicles, probed using anti-SMAD4 and anti-SMAD2/3. (B) Breeding scheme to delete Smad…
Figure 2
Depletion of SMAD4 reduces transzonal projection (TZP)-number but does not affect granulosa cell communication with the oocyte or proliferation.
(A) Confocal images of granulosa cell-oocyte complexes (GOCs) five days after tamoxifen treatment stained with anti-green fluorescent protein (GFP), phalloidin to visualize F-actin and DAPI to …
Figure 3
Depletion of SMAD4 in granulosa cell-oocyte complexes (GOCs) reduces the number of transzonal projections (TZPs) per granulosa cell and alters their morphometric parameters.
(A) Schematic illustrating the experimental protocol. green fluorescent protein (GFP+) granulosa cells in clusters were used for calculations in C and individual GFP + granulosa cells were used for …
Figure 4 with 1 supplement
Depletion of SMAD4 in reaggregates reduces the number of newly generated transzonal projections (TZPs) and alters their morphometric parameters.
(A) Schematic illustrating the reaggregation procedure. (B) Three-dimensional reconstruction of a reaggregate, showing granulosa cell bodies, TZPs, and oocyte cortex. Serial optical confocal …
Figure 4—figure supplement 1
Segmentation pipeline of green fluorescent protein (GFP)-positive granulosa cells.
(A) Three-dimensional (3D) reconstruction of granulosa cells, oocyte, and transzonal projections (TZPs). (B) TZP segmentation into spots. Graph shows an example of spot subtraction of two TZPs …
Figure 5
Expression of transmembrane N-cadherin and Notch proteins is reduced in SMAD4-depleted granulosa cells.
(A) Immunoblot and graph showing mean and SEM of SMAD4 and N-cadherin in granulosa cells. Protein quantities are normalized to amounts in ER-Cre- cells. n=6. (B) As in A, showing Notch2. n=5. (C) …
Figure 6
Model for regulation of the size of the transzonal projection (TZP) population.
Upper: Dynamics of an individual TZP. When growing TZP contacts the surface of the oocyte, it becomes stably attached if there is sufficient N-cadherin, as in wild-type cells. In SMAD4-depleted …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| gene (M. musculus) | Smad4 | GenBank | Gene ID: 17128 | |
| strain, strain background (M. musculus) | Smad4tm2.1Cxd/J | Jackson Laboratories | strain 017462 | Supplied by Dr. Daniel. J. Bernard, McGill University |
| strain, strain background (M. musculus) | Amhr2tm3(cre)Bhr | MMRRC | strain 014245-UNC | Supplied by Dr. Makoto Nagano, McGill University |
| strain, strain background (M. musculus) | B6.129-Gt(ROSA)26Sortm1(cre/ERT2)Tyj/J | Jackson Laboratories | strain 008463 | |
| strain, strain background (M. musculus) | B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J | Jackson Laboratories | strain 007676 | |
| antibody | anti-SMAD2/3 (Rabbit monoclonal) | Cell Signaling Technology | 8685 RRID: AB_10889933 | 1:1000 (immunoblot) |
| antibody | anti-SMAD4 (Rabbit polyclonal) | Sigma | HPA019154 RRID: AB_1853480 | 1:1000 (immunoblot) |
| antibody | anti-N-cadherin (Mouse monoclonal) | BD Biosciences | B610920 RRID: AB_2077527 | 1:1000 (immunoblot) |
| antibody | anti-Notch2 (Rabbit polyclonal) | Abcam | Ab8926 RRID: AB_2267338 | 1:1000 (immunoblot) |
| antibody | anti-GFP (Rabbit polyclonal) | Invitrogen | A11122 RRID: AB_2307355 | 1:100 (immunofluorescence, immunohistochemistry) |
| antibody | anti-rabbit IgG-HRP (Goat polyclonal) | Promega | W4011 RRID: AB_430833 | 1:5000 (immunoblot) |
| antibody | anti-mouse IgG-HRP (Goat polyclonal) | Promega | W4021 RRID: AB_430834 | 1:5000 (immunoblot) |
| antibody | anti-rabbit IgG- Alexa 488 (Donkey polyclonal) | Invitrogen | A21206 RRID: AB_2535792 | 1:100 (immunofluorescence, immunohistochemistry) |
| sequence-based reagent | Primer for polymerase chain reaction (PCR) genotyping | Sigma | Smad4 – wild-type | 5ʹ:GGGCAGCGTAGCATATAAGA 3ʹ:GACCCAAACGTCACCTTCAG Predicted size: 390 nt |
| sequence-based reagent | Primer for PCR genotyping | Sigma | Smad4 – floxed | 5ʹ:GGGCAGCGTAGCATATAAGA 3ʹ:GACCCAAACGTCACCTTCAG Predicted size: 450 nt |
| sequence-based reagent | Primer for PCR genotyping | Sigma | Smad4 – recombined | 5ʹ:TAAGAGCCACAGGGTCAAGC 3ʹ:GACCCAAACGTCACCTTCAG Predicted size: 450 nt |
| sequence-based reagent | Primer for PCR genotyping | Sigma | Amhr2-Cre | 5ʹ:CTCTGGTGTAGCTGATGATC 3ʹ:TAATCGCCATCTTCCAGCAG Predicted size: 380 nt |
| sequence-based reagent | Primer for PCR genotyping | Sigma | Rosa26CreERT2 | 5ʹ:CGTGATCTGCAACTCAGTC 3ʹ:AGGCAAATTTTGGTGTACGG Predicted size: 150 nt |
| sequence-based reagent | Primer for reverse-transcription (RT)-PCR | Sigma | Smad4 | 5ʹ:TCACAATGAGCTTGCATTCC 3ʹ:CCATCCACAGTCACAACAGG Predicted size: 143 nt |
| sequence-based reagent | Primer for reverse-transcription (RT)-PCR | Sigma | Cdh2 (N-cadherin) | 5ʹ:CCAGGAAAAGTGGCAGGTAG 3ʹ:CACTGTGCTTGGCAAGTTGT Predicted size: 121 nt |
| sequence-based reagent | Primer for reverse-transcription (RT)-PCR | Sigma | Notch2 | 5ʹ:GACCCTATCCTACCCTCTAGTG 3ʹ:AGCAGGATGAAGAACAGGATG Predicted size: 103 nt |
| sequence-based reagent | Primer for reverse-transcription (RT)-PCR | Sigma | Myo10 | 5ʹ:TCCAGACAGACTATGGGCAGG 3ʹ:GGAAGCCATGTCGTCCACG Predicted size: 109 nt |
| sequence-based reagent | Primer for reverse-transcription (RT)-PCR | Sigma | Fscn1 | 5ʹ:AGAACGCCAGCTGCTACTTT 3ʹ:CGAGGAATCACTACCCACCG Predicted size: 331 nt |
| sequence-based reagent | Primer for reverse-transcription (RT)-PCR | Sigma | Daam1 | 5ʹ:GCGGCTGCTCAGAGTATAGAAA 3ʹ:AAACATGGCTTCCCTGTGTTTG Predicted size: 273 nt |
| sequence-based reagent | Primer for reverse-transcription (RT)-PCR | Sigma | Rpl19 | 5ʹ:GAAATCGCCAATGCCAACTC 3ʹ:CTTCCCTATGCCCATATGCC Predicted size:147 nt |
| sequence-based reagent | RNA in situ hybridization probe | Advanced Cell Diagnostics | 857571 | Smad4, exon 8 |
| sequence-based reagent | RNA in situ hybridization probe | Advanced Cell Diagnostics | 310043 | Bacillus subtilis DapB |
| commercial assay or kit | Click-iT EdU Alexa Fluor 488 Imaging Kit | Molecular Probes | C10337 | In situ detection of DNA replication |
| commercial assay or kit | BaseScope Assay | Advanced Cell Diagmostics | 322337 | In situ detection of RNA |
| chemical compound, drug | 4-hydroxytamoxifen | Sigma | T176 | 1 µg/ml |
| chemical compound, drug | Phalloidin (Alexa Fluor 568) | Thermo Fisher | A12380 | 1:100 |
| chemical compound, drug | EdU | Thermo Fisher | C10337 | 100 μM |
| software, algorithm | Imaris | Bitplane | 9.7.2 | Image analysis |
