(A–D) Immunostaining for Laminin magenta on Tg(neurog1:GFP) embryos (green) at 18 and 22 hpf (A-B’, dorsal views), and on Tg(omp:meYFP) embryos (green) at 28 and 36 hpf (C-D’, frontal views). In A, …
Same embryo as the z-section shown in Figure 1J. Confocal live imaging performed on a TgBAC(lamC1:lamC1-sfGFP);Tg(cldnb:Gal4;UAS:RFP) embryo in which Laminin γ1-sfGFP is expressed under the control …
Same embryo as the z-sections shown in Figure 1E-I and in Figure 1—video 4. Confocal live-imaging performed on a TgBAC(lamC1:lamC1-sfGFP);Tg(cldnb:Gal4;UAS:RFP) embryo in which Laminin γ1-sfGFP is …
Confocal live-imaging performed on a TgBAC(lamC1:lamC1-sfGFP);Tg(cldnb:Gal4;UAS:lyn-TagRFP) embryo in which Laminin γ1-sfGFP is expressed under the control of its own promoter (green), and OP and …
Same embryo as the z-sections shown in Figure 1E-I and Figure 1—video 2. Confocal z-stacks performed on a live TgBAC(lamC1:lamC1-sfGFP);Tg(cldnb:Gal4;UAS:RFP) embryo in which Laminin γ1-sfGFP is …
(A–I) Immunostaining for Laminin (A–C), Nidogen (D–F) and Collagen IV (G–I) (magenta) on sly mutants and control siblings at 22 (dorsal view), 28, and 36 hpf (frontal view). For Laminin and Nidogen, …
Thickness of the intercellular space in sly mutants (between OP and brain cells) and control siblings (between NCC and brain or OP cells).
A, A’ and C, C’ Examples of images of the intercellular space located between OP cells in control siblings (A, C) and in sly mutants (A’, C’), at 24 and 32 hpf. Arrows = plasma membranes. (B, D) …
Thickness of the intercellular space within OP and brain tissues in sly mutants and control siblings.
(A, B) Images (dorsal views, 1 z-section) of representative OPs from a Tg(neurog1:GFP); sly -/- mutant (right) and a control Tg(neurog1:GFP) sibling (left) at the end of OP coalescence (22 hpf). The …
OP dimensions at 22 hpf, and MSD analysis and cell displacements during OP coalescence in sly mutants and control siblings.
(A-D’) Immunostaining for Phospho-histone H3 (magenta) to label dividing cells on Tg(neurog1:GFP) embryos (green) at 16 hpf and 21 hpf (A-B’ show images at 21 hpf, dorsal view), and on Tg(omp:meYFP) …
Analysis of OP proliferation and apoptosis and total number of YFP+ cells in sly mutants and control siblings.
Same embryos as the images and analyses shown in Figure 3F-I. Confocal live imaging showing OP coalescence movements in sly mutant and control Tg(neurog1:GFP) embryos, in which OP and brain neurons …
(A, B) Images (frontal view, 1 z-section) of representative placodes from a Tg(omp:meYFP); sly -/- mutant (right) and a control Tg(omp:meYFP) sibling (left) at 36 hpf. Laminin immunostaining in …
OP dimensions at 36 hpf, and MSD analysis and angles of OP cell trajectories from 22 hpf in sly mutants and control siblings.
(A-L) Analysis of OP dimensions at 24, 28, and 32 hpf. (A, A’, E, E’ and I, I’) Images (frontal views, 1 z-section) of representative OPs from Tg(omp:meYFP); sly -/- mutants (right) and control Tg(om…
OP dimensions at 24, 28, and 32 hpf in sly mutants and control siblings.
Same embryos as the images and analyses shown in Figure 4I-L. Confocal live imaging showing OP cell movements and axon behaviours in sly mutant and control Tg(omp:meYFP) embryos, in which …
The embryos are at 28 hpf and carry the Tg(omp:meYFP) transgene to visualise the membrane of ompb-expressing OP neurons and their axons (green). In control embryos, the bundle of axons exit the OP …
(A, A’) Immunostaining for HuC (cyan) at 36 hpf on Tg(cldnb:Gal4; UAS:RFP) (magenta) control and sly mutant embryos (frontal view). Similar immunostainings performed at 28 hpf are shown in Figure …
Brain width measurements and distortion index of the OP/brain boundary in sly mutants and control siblings.
(A, A’) Immunostaining for HuC (cyan) at 28 hpf performed on Tg(cldnb:Gal4; UAS:RFP) (magenta) control and sly mutant embryos (frontal view). Similar immunostainings performed at 36 hpf are shown in …
Brain width measurements and analysis of brain proliferation and apoptosis in sly mutants and control siblings.
(A, A’) In situ hybridisation for the NCC marker crestin on 32 hpf controls and sly mutants. Arrowheads = crestin-positive NCC cluster at the OP/brain interface, which is absent in sly mutants. (B) …
(A, B) In situ hybridisation for the NCC marker crestin on 32 hpf controls and foxd3 mutants. Arrowheads = crestin-positive NCC cluster at the OP/brain interface, which is absent in foxd3 mutants. (C…
OP dimensions and length of the axon bundle in foxd3 mutants and controls siblings.
sly mutant and control Tg(cldnb:Gal4;UAS:RFP) embryos, in which OP and peridermal skin cells are labelled in with cytoplasmic RFP (magenta), were immunostained for HuC (cyan) at 28 hpf and 36 hpf to …
Confocal live imaging from 16 to 32 hpf showing OP and NCC cell movements in sly mutant and control Tg(neurog1:GFP);Tg(UAS:RFP) embryos injected with the sox10(7.2):KalTA4 plasmid. The DNA injection …
(A, B) Images extracted from confocal live imaging on control (A-A’’’’) and sly mutant (B-B’’’’) embryos injected with the omp:meYFP plasmid to obtain a mosaic labelling of OP neurons and their …
Mean speed and persistence of growth cones in sly mutants and control siblings.
Angles of growth cone trajectories in sly mutants and control siblings.
(A, B) Images extracted from confocal live imaging experiments performed during OP coalescence on Tg(cldnb:Gal4; UAS:RFP) embryos injected with the neurog1:GFP plasmid, allowing a sparse labelling …
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Strain (Danio rerio) | Zebrafish wild-type hybrid (TL x AB) strains | IBPS aquatic facility, Paris | N/A | |
Strain (Danio rerio) | slywi390 (sly/lamc1) | Wiellette et al., 2004; PMID:15593329 | ZDB-ALT-050317–6 | |
Strain (Danio rerio) | foxd3zdf10 | Stewart et al., 2006; PMID:16499899 | ZDB-ALT-060519–4 | |
Strain (Danio rerio) | Tg(–8.4neurog1:GFP)sb1 | Blader et al., 2003; PMID:12559493 | ZDB-ALT-030904–6 | |
Strain (Danio rerio) | Tg(–2.0ompb:gapYFP)rw032 | Sato et al., 2007; PMID:17301169 | ZDB-ALT-050513–2 | |
Strain (Danio rerio) | Tg(–4.0cldnb:GalTA4, cry:RFP)nim11 | Breau et al., 2013; PMID:24082091 | ZDB-ALT-130822–6 | |
Strain (Danio rerio) | Tg(14XUAS:mRFP,Xla.Cryg:GFP)tpl2 | Balciuniene et al., 2013; PMID:24034702 | ZDB-ALT-131119–25 | |
Strain (Danio rerio) | TgBAC(lamc1:lamc1-sfGFP,cryaa:Cerulean)sk116Tg | Yamaguchi et al., 2022; PMID:35165417 | ZDB-ALT-241010–5 | |
Strain (Danio rerio) | Tg(eltC:GFP)zf199Tg | Stedman et al., 2009; PMID:19152797 | ZDB-ALT-101103–3 | |
Strain (Danio rerio) | Tg(UAS:lyn-tagRFP) | This study | Lab of Filippo Del Bene, Institut de la Vision, Paris | |
Antibody | Rabbit anti-Laminin polyclonal | Sigma-Aldrich | Cat# L9393; RRID:AB_477163 | 1/200 |
Antibody | Rabbit anti-Nidogen polyclonal | Abcam | Cat# ab14511, RRID:AB_301290 | 1/200 |
Antibody | Rabbit anti-Collagen IV polyclonal | Abcam | Cat# ab6586, RRID:AB_305584 | 1/200 |
Antibody | Chicken anti-GFP polyclonal | Aves labs | Cat# GFP-1020, RRID:AB_10000240 | 1/200 |
Antibody | Rabbit anti-DsRed polyclonal | Takara Bio | Cat# 632496; RRID:AB_10013483 | 1/300 |
Antibody | Rabbit anti phospho-Histone H3 polyclonal | Millipore | Cat# 06–570; RRID:AB_310177 | 1/200 |
Antibody | Rabbit anti Caspase 3, active form polyclonal | R and D Systems | Cat# AF835; RRID:AB_2243952 | 1/200 |
Antibody | Mouse anti-HuC/HuD clone 16A11 | ThermoFisher scientific | Cat# A-21271, RRID:AB_221448 | 1/200 |
Antibody | Mouse anti-Dlx3b monoclonal | ZIRC | Cat# anti-DLX3b, RRID:AB_10013771 | 1/500 |
recombinant DNA reagent | 10XUAS:lyn-tagRFP plasmid | This study | Gateway cloning, Lab of Filippo Del Bene, Institut de la Vision, Paris | |
recombinant DNA reagent | –2.0ompb:gapYFP plasmid | Miyasaka et al., 2005; PMID:15716341 | ZDB-TGCONSTRCT-070117–121 | |
recombinant DNA reagent | sox10(7.2):KalTA4 plasmid | Almeida and Lyons, 2015; PMID:26485616 | ZDB-TGCONSTRCT-170418–9 | |
sequence-based reagent | FW genotyping primer for slywi390 | This study | CATGACGGCAAAGTTGGTGA | |
sequence-based reagent | RV1 genotyping primer for slywi390 | This study | CCATGCCTTGCAAAATGGCGTTA CTTAA | |
sequence-based reagent | RV2 genotyping primer for slywi390 | This study | TGTAGGAGAGAAGTCGCGAG | |
sequence-based reagent | crestin PCR amplification for ISH probe synthesis FW primer | This study | AAGCCCTCGAAACTCACCTG | |
sequence-based reagent | crestin PCR amplification for ISH probe synthesis RV primer | This study | CCACTTGATTCCCACGAGCT | |
Commercial assay or kit | Multisite Gateway system kit | Invitrogen | Cat# 12537–023 | |
software, algorithm | LASX | Leica | RRID:SCR_013673 | |
software, algorithm | Fiji | https://imagej.net/Fiji/Downloads | RRID:SCR_002285 | |
software, algorithm | Ilastik | https://www.ilastik.org/ | RRID:SCR_015246 | |
software, algorithm | Prism | GraphPad https://www.graphpad.com/ | RRID:SCR_002798 | |
software, algorithm | Numpy library, Python | Harris et al., 2020 | RRID:SCR_008633 | |
software, algorithm | Matlab | The Mathworks, Inc. https://fr.mathworks.com/products/matlab.html | RRID:SCR_001622 |