Syntaxin 17 recruitment to mature autophagosomes is temporally regulated by PI4P accumulation
- Department of Biochemistry and Molecular Biology, Graduated School of Medicine, The University of Tokyo, Japan
- Department of Biosystems Science, Institute for Life and Medical Sciences, Kyoto University, Japan
- Department of Molecular Oncology, Institute for Advanced Medical Sciences, Nippon Medical School, Japan
Figures
Figure 1 with 1 supplement
The recruitment of STX17 to autophagosomes is dependent on its positively charged C-terminal region.
(A) Schematic representation of the structures of STX17 and its C-terminal variants. The positively (orange) and negatively (blue) charged residues are shown. Alanine substitutions are shown in …
-
Figure 1—source data 1
Data used for graphs presented in Figure 1C, D and E and Figure 1—figure supplement 1B.
- https://cdn.elifesciences.org/articles/92189/elife-92189-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Recruitment of STX17 depends on the abundance of cationic amino acids in the C-terminal region but not on its specific amino acid sequence.
(A) Multiple sequence alignment of STX17 proteins from Homo sapiens (Hs), Mus musculus, Danio rerio, Ciona intestinalis, Drosophila melanogaster (Dm), and Caenorhabditis elegans (Ce). Identical …
Figure 2 with 1 supplement
The membrane of autophagosomes becomes negatively charged during maturation.
(A) GFP–STX17TM translated in vitro was incubated with rhodamine-labeled liposomes containing the indicated concentrations of phospholipids: 70% phosphatidylcholine (PC), 20% …
-
Figure 2—source data 1
Data used for graphs presented in Figure 2A, B, D and E.
- https://cdn.elifesciences.org/articles/92189/elife-92189-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
The membrane of autophagosomes becomes negatively charged during maturation.
(A) Mouse embryonic fibroblasts stably expressing one of the GFP-tagged charge probes and mRuby3–LC3B were cultured in starvation medium for 1 hr. (B) Time-lapse analysis of MEFs stably expressing …
Figure 3 with 2 supplements
Phosphatidylinositol 4-phosphate (PI4P) is enriched in the autophagosomal membrane during maturation.
(A) Mouse embryonic fibroblasts (MEFs) stably expressing GFP–CERT(PHD) and mRuby3–STX17TM or mRuby3–ATG5 were cultured in starvation medium for 1 hr. GFP intensities of mRuby3-positive structures (n>…
-
Figure 3—source data 1
Data used for graphs presented in Figure 3A and Figure 3—figure supplement 2C.
- https://cdn.elifesciences.org/articles/92189/elife-92189-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Localization of phospholipids in mature autophagosomes.
(A) Mouse embryonic fibroblasts (MEFs) stably expressing the indicated GFP-tagged phospholipid probe and mRuby3–STX17TM were cultured in starvation medium for 1 hr. The following phospholipid probes …
Figure 3—figure supplement 2
Phosphatidylinositol 4-phosphate (PI4P) is enriched in mature autophagosomes before fusion with lysosomes.
(A and B) Mouse embryonic fibroblasts (MEFs) stably expressing the indicated GFP-tagged PI4P probe, CERT(PHD)(W33A), FAPP(PHD), OSBP(PHD) or P4M-SidMx2, and mRuby3–STX17TM or mRuby3–ATG5 were …
Figure 4 with 1 supplement
STX17 recruitment to autophagosomes depends on phosphatidylinositol 4-phosphate (PI4P) in vitro.
(A) Schematic representation of the in vitro autophagosome recruitment assay. Isolated autophagosomes were mixed with mGFP–STX17TM and either recombinant Sac1-phosphatase domain (Sac1PD) or its …
-
Figure 4—source data 1
Data used for graphs presented in Figure 4D, Figure 4—figure supplement 1A, B.
- https://cdn.elifesciences.org/articles/92189/elife-92189-fig4-data1-v1.xlsx
-
Figure 4—source data 2
Uncropped blot images of Figure 4B and C.
- https://cdn.elifesciences.org/articles/92189/elife-92189-fig4-data2-v1.zip
Figure 4—figure supplement 1
The PI 4-kinase inhibitor NC03 failed to suppress autophagosomal PI4P accumulation and STX17 recruitment.
HEK293T cells stably expressing mRuby3–STX17TM (A) or mRuby3–CERT(PHD) (B) and HaloTag-LC3B were cultured in starvation medium for 1 hr and then treated with and without 10 μM NC03 for 10 min. …
Figure 5 with 3 supplements
Molecular dynamics simulations of phosphatidylinositol 4-phosphate (PI4P)-dependent STX17TM insertion into membranes.
(A, C and E) An example of a time series of simulated results of STX17TM insertion into a membrane consisting of 70% phosphatidylcholine (PC), 20% phosphatidylethanolamine (PE), and 10% PI4P …
-
Figure 5—source data 1
Data used for graphs presented in Figure 5B, D and F.
- https://cdn.elifesciences.org/articles/92189/elife-92189-fig5-data1-v1.xlsx
Figure 5—video 1
Molecular dynamics simulations of STX17TM insertion into a phosphatidylinositol 4-phosphate (PI4P)-containing membrane.
STX17TM is shown in blue. Phosphorus in POPC (70%), POPE (20%), and PI4P (10%) are indicated by yellow, cyan, and red spheres, respectively. Short-tailed lipids are represented by green sticks. This …
Figure 5—video 2
Molecular dynamics simulations of STX17TM insertion into a membrane without phosphatidylinositol 4-phosphate (PI4P).
STX17TM is shown in blue. Phosphorus in POPC (70%) and POPE (30%) are indicated in yellow and cyan, respectively. Short-tailed lipids are represented by green sticks. This video corresponds to Figure…
Figure 5—video 3
Molecular dynamics simulations of STX17TM insertion into a phosphatidylinositol (PI)-containing membrane.
STX17TM is shown in blue. Phosphorus in POPC (70%), POPE (20%), and PI (10%) are indicated by yellow, cyan, and orange spheres, respectively. Short-tailed lipids are represented by green sticks. …
Author response image 1
The PI 4-kinase inhibitor NC03 failed to suppress autophagosomal PI4P accumulation and STX17 recruitment.
HEK293T cells stably expressing mRuby3–STX17TM (A) or mRuby3–CERT(PHD) (B) and Halotag-LC3 were cultured in starvation medium for 1 h and then treated with and without 10 μM NC03 for 10 min. …
Author response image 2
Molecular dynamics simulations showing that phosphatidylinositol is not sufficient for STX17TM insertion into membranes.
(E) An example of a time series of simulated results of STX17TM insertion into a membrane consisting of 70% phosphatidylcholine (PC), 20% phosphatidylethanolamine (PE), and 10% phosphatidylinositol …
Author response image 3
GFP–STX17TM translated in vitro was incubated with rhodamine-labeled liposomes containing 70% PC, 20% PE and 10% PI4P in the presence of 1 M NaCl or 1.
2 M sucrose. GFP intensities of liposomes were quantified and shown as in Figure 1C (n > 30).
Author response image 4
Mouse embryonic fibroblasts (MEFs) stably expressing GFP–CERT(PHD)(W33A) and mRuby3–STX17TM were cultured in starvation medium for 1 h.
Bars indicate 10 μm (main images) and 1 μm (insets).
Author response image 5
WT and ATG8 hexa KO HeLa cells stably expressing GFP–STX17TM and transiently expressing mRuby3–CERT(PHD) were cultured in starvation medium.
Bars indicate 10 μm (main images) and 1 μm (insets).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (H. sapiens) | STX17 | https://doi.org/10.1016/j.cell.2012.11.001 | ||
| Gene (D. melanpgaster) | STX17 | NCBI Reference Sequence | NM_079202 | |
| Gene (C. elegans) | STX17 | NCBI Reference Sequence | NM_059941 | |
| Gene (R. norvegicus) | LC3B | https://doi.org/10.1083/jcb.200712064 | ||
| Gene (M. musculus) | ATG5 | NCBI Reference Sequence | NM_053069 | |
| Gene (H. sapiens) | 2×Spo20(PABD) | https://doi.org/10.1074/jbc.M116.742346 | NM_005633; amino acids 422–551 | For GFP tagged phospholipid probes |
| Gene (H. sapiens) | CERT(PHD) | https://doi.org/10.1007/s11010-005-9044-z | NM_001130105; amino acids 1–116 | For GFP tagged phospholipid probes |
| Gene (H. sapiens) | FAPP | https://doi.org/10.1091/mbc.e04-07-0578 | NM_001807; amino acids 1–101 | For GFP tagged phospholipid probes |
| Gene (H. sapiens) | OSBP | https://doi.org/10.1016/s0960-9822(98)70296-9 | NM_002556; amino acids 87–185 | For GFP tagged phospholipid probes |
| Gene (H. sapiens) | 2×ING2(PlantHD) | https://doi.org/10.1016/s0092-8674(03)00,480x | NM_001564; amino acids 190–280 | For GFP tagged phospholipid probes |
| Gene (H. sapiens) | 2×TAPP1(PHD) | https://doi.org/10.1042/bj3510019 | NM_001001974; amino acids 184–304 | For GFP tagged phospholipid probes |
| Gene (H. sapiens) | 2×TRPML1(PHD) | https://doi.org/10.1038/ncomms1037 | NM_020533; amino acids 1–69 | For GFP tagged phospholipid probes |
| Gene (H. sapiens) | Btk | https://doi.org/10.1016/s0969-2126(99)80057-4 | NM_000061; amino acids 1–177 | For GFP tagged phospholipid probes |
| Gene (H. sapiens) | PLCd1 | https://doi.org/10.1083/jcb.143.2.501 | NM_017035; amino acids 1–175 | For GFP tagged phospholipid probes |
| Gene (S. cerevisiae) | Sac1 | NCBI Reference Sequence | NM_001179777 | |
| Antibody | Mouse monoclonal anti-TOMM20 | Santa Cruz Biotechnology, Inc. | sc-11415 | 1:10,000 for WB |
| Antibody | Rabbit polyclonal anti-LAMP1 | Abcam | ab24170 | 1:10,000 for WB, 1:1000 for IF |
| Antibody | Rabbit polyclonal anti-p62 | MBL | PM045 | 1:10,000 for WB |
| Antibody | Rabbit polyclonal anti-LC3 | https://doi.org/10.1093/emboj/19.21.5720 | 1:10,000 for WB | |
| Antibody | HRP-conjugated anti-mouse IgG | Jackson ImmunoResearch Laboratories | 111-035-003 | 1:10,000 for WB |
| Antibody | HRP-conjugated anti-Rabbit IgG | Jackson ImmunoResearch Laboratories | 111-035-144 | 1:10,000 for WB |
| Antibody | Alexa Fluor 660-anti-rabbit IgG | Molecular Probes | A-21074 | 1:1000 for IF |
| Cell line (H. sapiens) | HeLa | RIKEN | RCB0007 | |
| Cell line (H. sapiens) | HEK293T | RIKEN | RCB2202 | |
| Cell line (M. musculus) | MEF | https://doi.org/10.1016/j.cell.2012.11.001 | Established from C57BL/6 mice | |
| Cell line (H. sapiens) | STX17 KO HeLa | https://doi.org/10.1083/jcb.201712058 | ||
| Cell line (H. sapiens) | ATG8 hexa KO HeLa | https://doi.org/10.1083/jcb.201607039 | Kindly provided by Michael Lazarou | |
| Chemical compound, drug | Lipofectamine 2000 | Thermo Fisher Scientific | 11668019 | |
| Chemical compound, drug | FuGENE HD | Promega | VPE2311 | |
| Chemical compound, drug | Lysotracker Red DND99 | Thermo Fisher Scientific | L7528 | 50 nM |
| Chemical compound, drug | LysoTracker Deep Red | Thermo Fisher Scientific | L12492 | 50 nM |
| Chemical compound, drug | SaraFluor 650T HaloTag ligand | GoryoChemical | A308-02 | |
| Chemical compound, drug | Cellfectin II | Thermo Fisher Scientific | 10362100 | |
| Chemical compound, drug | Glutathione Sepharose 4B | GE Healthcare | 17075601 | |
| Chemical compound, drug | HRV3C protease | Fujifilm Wako Pure Chemical Corp. | 206–18151 | |
| Chemical compound, drug | CBB Stain One Super | Nacalai Tesque | 11642–31 | |
| Chemical compound, drug | DOPC | Avanti Polar Lipids | 850375 C | |
| Chemical compound, drug | DOPE | Avanti Polar Lipids | 850725 C | |
| Chemical compound, drug | DOPS | Avanti Polar Lipids | 840035 P | |
| Chemical compound, drug | 18:1 PI | Avanti Polar Lipids | 850149 P | |
| Chemical compound, drug | 18:1 PI3P | Avanti Polar Lipids | 850150 P | |
| Chemical compound, drug | 18:1 PI4P | Avanti Polar Lipids | 850151 P | |
| Chemical compound, drug | DSPE-PEG(2000) Biotin | Avanti Polar Lipids | 880129 C | |
| Chemical compound, drug | 18:1 Liss Phod PE | Avanti Polar Lipids | 810150 C | |
| Chemical compound, drug | OptiPrep | Cosmo Bio | 1893 | |
| Chemical compound, drug | NeutrAvidin Protein | Thermo Fisher Scientific | 31000 | |
| Chemical compound, drug | Lipofectamine RNAiMAX | Thermo Fisher Scientific | 13778150 | |
| Chemical compound, drug | digitonin | Sigma-Aldrich | D141 | |
| Chemical compound, drug | polybrane | Sigma-Aldrich | H9268 | |
| Chemical compound, drug | puromycin | Sigma-Aldrich | P8833 | |
| Chemical compound, drug | blasticidin | Fujifilm Wako Pure Chemical Corp. | 2218713 | |
| Chemical compound, drug | geneticin | Thermo Fisher Scientific | 10131 | |
| Chemical compound, drug | zeocin | Thermo Fisher Scientific | R25005 | |
| Commercial assay or kit | mMACHINE SP6 Transcription Kit | Thermo Fisher Scientific | AM1340 | |
| Commercial assay or kit | Rabbit reticulocyte lysates | Promega | L4960 | |
| Strain (E. coli) | DH10Bac | Thermo Fisher Scientific | 10361012 | |
| Cell line (T. ni) | High Five | Thermo Fisher Scientific | BTI-TN-5B1-4; B85502 | |
| Recombinant DNA reagent | D. melanogaster cDNA | Kindly provided by Masayuki Miura | ||
| Recombinant DNA reagent | C. elegans cDNA | Kindly provided by Hiroyuki Arai | ||
| Recombinant DNA reagent (plasmid) | pFastBac Dual Expression vector | Thermo Fisher Scientific | 10712024 | |
| Recombinant DNA reagent (plasmid) | GFP–Evectin-2 | Kindly provided by Hiroyuki Arai | For GFP-tagged phospholipid probes | |
| Recombinant DNA reagent (plasmid) | GFP–PKD C1ab | Kindly provided by Tamas Balla | For GFP-tagged phospholipid probes | |
| Recombinant DNA reagent (plasmid) | mRFP–2×FYVE | Kindly provided by Harald Stenmark | For GFP-tagged phospholipid probes | |
| Recombinant DNA reagent (plasmid) | GFP–P4M-SidMx2 | Addgene | 51472 | For GFP-tagged phospholipid probes |
| Recombinant DNA reagent (plasmid) | pCG-gag-pol | Kindly provided by Teruhiko Yasui | For GFP-tagged phospholipid probes | |
| Recombinant DNA reagent (plasmid) | pCG-VSV-G | Kindly provided by Teruhiko Yasui | For GFP-tagged phospholipid probes | |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-STX17TM(DDDDD) | This paper | SN104 | Figure 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-STX17TMΔC | This paper | SN106 | Figure 1, Figure 1—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-STX17TM(RRRRR) | This paper | SN118 | Figure 1, Figure 1—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-STX17TM(KKKKK) | This paper | SN84 | Figure 1, Figure 1—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-STX17TM(AAAAA) | This paper | SN85 | Figure 1, Figure 1—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-STX17TM(0KR) | This paper | SN178 | Figure 1, Figure 1—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-STX17TM(1KR) | This paper | SN177 | Figure 1, Figure 1—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-STX17TM(2KR) | This paper | SN168 | Figure 1, Figure 1—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-STX17TM(3KR) | This paper | SN159 | Figure 1, Figure 1—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-STX17TM | https://doi.org/10.1016/j.cell.2012.11.001 | Addgene; 45910 | Figure 1, Figure 1—figure supplement 1, Figure 3—figure supplement 2 |
| Recombinant DNA reagent (plasmid) | pMRXIB-mRuby3-LC3 | This paper | SN219 | Figure 1, Figure 1—figure supplement 1, Figure 2, Figure 2—figure supplement 1, Figure 3—figure supplement 1, Figure 3—figure supplement 2, Figure 4 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-Dmela STX17TM | This paper | SN162 | Figure 1—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-Celegans Syx17TM | This paper | SN163 | Figure 1—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-9K0Q | This paper | SN267 | Figure 2, Figure 2—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-5K4Q | This paper | SN268 | Figure 2, Figure 2—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-3K6Q | This paper | SN269 | Figure 2, Figure 2—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-1K8Q | This paper | SN270 | Figure 2, Figure 2—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-0K9Q | This paper | SN277 | Figure 2, Figure 2—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIB-mRuby3-STX17TM | This paper | SN236 | Figure 2, Figure 2—figure supplement 1, Figure 3, Figure 3—figure supplement 1, Figure 3—figure supplement 2, Figure 4—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-OSBP(PHD) | This paper | SN128 | Figure 3, Figure 3—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-CERT(PHD) | This paper | SN232 | Figure 3, Figure 3—figure supplements 1 and 2 |
| Recombinant DNA reagent (plasmid) | pMRXIP-P4M-SidMx2 | This paper | SN247 | Figure 3, Figure 3—figure supplement 2 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-FAPP(PHD) | This paper | SN231 | Figure 3, Figure 3—figure supplement 2 |
| Recombinant DNA reagent (plasmid) | pMRXIP-HaloTag7-LC3 | https://doi.org/10.7554/eLife.78923 | Addgene; 184899 | Figure 3, Figure 4—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIB-WIPI2b-mRuby3 | This paper | SN214 | Figure 3C |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-2xFYVE | This paper | SN262 | Figure 3—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-ING2(PHD) | This paper | SN129 | Figure 3—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-TRPML1(PHD) | This paper | SN132 | Figure 3—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-PLCd1(PHD) | This paper | SN131 | Figure 3—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-Evectin-2 | This paper | SN115 | Figure 3—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-PKD C1ab | This paper | SN125 | Figure 3—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pMRXIP-Btk1(PHD)-GFP | This paper | SN133 | Figure 3—figure supplement 1A |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-TAPP1(PHD) | This paper | SN130 | Figure 3—figure supplement 1A |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-Spo20(PABD) | This paper | SN124 | Figure 3—figure supplement 1A |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-PI4KB | This paper | SN199 | Figure 3—figure supplement 1C |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-PI4K2A | This paper | SN190 | Figure 3—figure supplement 1C |
| Recombinant DNA reagent (plasmid) | pMRXIP-GFP-CERT(PHD)(W33A) | This paper | pmSS123 | Figure 3—figure supplement 2 |
| Recombinant DNA reagent (plasmid) | pMRXIB-mRuby3-CERT(PHD) | This paper | SN313 | Figure 3—figure supplement 2, Figure 4—figure supplement 1 |
| Recombinant DNA reagent (plasmid) | pFastBacDual-GST-PreSci-ScSac1PD (WT) | This paper | HY580 | Figure 4 |
| Recombinant DNA reagent (plasmid) | pFastBacDual-GST-PreSci-ScSac1PD (C392S) | This paper | HY581 | Figure 4 |
| Recombinant DNA reagent (plasmid) | pFastBacDual-GST-PreSci-TEV-mGFP-STX17TM | This paper | HY1370 | Figure 4 |
| Sequence-based reagent | human YKT6 siRNA antisense | https://doi.org/10.1083/jcb.201712058 | GGTGTGGTCATTGCTGACAATGAAT | |
| Sequence-based reagent | human YKT6 siRNA antisense sense | https://doi.org/10.1083/jcb.201712058 | ATTCATTGTCAGCAATGACCACACC | |
| Sequence-based reagent | human STX17 siRNA antisense | https://doi.org/10.1016/j.cell.2012.11.001 | AATTAAGTCCGCTTCTAAGGTTTCC | |
| Sequence-based reagent | human STX17 siRNA antisense sense | https://doi.org/10.1016/j.cell.2012.11.001 | GGAAACCTTAGAAGCGGACTTAATT | |
| Software, algorithm | FIJI-Image J | https://imagej.net/Fiji/Downloads | Image analysis were done using Fiji-Image J and plugins | |
| Software, algorithm | Illustrator | Adobe | Images were mounted using these softwares | |
| Software, algorithm | GraphPad prism | GraphPad Prism | Graphs and statistical tests were done using GraphPad Prism |
