TRIP13 localizes to synapsed chromosomes and functions as a dosage-sensitive regulator of meiosis
- Department of Biomedical Sciences, University of Pennsylvania School of Veterinary Medicine, United States
- College of Life Sciences, Capital Normal University, China
Figures
Figure 1 with 1 supplement
TRIP13 localizes to the synaptonemal complex and telomeres in spermatocytes.
(A) Western blot analysis of TRIP13 in adult mouse tissues. Heart and skeletal muscle lack ACTB. (B) Immunofluorescence of TRIP13 in sections of 3-month-old wild type and Trip13-/- testes. Lep, leptotene; Zyg, zygotene; Pac, pachytene; eS, elongating spermatids; ES, elongated spermatids. (C) Immunofluorescence of TRIP13 in spread nuclei of spermatocytes from wild type P20 testes. (D) Super-resolution localization of TRIP13 to the central element (CE) but not lateral element (LE) of the synaptonemal complex at early pachytene stage. The enlarged view of the boxed chromosome is shown at the bottom.
-
Figure 1—source data 1
Original files of the full raw unedited western blots in Figure 1A.
- https://cdn.elifesciences.org/articles/92195/elife-92195-fig1-data1-v1.pdf
Figure 1—figure supplement 1
Immunofluorescent analysis of TRIP13 in spread nuclei of oocytes from embryonic day 16.5 (E16.5) and E18.5 female embryos.
Scale bars, 10 µm.
Figure 2 with 1 supplement
Loss of Trip13 leads to meiotic arrest in males.
(A) Image of testes from 2- to 3-month-old mice. (B) Western blot analysis of TRIP13 in P21 testes. SYCP3 serves as a meiosis-specific marker. ACTB serves as a loading control. (C) Testis to body weight ratio of 2–3-month-old mice. n = 3 males. Statistics, one-way ANOVA. (D) Sperm count of 2–3-month-old Trip13+/+ and Trip13+/- males. n = 3 males. Statistics, one-way ANOVA. (E) Histological analysis of 2-month-old testes. Sertoli, Sertoli cell; Zyg, zygotene; Pa-like, pachytene-like; Dip, diplotene; eS, elongating spermatids.
-
Figure 2—source data 1
Original files of the full raw unedited western blots in Figure 2B.
- https://cdn.elifesciences.org/articles/92195/elife-92195-fig2-data1-v1.pdf
Figure 2—figure supplement 1
Histological analysis of ovaries from adult (8-week) wild type and Trip13-/- females.
Scale bars, 200 µm.
Figure 3
Trip13 is required for chromosomal synapsis in males.
(A) Composition of prophase I spermatocytes in P20 testes. Three males per genotype were analyzed by nuclear spread analysis. Total number of spermatocytes counted: Trip13+/+, 1038 cells; Trip13+/-, 803 cells; Trip13-/-, 406 cells. (B) Immunofluorescence of SYCP1 and SYCP3 in spread nuclei of pachytene spermatocytes from P20 testes. (C) Immunofluorescence of SYCE1 and SYCP3 in spread nuclei of pachytene spermatocytes from P20 testes. (D) Super-resolution confocal microscopy of a Trip13-/- spermatocyte from P20 testis. Immunostaining was performed for SYCP1 and SYCP3. Arrowheads indicate end asynapsis. Arrow indicates interstitial asynapsis. (E) Percentage of early pachytene cells from P19-20 testes with asynapsed chromosomes across three genotypes. (F) Number of homologous chromosomes with end asynapsis per cell in P19-20 testes. (G) Percentage of early pachytene cells from P20 testes with asynapsed XY chromosomes per mouse. The p-values are indicated in graphs. Statistics (E–G), one-way ANOVA.
Figure 4 with 1 supplement
Normal localization of centromere and telomere markers in Trip13-deficient spermatocytes from juvenile mice.
(A–D) Immunofluorescent analysis of centromere and telomere markers in Trip13+/+ and Trip13-/- pachytene spermatocytes: CREST (A), CENPC (B), TRF1 (C), and MAJIN (D). SYCP3 labels the lateral elements of the synaptonemal complex. Scale bars, 10 µm.
Figure 4—figure supplement 1
Immunofluorescent analysis of REC114 in spread nuclei of spermatocytes from P28 wild type (Trip13+/+) and Trip13-/- testes.
Wild type, early pachytene; Trip13-/-, pachytene-like. REC114 foci are indicated by arrows. Scale bar, 10 μm.
Figure 5
HORMAD1 and HORMAD2 accumulate on the lateral elements of synapsed autosomes in Trip13-/- spermatocytes from juvenile (P19-21) mice.
(A, B) Immunofluorescence of HORMAD1 (A) and HORMAD2 (B) in pachytene spermatocytes. (C, D) Super-resolution imaging of HORMAD1 and HORMAD2 in zygotene and pachytene spermatocytes. Enlarged views of the boxed chromosomes are shown below. Scale bars: 10 µm (A, B), 5 µm (C, D).
Figure 6
Localization of TRIP13 to the synaptonemal complex (SC) is independent of individual axial element components.
(A) Immunofluorescent analysis of TRIP13 in Hormad1-/- spermatocytes from 2-month-old mice. (B) Immunofluorescent analysis of TRIP13 in Rec8-/- spermatocytes from 2-month-old mice. (C) Immunofluorescent analysis of TRIP13 in Sycp2-/- spermatocytes from 2-month-old mice. (D) Immunofluorescent analysis of TRIP13 in Skp1cKO spermatocytes from 2-month-old mice. Scale bars, 10 µm.
Figure 7 with 1 supplement
FLAG-tagged TRIP13 proteins localize correctly and are functional.
(A) Western blot analysis of tagged and untagged TRIP13 proteins in testes from P20 wild type (no tag), heterozygous-tagged, and homozygous-tagged males. (B) Immunofluorescence of FLAG-tagged TRIP13 in pachytene spermatocytes from P20 homozygous testes. N-terminal tag, 3×FLAG-Trip13; C-terminal tag, Trip13−3×FLAG. Scale bar, 10 μm. (C) A schematic illustration of TRIP13, SKP1, HORMAD1/2, and the synaptonemal complex. Relative locations of TRIP13 and SKP1 within the synaptonemal complex (SC) are depicted. HORAMD1/2 are retained in synapsed regions in Trip13-deficient or Skp1-deficient spermatocytes.
-
Figure 7—source data 1
Original files of the full raw unedited western blots in Figure 7B.
- https://cdn.elifesciences.org/articles/92195/elife-92195-fig7-data1-v1.pdf
Figure 7—figure supplement 1
Generation of two Trip13 FLAG-tagged mouse lines.
(A) Illustration of the Trip13 gene structure with the 3×FLAG tag at the N terminus. The guide RNA sequence is underlined in green. The single-strand DNA (ssDNA) oligo template (200 nt) contains the 3×FLAG-encoding sequence. The PAM site is underlined in purple. One base in the PAM site is mutated in the ssDNA oligo template to prevent cutting of the template strand (in purple). The position of 3×FLAG in-frame insertion is designated (^) and occurs just after the endogenous start codon. Filled bars, coding regions; Open bars, 5′ or 3′ UTRs. (B) Illustration of the Trip13 gene structure with the 3×FLAG tag at the C terminus. The PAM cut site and guide RNA were on the reverse strand, but for clarity, the forward strand sequence is shown. The 3×FLAG was inserted just before the endogenous stop codon.
Tables
Table 1
List of proteins from testis identified by co-immunoprecipitation and mass spectrometry.
| Protein | Number of peptides in anti-FLAG IP | MW (kDa) | ||
|---|---|---|---|---|
| 3×FLAG-TRIP13 testis | TRIP13−3×FLAG testis | Wild type testis | ||
| TRIP13 | 28 | 36 | 4 | 51 |
| HORMAD2 | 21 | 10 | 7 | 39 |
| DDX46 | 32 | 6 | 0 | 117 |
| PUF60 | 24 | 14 | 0 | 59 |
| RBM25 | 19 | 3 | 2 | 100 |
| RBM39 | 20 | 10 | 1 | 59 |
| U2AF1 | 11 | 4 | 1 | 28 |
| U2AF2 | 15 | 9 | 3 | 54 |
| SRSF11 | 9 | 4 | 0 | 53 |
| SPATA5 | 26 | 27 | 7 | 97 |
| AP3D1 | 17 | 6 | 2 | 135 |
| PRPF40A | 16 | 3 | 0 | 108 |
| UGP2 | 15 | 3 | 0 | 57 |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Trip13 | GenBank | Gene ID: 69716 | |
| Genetic reagent (M. musculus) | Trip13tm1.1(KOMP)Vlcg/JMmucd | MMRCC | MMRRC_050223-UCD | |
| Genetic reagent (M. musculus) | Hormad1 knockout | PMID:21079677; Shin et al., 2010 | Rajkovic lab | |
| Genetic reagent (M. musculus) | Sycp2 knockout | PMID:16717126; Yang et al., 2006 | Wang lab | |
| Genetic reagent (M. musculus) | Rec8 knockout | PMID:32232159; Guan et al., 2020 | Wang lab | |
| Genetic reagent (M. musculus) | 3×FLAG-Trip13 | This paper | Wang Lab | |
| Genetic reagent (M. musculus) | Trip13-3×FLAG | This paper | Wang Lab | |
| Antibody | Anti-ACTB (mouse monoclonal) | Sigma | Cat# A5441, RRID:AB_476744 | WB (1:2000) |
| Antibody | Anti-centromere (CREST) (human polyclonal) | Antibodies Incorporated | Cat# 15-234, RRID:AB_2687472 | IF (1:500) |
| Antibody | Anti-SYCP1 (rabbit polyclonal) | Abcam | Cat# ab15090, RRID:AB_301636 | IF (1:300) |
| Antibody | Anti-SYCP2 (guinea pig polyclonal) | PMID:16717126 | Custom made | IF (1:150) |
| Antibody | Anti-SYCP3 (mouse monoclonal) | Abcam | Cat# ab97672, RRID:AB_10678841 | IF (1:500) |
| Antibody | Anti-SYCP3 (rabbit polyclonal) | ProteinTech Group | Cat# 23024-1-AP, RRID:AB_11232426 | IF (1:500), WB (1:2000) |
| Antibody | Anti-HORMAD1 (rabbit polyclonal) | ProteinTech Group | Cat# 13917-1-AP, RRID:AB_2120844 | IF (1:300) |
| Antibody | Anti-HORMAD2 (rabbit polyclonal) | PMID:19851446; Wojtasz et al., 2009 | A gift from Toth lab | IF (1:500) |
| Antibody | Anti-REC114 (rabbit polyclonal) | PMID:31003867; Boekhout et al., 2019 | A gift from Keeney Lab | IF (1:100) |
| Antibody | Anti-REC8 (rabbit polyclonal) | Custom made | A gift from Mengcheng Luo lab | IF (1:200) |
| Antibody | Anti-FLAG (mouse monoclonal) | Sigma | Cat# F3165, RRID:AB_259529 | IF (1:300), WB (1:4000) |
| Antibody | Anti-SKP1 (rabbit polyclonal) | Cell Signaling | Cat# 12248S, RRID:AB_2754993 | IF (1:200), WB (1:1000) |
| Antibody | Anti-TRIP13 (rabbit polyclonal) | ProteinTech Group | Cat# 19602-1-AP | IF (1:150), WB (1:1000) |
| Antibody | Anti-SYCE1 (rabbit polyclonal) | Custom made | A gift from Mengcheng Luo lab | IF (1:200), WB (1:1000) |
| Antibody | Anti-SYCP1 (mouse monoclonal) | Custom made | A gift from Christer Hoog lab | IF (1:200), WB (1:1000) |
| Antibody | Anti-CENP-C (rabbit polyclonal) | PMID:25533956; Kim et al., 2015 | A gift from Y. Watanabe lab | IF (1:500) |
| Antibody | Anti-TRF1 (mouse monoclonal) | Sigma | Cat# T1948 | IF (1:100) |
| Antibody | Anti-MAJIN (guinea pig polyclonal) | This paper | Custom made | IF (1:100) |
Table 2
Sequences of genotyping PCR primers, sgRNA, and ssDNA templates.
| Genotyping primers | |||
|---|---|---|---|
| Allele | Forward | Reverse | Product (bp) |
| Trip13 WT | GCCCTTAGCCAAGGTGGAT | TCCTTGCACCCCTAATTGAC | 645 |
| Trip13 KO | ACTTGCTTTAAAAAACCTCCCACA | CAGAAAGCAACTGCTCCCTTCTAGC | 731 |
| Sycp2 WT | AGATGAGGGCATATCACCGA | TAAGCACACTCACCATCTCC | 400 |
| Sycp2 KO | GCATGTTATCAACCTTATCCCT | CCTACCGGTGGATGTGGAATGTGTG | 300 |
| Rec8 WT | AGCAGAGTCGAAGAAGGCCTCTTG | CAGATGGTGGCGAAGCAGCCTGT | 426 |
| Rec8 KO | AGCAGAGTCGAAGAAGGCCTCTTG | TTGCTCAGGGGAATTTGGGTC | 212 |
| Hormad1 WT | TCAAGACCAACCTGGGCTAC | CCATGTGGGTTGTAGGGAGT | 196 |
| Hormad1 KO | TCAAGACCAACCTGGGCTAC | GGGGAACTTCCTGACTAGGG | ~400 |
| 3×FLAG-Trip13 | CCTACATCGGAGAAGGCTGT | TTCATGTCAGGCTGTTCAGG | WT:348 KI:426 |
| Trip13-3×FLAG | GCCCCACTAAAGCACAAGTC | ACAGGCTTGAGTCAGGATGG | WT:405 KI:471 |
| Genome editing | |||
| Guide RNA | HDR ssDNA | ||
| 3×FLAG-Trip13 | ATTCCCTCGGCTCCCGGCGG | TCGGAGAAGGCTGTCGCACAGGGCGCAGGGA GGCGACCGCGGCCTCACTCCGGCGGCATTCC CTCGGCTCCCGGCGGCAGCGCCATGGGTGAC TACAAAGACCATGACGGTGATTATAAAGATCATG ACATCGATTACAAGGATGACGATGACAAGGGAA GCGGAGACGAGGCGGTGGGCGACCTGAAGCAAGCGCTTCC | |
| Trip13-3×FLAG | AAGCCATAGATATGGATGTC | AGGGTTTCCTCCAGGCCCTATCTCTGGCAGTGGAC AAACAGTTTGAGGAGAAAAAGAAACTTTCAGCTTAT GTTGACTACAAAGACCATGACGGTGATTATAAAGATC ATGACATCGATTACAAGGATGACGATGACAAGTGATC CAAGACATCCATATCTATGGCTTTCAATGGACAAGTAGGAGGTGATACCGTCTAC | |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
TRIP13 localizes to synapsed chromosomes and functions as a dosage-sensitive regulator of meiosis
eLife 12:RP92195.
https://doi.org/10.7554/eLife.92195.3
