The RNA-binding protein HuR modulates the expression of the disease-linked CCL2 rs1024611G-rs13900T haplotype
- Department of Health and Behavioral Sciences, Texas A&M University-San Antonio, United States
- Utah Center for Genetic Discovery, Department of Human Genetics, University of Utah, United States
- Department of Pathology, School of Medicine, University of Texas Health San Antonio, United States
- Department of Medicine, School of Medicine, University of Texas Health San Antonio, United States
- South Texas Diabetes and Obesity Institute, Department of Genetics, School of Medicine, University of Texas Rio Grande Valley, United States
- Department of Population Health and Biostatistics, School of Medicine, University of Texas Rio Grande Valley, United States
Figures
Figure 1 with 2 supplements
rs13900 heterozygous individuals exhibit allelic expression imbalance (AEI) in CCL2.
(A) Schematic depicting distal, proximal regulatory elements extending 3 kb on either side of CCL2 gene and the linkage disequilibrium (LD) between regulatory polymorphism rs1024611 and the transcribed polymorphism rs13900. rs1024611 is located 2578 base pairs upstream of the CCL2 translation start site and rs13900 is located in the CCL2 3′untranslated region (3′ UTR). (B) Allelic expression imbalance (AEI) in heterozygous donors is measured as a ratio of alternative allele (ALT) to reference allele (REF) in a transcribed polymorphism. (C) Representative chromatograms obtained following Sanger sequencing of PCR products obtained from genomic DNA (gDNA) and reverse transcription PCR of mRNA (cDNA) from three individuals heterozygous for rs13900. gDNA and mRNA were obtained from peripheral blood mononuclear cell (PBMC) treated with lipopolysaccharide (LPS) for 3 hr as previously described. The allelic ratios shown were determined by PeakPicker analysis. PeakPicker calculates allelic ratios by dividing the peak height of the alternate allele (rs13900 T allele) by that of reference allele (rs13900 C allele). The gDNA peaks were used for normalization. (D) Allelic ratio for cDNA and gDNA in six individuals heterozygous for rs13900 after treatment with LPS for 3 hr. Statistical significance for the difference in the level of expression between the alleles was determined using Student’s t test (p<0.003).
-
Figure 1—source data 1
Numerical data used to generate Figure 1D.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Single nucleotide polymorphism (SNP) genotyping for rs13900 using TaqMan technology.
(A) Real-time multicomponent amplification curves for the rs13900 TaqMan assay. Fluorescence signal detected for individuals with rs13900 T, rs13900 C, and rs13900 CT genotypes. The blue curve indicates amplification of T allele (alternate/mutant allele) while the green curve represents C allele (wild type). (B) Allelic discrimination plot generated on Quant Studio 12K Flex Real-Time PCR system showing higher signal and better cluster separation for the rs13900 assay. Allele C is plotted on the x-axis and the T allele is plotted on the y-axis.
-
Figure 1—figure supplement 1—source data 1
Numerical data used to generate Figure 1—figure supplement 2.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig1-figsupp1-data1-v1.xlsx
Figure 1—figure supplement 2
Time course of CCL2 mRNA expression in peripheral blood mononuclear cells (PBMCs).
PBMCs were treated with 1 µg lipopolysaccharide (LPS) for 1, 3, or 6 hr. CCL2 mRNA expression was measured by quantitative real-time PCR and normalized to 18S rRNA. Data are presented as mean ± SD of triplicate samples.
Figure 2
rs13900T confers greater stability to CCL2 mRNA.
(A) CCL2 mRNA expression in peripheral monocytes of heterozygous individuals (N=6) after treatment with lipopolysaccharide (LPS) for 3 hr and then incubated with 5 µg actinomycin D (Act D) for indicated times. mRNA was detected by RT-PCR. Results, normalized to 18S rRNA levels, are expressed as fold-increase over unstimulated cells (CNT). Levels shown in the bar graph represent mean ± SEM of result at time 0 (*p=0.019) versus unstimulated cells. (B) CCL2 mRNA half-life, calculated for each condition as the time (in hours) required for the transcript to decrease to 50% of its initial abundance (t1/2=ln (0.5)/slope). (C) Nascent RNA was isolated from treated monocytes from three individuals in the presence and absence of ActD. Allelic ratio was determined after 4 hr of incubation with or without ActD. Expression of the rs13900 T allele was much higher in ActD-treated samples. The difference between the groups was assessed by ANOVA with Fisher’s least significant difference (LSD) method (*p<0.05, **p<0.005).
-
Figure 2—source data 1
Numerical data used to generate Figure 2A and C.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig2-data1-v1.xlsx
Figure 3
Bioinformatic analysis of the rs13900.
(A) Validation of RBP-binding sites and polymorphism located on the 3′ untranslated region (3′ UTR) of CCL2 transcript from the Atlas of UTR Regulatory Activity and analysis of ENCODE genome-wide datasets detected specific enrichment of HuR (ELAVL1) at the region that contains the rs13900. (B) Predicted changes in the secondary structure using ViennaRNA Package 2.0; the black arrow indicates the changes in the secondary structure due to the rs13900 T allele. (C) Sequence logo of HuR-binding site as determined by HOMER. (D) Relative structural preference of HuR across different nucleotide contexts: P denotes paired regions, L denotes hairpin loops, U denotes unstructured (or external) regions, and M denotes miscellaneous regions.
Figure 4 with 1 supplement
The rs13900 T allele shows increased in vitro binding of HuR.
(A) RNA electrophoretic mobility shift assay (REMSA) with labeled oligoribonucleotide containing either rs13900 C or T allele and whole cell extracts from HEK-293 cells. § denotes free probe; black arrow, bound probe; red arrow, supershift. (B) Representative quantitative densitometric analysis of the antibody-shifted complexes suggested increased HuR binding to the oligoribonucleotide bearing rs13900 T allele. The signals in the bound fraction(s) were normalized using the free probe. The top panel represents the data from three independent experiments (mean ± SEM). Statistical analyses were performed using Student’s t test (*p<0.001). The bottom panel shows the relative fold enrichment of the bound protein complexes to the oligoribonucleotide containing the rs13900 T allele relative to that containing the rs13900 C allele. Statistical significance was calculated using Student’s t test (*p<0.001). (C) REMSA with labeled oligoribonucleotides containing either rs13900 T or C allele and purified recombinant HuR protein at indicated concentrations. § denotes free probe; black arrow, bound probe. (D) Plot showing the fraction of bound rs13900 C or rs13900 T oligoribonucleotides with increasing HuR concentrations. The signal in the bound fractions was normalized with free probe. The figure represents data from three independent experiments (mean ± SEM).
-
Figure 4—source data 1
PDF file containing original gel shift assay blots for Figure 4A and C, indicating the relevant band and treatments.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig4-data1-v1.zip
-
Figure 4—source data 2
Original files for gel shift assay analysis displayed in Figure 4A and C.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig4-data2-v1.zip
-
Figure 4—source data 3
Numerical data used to generate Figure 4B (upper and lower panels).
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig4-data3-v1.xlsx
Figure 4—figure supplement 1
Differential binding of rs13900 C or rs13900 T allele with recombinant HuR protein.
(A) RNA electrophoretic mobility shift assay (REMSA) with labeled oligoribonucleotides containing either rs13900 C or rs13900 T and recombinant HuR at indicated concentration. (B) Plot showing the fraction of bound rs13900 C or rs13900 T oligoribonucleotide with increasing HuR concentration.
-
Figure 4—figure supplement 1—source data 1
PDF file containing original gel shift assay blot for Figure 4—figure supplement 1, indicating the relevant band and treatments.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig4-figsupp1-data1-v1.zip
-
Figure 4—figure supplement 1—source data 2
Original gel shift assay blots displayed in Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig4-figsupp1-data2-v1.zip
Figure 5 with 1 supplement
rs13900 C and T alleles are associated with differential binding to HuR ex vivo.
(A) HuR enrichment in immunoprecipitated material from macrophages stimulated with lipopolysaccharide (LPS). The input sample could not be included due to limited availability of material. To ensure comparable protein recovery across samples, β-actin was used as a loading control. (B) CCL2 3′ untranslated region (3′ UTR) was detected at significant levels in the samples precipitated by anti-HuR antibody when compared to the control IgG. (C) CCL2 mRNA expression in anti-HuR antibody enriched immunoprecipitated material analyzed by real-time quantitative PCR (RT-qPCR) (N=4). Statistical significance was calculated using Student’s t test (*p<0.005). The error bars represent SEM. (D) Relative expression levels of rs13900 C and T alleles in the anti-HuR-enriched immunoprecipitated complexes obtained from macrophages stimulated with LPS (N=6). Statistical significance was calculated using Student’s t test (*p<0.005).
-
Figure 5—source data 1
PDF file containing original western blots for supporting Figure 5A.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig5-data1-v1.zip
-
Figure 5—source data 2
Original files for western blot analysis displayed in Figure 5—source data 1.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig5-data2-v1.zip
-
Figure 5—source data 3
PDF file containing original uncropped gel for Figure 5B, indicating the relevant bands and treatment.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig5-data3-v1.zip
-
Figure 5—source data 4
Original files for agarose gel displayed in Figure 5B.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig5-data4-v1.zip
-
Figure 5—source data 5
Numerical data used to generate Figure 5C and D.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig5-data5-v1.xlsx
Figure 5—figure supplement 1
Flow cytometric analysis of cell surface markers to assess the purity of monocytes isolated from peripheral blood mononuclear cell (PBMC) and in vitro differentiation to macrophages.
(A) A representative image depicting the purity of monocytes isolated from PBMCs by immunomagnetic negative selection. A high monocyte content (>90%) was achieved in the enriched fraction. (B) Multicolor flow cytometry to determine macrophage differentiation. The macrophage population was identified by forward and side scatter and immunostaining. Surface expressions of CD11c, CD206, CD200, CD16, and CD14 were measured.
Figure 6 with 1 supplement
Differential effects of rs13900 alleles in reporter assays and role of HuR.
(A) Schematic representation of the luciferase reporter vectors containing CCL2 3′untranslated region (3′ UTR) with either rs13900 C or T allele. (B) HEK-293 cells were transfected with the equal quantities of CCL2 3′ UTR reporter vectors, and luciferase activity was measured 48 hr later. The relative luciferase activities of the 3′ UTR reporter plasmids were expressed as a percentage reduction in the luminescence when compared to the control vector that was set to 100% after normalizing for the protein content of the lysates. The error bars indicate the standard error of mean, and statistical significance was calculated using two-tailed Student’s t test (*p<0.05) (N=3). (C) HEK-293 cells were transfected with either pCMV6-HuR (0.5 μg) or pCMV-Entry (0.5 μg), and after 72 hr they were co-transfected with the two plasmid constructs (0.5 μg). Twenty-four hours after transfection, the relative change in luciferase activity was determined (N=3). (D) Cells were co-transfected with 125 pmol HuR siRNA or control siRNA and with the two plasmid constructs (0.5 μg). Twenty-four hours after transfection, the relative change in luciferase activity was determined, normalized to total protein concentration, data from three independent experiments (mean ± SEM; N=3). Statistical analyses were performed using Fisher’s least significant difference (LSD) method (*p<0.05).
-
Figure 6—source data 1
Numerical data used to generate Figure 6B, C, and D.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
Validation of HuR overexpression and silencing by western blotting.
(A) A representative western blot showing HuR protein levels in HEK-293 cells transfected with either pCMV6-HuR plasmid or HuR-targeting siRNA (HuR-siRNA). (B) Densitometric analysis of western blot bands. The histogram shows relative intensity of HuR bands in each sample, normalized to β-actin. The error bars represent standard error of mean obtained from three independent experiments. *p<0.025, **p<0.05.
-
Figure 6—figure supplement 1—source data 1
PDF file containing original western blot for Figure 6—figure supplement 1, indicating the relevant band and treatments.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig6-figsupp1-data1-v1.zip
-
Figure 6—figure supplement 1—source data 2
Original files for western blot for Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig6-figsupp1-data2-v1.zip
Figure 7 with 1 supplement
Influence of rs13900 C and T alleles on CCL2 translatability.
(A) HEK-293 cells were transfected by nucleofection with control and CCL2 3′ untranslated region (3′ UTR) reporter constructs with rs13900 C and T alleles. The nucleofected cells were plated separately and harvested for total RNA isolation or lysed for mRNA level or protein level expression of luciferase, respectively, after 24 hr. The reporter mRNA levels from the transfected 293T cells were quantified by real-time quantitative PCR (RT-qPCR), and 18S rRNA was used for normalization (N=6). (B) The relative luciferase activities of the 3′ UTR reporter plasmids were expressed as a percentage reduction in the luminescence when compared to the control vector that was set to 100% after normalizing for the protein content of the lysates (N=4). (C) mRNA translatability was calculated as luciferase activity normalized by the reporter luciferase mRNA level. The error bars indicate the standard error of mean from four independent experiments (N=4), and statistical significance was calculated using ANOVA and post hoc contrast with Fisher’s least significant difference (LSD) method. *p<0.01, **p<0.005.
-
Figure 7—source data 1
Numerical data used to generate Figure 7A, B, and C.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig7-data1-v1.xlsx
Figure 7—figure supplement 1
Polysomal association of CCL2 mRNA before and after lipopolysaccharide (LPS) stimulation of macrophages.
(A) Polysome profile obtained by sucrose gradient centrifugation from macrophages before and after stimulation with LPS (1 µg/mL) for 3 hr. The polysome profile shows a shift from monosomal fractions to heavier polysomal fractions upon LPS stimulation, indicating active translation. (B) The percentage of CCL2 mRNA loading on the polysome fraction was calculated using the ΔCT method (mean ± SEM, N=4). *p<0.025.
Figure 8 with 2 supplements
HuR differentially regulates CCL2 haplotypes.
(A) HuR expression in primary human macrophages following lentiviral transduction. Macrophages obtained from four individuals who are homozygous for either rs13900 C or rs13900 T allele were transduced with either CMV-null or HuR expressing lentiviral particles (pCMV6-HuR) for 72 hr followed by lipopolysaccharide (LPS) stimulation for 3 hr. (B) CCL2 expression determined by real-time quantitative PCR (RT-qPCR) (N=4). Error bars represent SEM. Statistical analyses were performed using Student’s t test (*p<0.005).
-
Figure 8—source data 1
Numerical data used to generate Figure 8A and B.
- https://cdn.elifesciences.org/articles/93108/elife-93108-fig8-data1-v1.xlsx
Figure 8—figure supplement 1
Transduction efficiency of pCMV6-HuR.
Flow cytometric analysis of transduction efficiency (A) and the intensity of GFP in transduced cells (B).
Figure 8—figure supplement 2
Lentiviral transduction of differentiated macrophages.
The differentiation of monocytes into macrophages and their transduction was confirmed by detection of GFP and the cell surface markers CD44, CD200, and CD206 by flow cytometry. Cells were transduced with either GFP-tagged pCMV-null (A) or GFP-tagged pCMV-HuR particles at an MOI of 1 (B). Each bracketed region in the histogram corresponds to the % of positive cells for respective markers noted on the x-axis of the histogram.
Author response image 1
Differential binding and stability of oligoribonucleotide probes containing rs13900C or T alleles with recombinant HuR.
(A) REMSA with labeled oligoribonucleotides containing either rs13900C or rs13900T and recombinant HuR at indicated concentrations. (B&C) Representative quantitative densitometric analysis of HuR binding to the oligoribonucleotides bearing rs13900 T or C. The signal in the bound fractions were normalized with the free probe. The figure represents data from three independent experiments (mean ± SEM).
Author response image 2
Cross-species alignment of the CCL2 3′ UTR region flanking the rs13900 using homologous regions from 5 different mammals.
(Hu, Human; CH, Chimps; MO, Mouse; RA, Rat; DO, Dog, rs13900 is shown within the brackets Y, pyrimidine)
Author response image 3
Ct values of 18s rRNA in ACT-D and control samples in Fig 2.
Author response image 4
MBL RIP-Assay Kit’s Quality Check.
Quality check of immunoprecipitated endogenous PTBP1 expressed in Jurkat cells. Lane 1: Jurkat (WB positive cells), Lane 2: Jurkat + normal Rabbit IgG, Lane 3: Jurkat+ anti-PTBP1.
Author response image 5
Schematic of the Lightswitch 3′ UTR vector.
(A) Vector information. The vector contains a multiple cloning site (MCS) upstream of the Renilla Luciferase gene (RenSP). Human 3′ UTR CCL2 is cloned into MCS downstream of the reporter gene and it becomes a part of a hybrid transcript that contains the luciferase coding sequence used to the UTR sequence of CCL2. Constructs containing rs13900C or rs13900T allele were generated using site-specific mutagenesis on CCL2 LightSwitch 3′ UTR reporter. The constructs were validated by Sanger sequencing. (B&C) Sequence chromatograph of the constructs containing CCL2-3′UTR insert showing rs13900C and rs13900T respectively. The result confirms the fidelity of the constructs used in the reporter assay.
Author response image 6
Determination of rs13900C/T allelic enrichment in polysome fractions and its effect on polysome loading.
Polysome profile obtained by sucrose gradient centrifugation of macrophages before and after stimulation with LPS (1 µg/mL) for 3 h. (A&B) The CCL2 mRNA shifts from monosome-associated fractions to heavier polysomes following LPS stimulation, indicating increased translation efficiency. (C&D) In contrast, the distribution of 18S shows no significant shift due to LPS treatment. (mean ± SEM, n=4). The percentage of mRNA loading on polysome was calculated using ΔCT method (mean ± SEM, n=4). (E&F) CCL2 AEI measurement in polysomes of macrophages from heterozygous donors (n=2). Genomic and cDNA were subjected to Sanger sequencing and the peak height of both the alleles were used to determine the relative abundance of each allele.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (human) | HEK-293 (CRL-1573) | Gift from Christopher Jenkinson, University of Texas Rio Grande Valley | ||
| Transfected construct (human) | GFP-tagged pCMV6-HuR | Amsbio | Cat# LVP071 | |
| Antibody | Anti-human CD14 -Pe-Cy (Mouse monoclonal) | BD Biosciences | Cat# 562698, RRID:AB_2737729 | (5 µL/test) |
| Antibody | Anti-human CD 64-FITC (Mouse monoclonal) | BD Biosciences | Cat# 555527, RRID:AB_395913 | (20 µL/test) |
| Antibody | Anti-human CD206-BV421 (Mouse monoclonal) | BD Biosciences | Cat# 564062, RRID:AB_2738570 | (5 µL/test) |
| Antibody | Anti-human CD11c-AlexaFluor 700 (Mouse monoclonal) | BD Biosciences | Cat# 561352, RRID:AB_10612006 | (5 µL/test) |
| Antibody | Anti-human CD44- PE (Mouse monoclonal) | BD Biosciences | Cat# 555479, RRID:AB_395871 | (20 µL/test) |
| Antibody | Anti-human CD200-APC (Mouse monoclonal) | Thermo Fisher Scientific | Cat# 17-9200-42, RRID:AB_10698161 | (5 µL/test) |
| Antibody | Anti-HuR (3A2) (Mouse monoclonal) | Santa Cruz Biotechnology | Cat# sc-5261, RRID:AB_627770 | REMSA (0.4 µg/rxn) RNA immunoprecipitation (RIP) (15 µg) WB (1:1000) |
| Antibody | β-Actin (2 A3) (Mouse monoclonal) | Santa Cruz Biotechnology | Cat# sc-517582, RRID:AB_2833259 | WB (1:10,000) |
| Antibody | Goat-IgG-control-human | Santa Cruz Biotechnology | Cat# sc-2028, RRID:AB_737167 | RNA immunoprecipitation (RIP) (15 µg) |
| Antibody | Goat anti-mouse IgG-HRP (Goat polyclonal) | Santa Cruz Biotechnology | Cat# sc- 2005, RRID:AB_3717730 | WB (1:1000) |
| Antibody | Goat anti-rabbit IgG-HRP (Goat polyclonal) | Santa Cruz Biotechnology | Cat# sc-2004, RRID:AB_631746 | WB (1:1000) |
| Recombinant DNA reagent | MultiScribe Reverse Transcriptase | Thermo Fisher Scientific | 4311235 | |
| Sequence-based reagent | rs13900_F | ACCTGGACAAGCAAACCCAA | PCR primers | |
| Sequence-based reagent | rs13900_R | ACCCTCAAAACATCCCAGGG | PCR primers | |
| Sequence-based reagent | rs13900 | GCAAACCCAAACTCCGAAGAC | Sequencing primer | |
| Sequence-based reagent | rs13900C | rCrUrUrUrCrCrCrCrArGrArCrArC rCrCrUrGrUrUrUrUrArUrUrU | Oligoribonucleotide | |
| Sequence-based reagent | rs13900C | rCrUrUrUrCrCrCrCrArGrArCrArC rCrUrUrGrUrUrUrUrArUrUrU | Oligoribonucleotide | |
| Peptide, recombinant protein | Recombinant Human M-CSF | Peprotech | Cat. #: 300-25 | 50 ng/mL |
| Peptide, recombinant protein | ELAVL1 human recombinant protein | OriGene | Cat. #: TP301562 | |
| Commercial assay or kit | EasySep Human Monocyte Isolation Kit | STEMCELL Technologies | STEMCELL Technologies: 19359 | |
| Commercial assay or kit | QIAamp DNA Blood Mini Kit (50) | QIAGEN | QIAGEN: 51104 | |
| Commercial assay or kit | RNeasy Plus Mini Kit (50) | QIAGEN | QIAGEN: 74134 | |
| Commercial assay or kit | Click-iT-Nascent RNA Kit | Thermo Fisher Scientific | Thermo Fisher Scientific: C10365 | |
| Commercial assay or kit | Superscript Vilo cDNA Synthesis Kit | Thermo Fisher Scientific | Thermo Fisher Scientific: 11754250 | |
| Commercial assay or kit | GeneJET PCR Purification Kit | Thermo Fisher Scientific | Thermo Fisher Scientific: 1 K0701 | |
| Commercial assay or kit | RIP-Assay Kit | MLB Life Sciences | MLB Life Sciences: RN1001 | |
| Commercial assay or kit | LightSwitch Lucifgerase Assay Kit | Active Motif | Active Motif: 32032 | |
| Commercial assay or kit | TaqMan SNP Genotyping Assay | Thermo Fisher Scientific | Thermo Fisher Scientific: 4351379 | Assay id: C___7449810_10 |
| Commercial assay or kit | TaqMan Gene Expression Assay (FAM) | Thermo Fisher Scientific | Thermo Fisher Scientific: 4331182 | Assay id: Hs03003631_g1 |
| Commercial assay or kit | TaqMan Gene Expression Assay (FAM) | Thermo Fisher Scientific | Thermo Fisher Scientific: 4331182 | Assay id: Hs00736046_m1 |
| Commercial assay or kit | TaqMan Genotyping Master Mix | Thermo Fisher Scientific | Thermo Fisher Scientific: 43711355 | |
| Commercial assay or kit | TaqMan Fast Advanced Master Mix | Thermo Fisher Scientific | Thermo Fisher Scientific: 4444964 | |
| Commercial assay or kit | AmpliTaq Gold 360 Master Mix | Thermo Fisher Scientific | Thermo Fisher Scientific: 4398881 | |
| Chemical compound, drug | Histopaque | Millipore Sigma | 10771 | |
| Chemical compound, drug | Lipopolysaccharides from Escherichia coli | Millipore Sigma | L2630 | 1 µg/mL |
| Chemical compound, drug | Actinomycin D | Millipore Sigma | A1410 | 5 µg/mL |
| Chemical compound, drug | Lipofectamine 3000 | Thermo Fisher Scientific | L3000008 | |
| Chemical compound, drug | cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail | Millipore Sigma | 118361700 | |
| Chemical compound, drug | MgCl2 (magnesium chloride) (25 mM) | Thermo Fisher Scientific | R0971 | |
| Chemical compound, drug | KCl (2 M), RNase-free | Thermo Fisher Scientific | AM9640G | |
| Chemical compound, drug | Glycerol, Molecular Biology Grade | Thermo Fisher Scientific | J61059AP | |
| Chemical compound, drug | Dithiothreitol (DTT) | Thermo Fisher Scientific | D1532 | |
| Chemical compound, drug | Penicillin-Streptomycin (10,000 U/mL) | Thermo Fisher Scientific | 15140122 | 100 U/mL |
| Chemical compound, drug | Pierce ECL Western Blotting Substrate | Thermo Fisher Scientific | 32106 | |
| Chemical compound, drug | Pierce Protein G Agarose | Thermo Fisher Scientific | 20398 | |
| Software, algorithm | ImageJ | ImageJ | RRID:SCR_003070 | |
| Software, algorithm | SigmaPlot | SigmaPlot | RRID:SCR_003210 | |
| Software, algorithm | QS12K Real-Time PCR Software | Thermo Fisher Scientific | ||
| Software, algorithm | PeakPicker v.2.0 | PeakPicker | https://doi.org/10.1101/gr.4023805 | |
| Software, algorithm | AURA | Atlas of UTR Regulatory Activity | https://doi.org/10.1093/bioinformatics/btr608 | |
| Software, algorithm | POSTAR3 | POSTAR3 | https://doi.org/10.1093/nar/gkab702 | |
| Software, algorithm | RBP-var2 | RBP-var2 | https://doi.org/10.1093/nar/gkv1308 | |
| Software, algorithm | ViennaRNA Package | ViennaRNA | RRID:SCR_008550 |
Author response table 1
Pairwise linkage disequilibrium data between rs13900 and rs1024611 by population reported in the ENSEMBL server for the 1000 genome dataset.
| Population | Description | Focus Variant | Variant 2 | r2 | D^(') |
|---|---|---|---|---|---|
| 1000GENOMES:phase_3:PEL | Peruvian in Lima, Peru | rs1024611 | rs13900 | 0.92478 | 1 |
| 1000GENOMES:phase_3:YRI | Yoruba in Ibadan, Nigeria | rs1024611 | rs13900 | 0.97254 | 1 |
| 1000GENOMES:phase_3:GWD | Gambian in Western Division, The... (more) | rs1024611 | rs13900 | 0.9737 | 1 |
| 1000GENOMES:phase_3:FIN | Finnish in Finland | rs1024611 | rs13900 | 0.97835 | 1 |
| 1000GENOMES:phase_3:JPT | Japanese in Tokyo, Japan | rs1024611 | rs13900 | 0.97905 | 1 |
| 1000GENOMES:phase_3:CHB | Han Chinese in Bejing, China | rs1024611 | rs13900 | 0.97919 | 1 |
| 1000GENOMES:phase_3:ACB | African Caribbean in Barbados | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:ASW | African Ancestry in Southwest US | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:BEB | Bengali in Bangladesh | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:CDX | Chinese Dai in Xishuangbanna, China | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:CEU | Utah residents with Northern and... (more) | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:CHS | Southern Han Chinese, China | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:CLM | Colombian in Medellin, Colombia | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:ESN | Esan in Nigeria | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:GBR | British in England and Scotland | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:GIH | Gujarati Indian in Houston, TX | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:IBS | Iberian populations in Spain | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:ITU | Indian Telugu in the UK | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:KHV | Kinh in Ho Chi Minh City, Vietnam | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:LWK | Luhya in Webuye, Kenya | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:MSL | Mende in Sierra Leone | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:MXL | Mexican Ancestry in Los Angeles... (more) | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:PJL | Punjabi in Lahore, Pakistan | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:PUR | Puerto Rican in Puerto Rico | rs1024611 | rs13900 | 1 | 1 |
| 1000GENOMES:phase_3:STU | Sri Lankan Tamil in the UK | rs1024611 | rs13900 | 1 | 1 |
Additional files
-
Supplementary file 1
Allele carriages and allele frequencies of rs13900 in healthy volunteers.
MAF, minor allele frequency.
- https://cdn.elifesciences.org/articles/93108/elife-93108-supp1-v1.docx
-
Supplementary file 2
Crosslinking immunoprecipitation (CLIP) analysis of HuR-binding sites on the 3′untranslated region (3′UTR) of the CCL2 gene.
A summary of the single nucleotide polymorphisms (SNPs) located within HuR-binding regions is shown, including SNP ID (rs#), genomic coordinates, strand, binding score, conservation scores (PhastCons, PhyloP), dataset accession numbers, alleles, and SNP position within peak region. Data were generated using the Genomic Variants Module in the POSTAR3 platform. The GSE accession #s correspond to those reported in the Gene Expression Omnibus (GEO).
- https://cdn.elifesciences.org/articles/93108/elife-93108-supp2-v1.docx
-
Supplementary file 3
Loading of rs13900 alleles to cytosolic, monosomal, and polysomal fractions from macrophage extracts prepared from heterozygous donors.
A T:C ratio >1 indicates increased levels of the T allele relative to the C allele.
- https://cdn.elifesciences.org/articles/93108/elife-93108-supp3-v1.docx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/93108/elife-93108-mdarchecklist1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
The RNA-binding protein HuR modulates the expression of the disease-linked CCL2 rs1024611G-rs13900T haplotype
eLife 13:RP93108.
https://doi.org/10.7554/eLife.93108.3
