Transdifferentiation of fibroblasts into muscle cells to constitute cultured meat with tunable intramuscular fat deposition
- College of Animal Science and Technology, Key Laboratory of Efficient Utilization of Non-Grain Feed Resources, Ministry of Agriculture and Rural Affairs, Shandong Agricultural University, China
- College of Animal Science and Technology, Huazhong Agricultural University, China
- College of Food Science and Technology, Huazhong Agricultural University, China
Figures
Figure 1 with 1 supplement
Chicken fibroblasts proliferate stably in low-serum conditions.
(A) Cellular morphology and EdU staining of chicken fibroblasts under different low-serum conditions. FBS: fetal bovine serum; CS: chicken serum. Scale bars, 200 µm. (B) Quantification of the proportion of EdU-positive cells in (A). Error bars indicate s.e.m. n = 3. *p<0.05, **p<0.01, ***p<0.001. Paired t-test. (C) The CCK-8 cell proliferation assay showed the proliferation of chicken fibroblasts in 1% CS. Error bars indicate s.e.m, n = 3.
Figure 1—figure supplement 1
Experimental scheme of myogenic transdifferentiation.
(A) Scheme of the MyoD-induced transdifferentiation. (B) Morphology and EdU staining of chicken fibroblasts under different conditions from (A). Scale bars, 200 µm. (C) Quantification of the proportion of EdU-positive cells in (B). Error bars indicate s.e.m, n = 3. ns: not significant. Paired t-test. (D) Cellular morphology of chicken fibroblasts under different low-serum conditions. Orange triangles mark the sharper and smoother morphology of cell edge contours. Please note that the cells showed abnormal morphology in the lowest serums of 1% FBS and 0.5% CS. FBS: fetal bovine serum; CS: chicken serum. Scale bar, 100 µm.
Figure 2 with 2 supplements
3D culture of chicken fibroblasts in gelatin methacrylate (GelMA) hydrogels.
(A) Microscopic images of GelMA hydrogels at different concentrations (3, 5, 7, and 9 wt%) taken by scanning electron microscopy (SEM) and their corresponding simplified maps of pore distributions. Scale bar, 10 µm. (B) Quantification of pore area in (A). Error bars indicate s.e.m, n = 3. ****p<0.0001. Paired t-test. (C) Brightfield and red fluorescent images of cells in 3D culture after PKH26 staining at different times (1 hr, 1 d, 3 d, 5 d, and 9 d). Scale bars, 100 µm. (D) Relative area of PKH26-linked cells in (C). Error bars indicate s.e.m, n = 3. *p<0.05, ***p<0.001, ****p<0.0001. (E) Representative EdU staining shows the proliferation of cells in 3D culture on 1 d, 3 d, and 5 d after cell implantation in hydrogel. Scale bars, 100 µm. (F) Quantification of the proportion of EdU-positive cells in (E). Error bars indicate s.e.m, n = 3. **p<0.01. Paired t-test.
Figure 2—figure supplement 1
Cellular morphology of chicken fibroblasts cultured in 3D.
Morphological changes of cells implanted and cultured on four different concentrations of hydrogels at 3, 5, 7, and 9 wt% for different times, and the 3 wt% hydrogel collapsed after the second day of growth. Scale bars, 100 µm.
Figure 2—figure supplement 2
The labeling of cells with PKH26 and comparisons of cell morphology and proliferation between 2D and 3D.
(A) Brightfield and red fluorescent images of chicken fibroblasts in 2D culture after PKH26 labeling. Scale bars, 100 µm. (B) Morphology of cells in gelatin methacrylate (GelMA) hydrogels cultured in 3D before and after dissociation. Scale bars, 100 µm. (C) Morphology and EdU staining of chicken fibroblasts under different conditions. 3D→2D indicates that cells isolated from 3D (B) were re-cultured in 2D. Scale bars, 200 µm. (D) Quantification of the proportion of EdU-positive cells in (C). Error bars indicate s.e.m, n = 3. ns: not significant. Paired t-test.
Figure 3 with 5 supplements
Transdifferentiation of chicken fibroblasts into muscle cells in 3D.
(A) Experimental design for fibroblast myogenic transdifferentiation in 3D culture. (B) Representative images of myosin heavy chain (MHC) staining showed the myogenic ability of chicken fibroblasts in 3D culture. Scale bars, 50 µm. (C) Comparison of the mean myogenic fusion index between 2D and 3D. Error bars indicate s.e.m, n = 3. *p<0.05. Paired t-test. (D) 3D images of MHC staining of cells cultured in 3D. The right panel is depth-coded image, which indicate different depths from the deepest (cyan) to the surface (yellow). (E) Orthogonal projections of three sets of MHC staining of cells in 3D culture at different depths. Scale bars, 50 µm. (F) Expression of skeletal muscle-related genes was determined by RT-qPCR in 2D and 3D cells upon myogenic transdifferentiation and control 3D cells without stimulation. Note that the myogenic transdifferentiation driven by MyoD stimulates the expression of classical myogenic factors. Error bars indicate s.e.m, n = 3. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Paired t-test. (G) Macroscopic morphology of the empty hydrogel matrix (left) and cultured meat (right). The cultured meat is the product obtained after 3D cell culture and induction of myogenesis. Scale bars, 1 cm.
Figure 3—figure supplement 1
Expression of MyoD upon doxycycline (DOX) treatment.
(A) The MyoD-3xFlag was fused in frame and under the control of Tet-On system. Representative immunofluorescence staining of MyoD in fibroblast_MyoD and fibroblast_Con. Scale bars, 50 μm. (B) Representative immunofluorescence staining of Flag in fibroblast_MyoD and fibroblast_Con. The anti-Flag immunostaining indicate the exogenous MyoD transgene expression. Scale bars, 50 μm.
Figure 3—figure supplement 2
Myogenic transdifferentiation in 2D.
(A) Experimental design for fibroblast myogenic transdifferentiation in 2D culture. (B) Myosin heavy chain (MHC) staining demonstrates the myogenic capacity of chicken fibroblasts. Note that horse serum (HS) treatment causes massive loss of cells. Scale bars, 100 µm. (C) Immunofluorescence staining of MHC in 3D cultured chicken fibroblasts without activation of MyoD factor as a negative control. Scale bar, 100 µm. (D) Immunofluorescence staining MHC in cell-free gelatin methacrylate (GelMA) hydrogels as the control. Scale bar, 200 µm.
Figure 3—figure supplement 3
Cell gelatin methacrylate (GelMA) 3D culture units and macroscopic morphology after 7 d of culture, with a white plastic frame as the fixation ring.
Scale bars, 1 cm.
Figure 3—video 1
MHC+ myotubes in the 3D cultured fibroblast after myogenic transdifferentiation.
Scale bar, 50 μm.
Figure 3—video 2
Multiangle video showing myotubes were aligned together.
Figure 4 with 1 supplement
Myogenic transdifferentiation of fibroblasts does not produce myofibroblasts.
(A) Immunofluorescence staining of 3D cultured cells showed that the skeletal muscle marker Desmin was expressed only in the transdifferentiated cells but not in fibroblasts or myofibroblasts. Scale bars, 50 µm. (B) Immunofluorescence staining of 3D cultured cells showed that the myofibroblast marker alpha-smooth muscle actin (α-SMA) was expressed only in the myofibroblasts but not in fibroblasts or transdifferentiated cells. Scale bars, 50 µm. (C) Immunofluorescence staining of 3D cultured cells showed that the fibroblast marker Vimentin was abundantly expressed in fibroblasts and myofibroblasts but greatly reduced in transdifferentiated cells. Scale bars, 50 µm. (D) RT-qPCR showed that the myogenic genes Desmin and Six1 were significantly increased upon myogenic transdifferentiation. (E) RT-qPCR showed the fibroblast marker gene Thy-1 was significantly reduced upon myogenic transdifferentiation. (F) The myofibroblast marker genes TGFβ-1, TGFβ-3, and Smad3 remain unchanged during myogenic transdifferentiation. Error bars indicate s.e.m, n = 4. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. ns: not significant. Paired t-test.
Figure 4—figure supplement 1
Myogenic transdifferentiation of fibroblasts does not produce myofibroblasts in 2D culture.
(A) Immunofluorescence staining of 2D cultured cells showed that the skeletal muscle marker Desmin was expressed only in the transdifferentiated cells but not in fibroblasts or myofibroblasts, and the myofibroblast marker alpha-smooth muscle actin (α-SMA) was expressed only in the myofibroblasts, but not in fibroblasts or transdifferentiated cells. Scale bars, 50 µm. (B) Immunofluorescence staining of 2D cultured cells showed that the fibroblast marker Vimentin was abundantly expressed in fibroblasts but greatly reduced in MyoD-transdifferentiated cells. Scale bars, 50 µm.
Figure 5 with 3 supplements
Stimulation of fat deposition in chicken fibroblasts in 3D.
(A) Experimental design for fibroblast lipogenesis in 3D culture (‘F’ is for fatty acids and ‘I’ is for insulin). (B) Representative images showing the Oil Red O staining of lipid content accumulated in cells at different focal planes at the same position. The control group was normal medium without lipogenesis. Scale bars, 100 µm. (C) Relative area of lipid droplets in (B). Error bars indicate s.e.m, n = 3. ****p<0.0001. Paired t-test. (D) Expression of lipid synthesis-related genes determined by RT-qPCR in 2D and 3D cells upon lipogenic induction and control 3D cells without stimulation. Error bars indicate s.e.m, n = 3. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Paired t-test. (E) Triglyceride content in the cultured meat upon different lipogenic inductions and control 3D cells without stimulation. Error bars indicate s.e.m, n = 3. **p<0.01. Paired t-test.
Figure 5—figure supplement 1
Efficient lipogenesis in 2D chicken fibroblasts.
(A) Experimental design of fibroblast lipogenic differentiation in 2D culture. (B) Oil Red O staining of lipids in 2D under different conditions. Scale bar, 100 µm. (C) Relative area of lipid droplets in (B). Error bars indicate s.e.m, n = 3. ***p<0.001, ****p<0.0001. Paired t-test.
Figure 5—figure supplement 2
Chicken serum (CS)-induced lipogenesis in 3D cultured chicken fibroblast.
(A) Experimental design for fibroblast lipogenic differentiation in 3D culture induced by CS. (B) Oil Red O staining of 3D culture of cells after lipogenic induction (10% CS) and representative images were taken consecutively at different focal planes in the same position. ‘1’, ‘2’, ‘3’, are magnifications of the corresponding areas. Scale bars, 100 µm. (C) Relative area of lipid droplets in (B). Error bars indicate s.e.m, n = 3. ****p<0.0001. Paired t-test.
Figure 5—video 1
Lipid droplets were observed in 3D cultured fibroblasts upon lipogenic induction.
Scale bar, 100 μm.
Figure 6 with 1 supplement
Controlled fat deposition in the transdifferentiated muscle cells in 3D hydrogel.
(A) Experimental design for fibroblast myogenic/lipogenic differentiation in 3D culture. (B) Representative images of myosin heavy chain (MHC) and Oil Red O staining of cells upon myogenesis/lipogenesis in 3D culture. Scale bars, 50 µm. (C) Orthogonal projections of three sets of MHC and Oil Red O staining of cells in 3D culture at different depths. Scale bars, 50 µm. (D) Expression of muscle-related genes (top) and lipid-related genes (bottom) in the cells with myogenesis/lipogenesis induction and control 3D cells without any stimulation were determined by RT-qPCR. (E) Triglyceride content of cultured meat under different conditions and real meat compare to fibroblasts_control. ‘Meat_leg’ and ‘Meat_breast’ were taken from the leg and breast muscles of adult chickens. Error bars indicate s.e.m, n = 3. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Paired t-test.
Figure 6—figure supplement 1
Myogenic/lipogenic stimulation in chicken fibroblasts.
(A) Experimental process for sequential myogenic/lipogenic stimulation in 2D culture. (B) Myosin heavy chain (MHC) staining and Oil Red O staining of cells with 2D induction of myogenesis/lipogenesis, with the triangular arrow indicating that Oil Red O-labeled lipid droplets are shown under the red fluorescent channel. Scale bars, 100 µm. (C) Immunofluorescence staining and Oil Red O staining demonstrating lipid deposition inside the transdifferentiated muscle cells, with the triangular arrow indicating the location of the lipids within the muscle cell. Scale bars, 100 µm.
Figure 7
The collagen content and expression of extracellular matrix (ECM) components in cultured meat.
(A) Total collagen content of cultured meat at different days of cultivation. Error bars indicate s.e.m, n = 3. *p<0.05, ***p<0.001. Paired t-test. (B) Expression of ECM-related genes determined by RT-qPCR of cultured meat. Error bars indicate s.e.m, n = 3. *p<0.05, ***p<0.001, ****p<0.0001. Paired t-test. (C) Representative Laminin staining of cells in 3D culture on 1 d, 3 d, 5 d, and 7 d after cell implantation and transdifferentiation in hydrogel. Scale bars, 100 µm.
Figure 8
Gene expression profiles during transdifferentiation and fat deposition in 3D.
(A) Scheme of the RNA-seq samples marked by different colors. (B) Hierarchical clustering analysis of whole transcriptomes of 3D_fibroblasts, 3D_MyoD, 3D+FI, and 3D_MyoD+FI using Euclidean distance with ward.D cluster method. (C) Principal component analysis (PCA) of transcriptome changes during myogenic transdifferentiation and fat deposition (n = 10,247 genes). The ellipses group includes three biological replicates in each cell type. The arrows represent the reprogramming of gene expression under different conditions. The routes were derived from the original fibroblast toward two differentiation routes, namely ‘myogenic transdifferentiation’ and ‘adipogenic transdifferentiation’. (D) Venn diagram showing the overlap of differentially expressed genes (DEGs) from 3D_MyoD, 3D+FI, and 3D_MyoD+FI compared to the original 3D_fibroblasts. (E) Heat map showing the representative genes differentially expressed between 3D_MyoD+FI and 3D_fibroblast cells (n = 3 biologically independent samples). (F) Gene Ontology (GO) analysis of upregulated DEGs between 3D_MyoD+FI vs. 3D_fibroblast cells. (G) GOChord analysis of the upregulated genes within representative pathway between 3D_MyoD+FI and 3D_fibroblast cells.
Figure 9
Model for myogenic and lipogenic transdifferentiation of chicken fibroblasts in 3D culture to produce meat with precisely controlled levels of intramuscular fat and extracellular matrix.
Author response image 1
Tables
Table 1
List of primers of qPCR.
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Gapdh | TCGGAGTCAACGGATTTGGC | ATAGTGATGGCGTGCCCATT |
| MyoD | ACTACAGCGGGGAGTCAGAT | GCTTCAGCTGGAGGCAGTAT |
| MyoG | AGCCTTCGAGGCTCTGAAAC | AAACTCCAGCTGGGTGCTC |
| Myh15 | AGATAAAGGAACTACAGGCTCGT | CGCCAGCTTCAGGAACTCA |
| CKM | ACCTGGACCCCAAATACGTG | TCGAACAGGAAGTGGTCGTC |
| Desmin | GGAGATCGCCTTCCTCAAGA | CAGGTCGGACACCTTGGATT |
| Six1 | ACTGCTTCAAGGAGAAGTCG | TTCTCCGTGTTCTCCCTCTC |
| Thy-1 | TGTCATCCTGACAGTGCTGC | GGTAGAGGCACACCAGGTTC |
| TGFβ–1 | GAGCTGTACCAGGGTTACG | GAAGCCTTCGATGGAGATG |
| TGFβ–3 | CTCCCCGAGCACAATGAGT | TATATGCTCATCTGGCCGCA |
| Smad3 | GCAAGATCCCACCAGGATG | GAGGTGCAGCTCAATCCAG |
| Pparg | TGCCAAGCATTTGTAT | TGCGAATTGCTACTTCTTTGTT |
| Znf423 | CCAGTGCCCACAGAAGTTCT | CCACTGTGCCACCATCAAGT |
| Fabp4 | CAAGCTGGGTGAAGAGTTTGATG | TCGTAAACTCTTTTGCTGGTAAC |
| Gpd1 | GGCTTTTGCCAAGACTGGGAA | GGTTTGCCCTCATAGCAGATCTG |
| Collagen I α1 | GTCCTGCTGGATTTGCTGG | GAAACCAGTAGCACCAGGG |
| Collagen I α2 | TGATCCATCTAAAGCGGCTG | TTTGCCAGGGTGACCATCTT |
| Laminin | CGCGATTTCTGATTTTGCCG | CATTGCAGTCACAAGGCAAG |
| Fibronectin | GTGCTACGACGATGGGAAAA | GCAGTTGACGTTGGTGTTTG |
| Elastin | CTACTGGGACAGGTGTTGGA | CACCATAGGCTCCTGCCTT |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Transdifferentiation of fibroblasts into muscle cells to constitute cultured meat with tunable intramuscular fat deposition
eLife 13:RP93220.
https://doi.org/10.7554/eLife.93220.3
