Atlas of Fshr expression from novel reporter mice
- Laboratory of Bone and Adipose Biology, Shanxi Medical University, China
- Department of Dentistry, The 980th Hospital of the PLA Joint Logistic Support Force, China
- Shanxi Medical Universityersity, The Second Hospital, University Shanxi Medical University, China
- Maine Medical Center Research Institute, United States
Figures
Figure 1
Generation of CRISPR/Cas9-mediated Fshr-ZsGreen knockin reporter mice.
(A) CRISPR/Cas9-mediated targeting strategy to generate Fshr-P2A-ZsGreen knockin mice. (B) Detection of integration by PCR in F0 and F1 mice: (a) Schematic of PCR primer design specific to Fshr-P2A-ZsGreen and the wild-type allele. The results of genomic DNA PCR genotypes using the primer pair EGE-YHN-013-A-L-GT-F/EGE-YHN-013-A-Mut-R (b) and another primer pair EGE-YHN-013-A-R-GT-F/EGE-YHN-013-A-R-GT-R (c). (C) Southern blot confirmation of the correct integration of the P2A-ZsGreen allele in F0 and F1 mice. The Southern blot results demonstrated the successful generation of the targeted P2A-Fshr-ZsGreen allele: (a) Restriction sites in the wild-type sequence and targeted vector; (b) Southern blot analysis probes, expected restriction fragment lengths as indicated and blotted images.
-
Figure 1—source data 1
Gel images for genotyping PCR of mouse tail DNA.
- https://cdn.elifesciences.org/articles/93413/elife-93413-fig1-data1-v1.zip
-
Figure 1—source data 2
Original TIFF images for Southern blots.
- https://cdn.elifesciences.org/articles/93413/elife-93413-fig1-data2-v1.zip
Figure 2
Imaging of Fshr-ZsGreen expression in the reproductive system.
(A) Fshr expression in the ovary. Frozen sections of the ovary were immunostained with an antibody against mouse Stra 8, followed by imaging of Fshr-ZsGreen expression and its colocalization with Stra8 staining. The entire picture of the sectioned ovary is shown in (A-a). The representative images of the section were taken at ×400 magnification. (A-b) An area containing a corpus luteum, tertiary and ruptured follicles, and a partial oviduct; (A-c) an area with more corpora lutea; (A-d) oviducts. Furthermore, representative images at ×1000 magnification; (A-e) primordial and secondary follicles; (A-f) a mature follicle; (A-g) follicle cells in a corpus luteum; and (A-h) ciliated epithelial cells in the oviduct. Scale bars: 100 μm for (a, b, c, and d), 20 μm for (e–h). (B) Fshr-ZsGreen expression and its colocalization with Stra8 (a–c) and Set (d–f) in the testis. (B-a) The whole image of the sectioned testis; (B-b) the representative area of seminiferous tubes with interstitial cells (Leydig cells); and (B-c) an seminiferous tube. White empty arrowheads indicate Leydig cells; (B-d) the representative area of seminiferous tubes with interstitial cells (Leydig cells) stained for Set; (B-e) an seminiferous tube stained for Set and an artery with partial areas of seminiferous tubes stained for Set. Arrows: empty white arrows indicate Leydig cells; empty white arrowheads indicate spermatogonia; white arrowheads indicate Sertoli cells; white arrows indicate spermatocytes. Magnifications: ×40 for (a), ×400 for (b and d), and ×1000 for (c, e, and f). Scale bars: 500 μm for (b and d), 50 μm for (c and d), and 20 μm for (c, e, and f). (C) Single RNA-fluorescence in situ hybridization (RNA-smFISH) confirmation of Fshr expression in Fshr-ZsG mice. Mixed antisense probes were applied for detection of Fshr while a sense probe was taken as a negative control. The entire image of the sectioned testis was taken at ×40 magnification (a and c), and two representative areas of seminiferous tubes with Leydig cells are demonstrated at ×1000 magnification (b and d). Abbreviations: LCs, Leydig cells, and ST, seminiferous tubule. Scale bars: 50 μm. (D) RNA-smFISH confirmation of Fshr expression in B6 mice. Mixed antisense probes were applied for detection of Fshr while a sense probe was taken as a negative control. Three representative areas of seminiferous tubes with Leydig cells were imaged at ×400 magnification (a–c for the sense probe; d–f for antisense RNA probes). White empty arrows indicate Leydig cells. Scale bars: 50 μm. (E) Fshr expression in the ovary (a) and testis (b) of B6 mice. Frozen sections of the ovary and testis were immunofluorescence stained for Fshr. A representative area of the whole ovary or the testis image is present at ×400 magnification. White arrows indicate Leydig cells. (F) Immunofluorescence staining for Fshr in TM3 cells. (a) Isotype control (IgG); (b) positive staining for Fshr with mouse Fshr antibody, empty arrowheads indicate lower Fshr expression cells and white arrows indicate higher Fshr expression cells; (c and f) higher magnification of Fshr positively stained cells (maximum intensity projected images); (d and g) single layer images across the centers of nuclei of the cells in (c and f; e and h). 3D images of the nuclei showing Fshr located in the nuclei; (i) a SIM image of Fshr located in the nuclei. (G) Comparison of Fshr expression in TM3 cells, testes and ovaries of Fshr-ZsGreen and B6 mice assessed by droplet digital RT-PCR (ddRT-PCR). Two groups of TM3 cells (1 and 2) for measurement of Fshr expression (n=4 per group). Three samples for each organ (n=3 mice/each for the testis or ovary). ***p<0.001; ns, no significant difference in the comparisons.
Figure 3
Fshr-ZsGreen expression in skeletal tissues.
(A) Detection of Fshr-ZsGreen expression in frozen sectioned skeletal tissues by fluorescence confocal microscopy. The upper panels show Fshr-ZsGreen-positive cells in the representative areas of skeletal tissues at low magnification (×400), while the lower panels show their corresponding cells at high magnification (×1000). These representative areas demonstrate the Fshr-ZsGreen-positive cells in chondrocytes of the growth plate (a and e), on the surfaces of sponge bone under the growth plate (b and f), in trabecular bone in the bone marrow (c and g), and in the cortex (d and h). Abbreviations: OBs, osteoblasts; OCs, osteoclasts; BM, bone marrow; CB, cortical bone; and P, periosteum. Arrows: empty white arrowhead indicates GFP-positive osteocytes. Magnifications: ×400 for (a–d) and ×1000 for (e–h); scale bars: 50 μm for (a–d) and 20 μm for (e–h). (B) Confirmation of GFP-positive cell identities with antibodies against either osteocalcin or Trap as markers for osteoblasts or osteoclasts. Colocations of GFP expression with osteocalcin in mature chondrocytes (a), osteoblasts, bone lining cells, and osteocytes on the surface of or within sponge bone (b), trabecular bone (c), and cortical bone (d). Colocations of Trap with multinucleated GFP-positive cells are shown in (e and f), which represent osteoclasts on the resorptive areas and in bone marrow adjacent to bone surfaces and bone lining cells over trabecular bone. Arrows: empty white arrows indicate early chondrocytes with GFP expression but undetectable osteocalcin expression, while white arrows point to mature chondrocytes with both strong GFP and osteocalcin expression. Magnifications: ×1000 for (a–f). Scale bars: 20 μm for (a–f). (C) Identification of stem/progenitor cells. (a) Colocalization of Fshr-ZsGreen with CD34-positive staining in bone marrow, indicated by empty white arrows; an empty white arrowhead indicates multinucleated Fshr-ZsGreen cells with CD34-positive staining. (b) CD34-positive stained cells in growth plates. Empty white arrows indicate spindle-shaped ZsGreen-positive chondrocytes stained positively for CD34, where empty white arrowheads point to round cells with CD34-positive staining located in the bottom of the growth plate. (c) Colocalization of Fshr-ZsGreen with CD133 staining in the cells of bone marrow and on the bone surface. Empty white arrows indicate bone marrow cells positive for both Fshr-ZsGreen and CD133 staining, and empty white arrowheads indicate Fshr-ZsGreen-positive cells on the trabecular bone surface with positive staining for CD133. (d) Positive staining for CD133 on Fshr-ZsGreen-positive chondrocytes on the surface of articular cartilage. (e) CD133 staining in the weak Fshr-ZsGreen-positive fibroblast-like cells in the periosteum. (D) Reduced Fshr expression by Fshr cKO in osteocytes. Immunofluorescence staining with Fshr antibody was performed in decalcified frozen sections of femurs from the control and inducible osteocytes Fshr cKO mice (DMP1-CreERT2+:Fshrfl/fl treated tamoxifen and DMP1-CreERT2-:Fshrfl/fl as the control treated with corn oil). White empty arrows, osteocytes in the control; green empty arrows, osteocytes with reduced Fshrr expression in the cKO. Dotted lines indicate the thickness of the cortex. Magnifications: ×400. Scale bars: 50 μm.
Figure 4
Fshr-ZsGreen expression in adipose tissues.
(A) Confocal imaging of Fshr-ZsGreen expression in frozen sections of inguinal WAT. The whole image of a piece of the inguinal WAT was imaged under confocal microscopy with a low magnification (×40), and three representative areas were also presented with a higher magnification (×400) showing low and high cellular densities (low – b and high – a and c). These images demonstrate Fshr-ZsGreen expression in the cellular membranes of adipocytes. (B) Immunofluorescence (IF) staining of Fshr-ZsGreen-positive adipocytes with an antibody against mouse Ucp1. To identify the beige cells in WAT, we performed IF staining with an antibody against mouse Ucp1. Positive staining for Ucp1 was colocalized within Fshr-ZsGreen-positive cells in the areas with a higher cell density (a and b) imaged at low magnification, as shown in the left panels, while higher magnification images are shown in the right panels (a and d). In addition, strong Fshr-ZsGreen expression was observed in the arterioles of WAT (c and d). Arrows: empty white arrows indicate beige cells; white arrows point to white adipocytes, and empty arrowheads indicate GFP-positive arterioles. Magnifications: ×400 for (a and c); ×1000 for (b and d). Scale bars: 50 μm for (a and c) and 20 μm for (b and d). (C) Fluorescence images of Fshr-ZsGreen expression in frozen sectioned BAT. A whole image of BAT was imaged under confocal fluorescence microscopy at low magnification (a, ×40). Three representative areas are also presented at a higher magnification (b, c, and d, ×400), which clearly show the Fshr-ZsGreen expressed in the cells of BAT and skeletal muscles in the right parts of the images (b and c). Abbreviation: M, muscle. Arrows: white arrows indicate strong Fshr-ZsGreen expression in BAT cells. Magnifications: ×40 for (a) and 40°C for (b, c, and d). Scale bars: 100 μm for (a) and 50 μm for (b, c, and d). (D) Identification of brown adipocytes in BAT by IF staining. Brown fat cells were identified using an antibody against mouse Ucp1. Ucp1 staining is shown at lower magnification (×40) in the left panel covering a whole piece of BAT. Three representative areas are imaged at higher magnifications (a, b, and c, ×400 and ×1000), showing Fshr-ZsGreen colocalization with Ucp1-positive staining. Magnifications and scale bars are indicated in the figure. (E) Examination of peripheral neural fibers within BAT. To determine whether Fshr-ZsGreen is expressed in the peripheral nerves in BAT, we performed IF staining with an antibody against tyrosine hydroxylase (TH), a marker for peripheral sympathetic neurons. A whole piece of BAT was imaged at a lower magnification (×40) after being stained for TH, as shown in the left panel. Representative areas are presented in the right panels with higher magnifications (×400 - a, b, and c and ×1000 - d, e, and f, respectively). Arrows: red outlined arrowheads indicate Fshr-ZsGreen- and TH-positive large peripheral nerves; green outlined arrowheads point to Th-stained nerve fibrils accompanying Fshr-ZsGreen-positive nerve fibrils around an Fshr-ZsGreen-positive arteriole; red arrows indicate Fshr-ZsGreen- and TH-positive nerve fibrils; and white arrows indicate brown adipocytes with both Fshr-ZsGreen and TH expression. Magnifications: ×40 for the whole image of BAT in the left panel; ×400 for (a, b, and c); and ×1000 for (a, e, and f). Scale bars: indicated in the images. (F) Further confirmation of Fshr-ZsGreen expression in the peripheral nerves. To confirm Fshr-ZsGreen expression in peripheral neurons, we also employed another antibody against peripherin (Peri), a 57 kD type III intermediate filament that is a specific marker for peripheral neurons, to further identify peripheral neurons in BAT. The left panel shows an entire image of the BAT stained for Peri at a lower magnification (×40). The three representatives are shown in the right panel: (a) the first area located in the edge of the BAT with more white adipocytes; (b) the second area with more brown adipocytes and a large peripheral nerve; (c) the last area enriched with brown adipocytes. Their corresponding higher magnifications (×1000) are shown in (a, e, and f), respectively. Abbreviation: LNF, large never fibril. Arrows: empty white arrows - small peripheral fibrils; white arrow - Fshr-ZsGreen-positive fibrils, and empty white arrows - both Fshr-ZsGreen- and Peri-positive brown adipocytes. Magnifications: ×40 for the t panel; ×400 for (a, b, and c) and ×1000 for (d, e, and f). Scale bars: 1000 μm for the whole images in the left panel; 50 μm for (a, b, and c), and 20 μm for (d, e, and f). (G) Detection of Fshr expression in adipose tissues of B6 mice. Immunofluorescence staining for Fshr expression was carried out in frozen sections of white adipose tissue (the left panels) and brown fat (the right panels) from B6 mice at age of 3 months. Magnifications: ×40 and ×400. Scale bars: 500 μm and 50 μm.
Figure 5
Imaging of Fshr-ZsGreen expression in the heart and aorta.
Fshr-ZsGreen expression was imaged in frozen sections of the heart (A): cardiomyocytes (a) and smooth muscles (b). Then, immunofluorescence (IF) staining with antibodies against α-SMA (B) and EMCN (C) was carried out to identify cardiomyocytes and smooth muscles. The whole image of the heart with Fshr-ZsGreen expression and staining for α-SMA is shown in the left upper panel of (B). Its representative areas are presented at two magnifications of ×400 (B-a to h) and ×1000 (B-i to n), respectively, in the following: (1) ×400 magnification: (a) cross-oriented cardiomyocytes; (b) longitudinally oriented cardiomyocytes; (c) cross-oriented smooth muscle of the ascending aorta with brown adipose tissue; (d) smooth muscle of the left pulmonary artery with brown adipose tissue; (e) brown adipose tissue attached to a large artery; (f) layer of endothelial cells of the superior vena cava (SVC); (g) connective tissues between arteries containing brown adipose, different sized nerves and arteries; (h) another part of the SVC with layers of smooth muscles and connective tissue. (2) ×1000 magnification: (i) cardiomyocytes with an arteriole; (j) brown adipose tissue attached to the circulation system above the heart; (k) the layers of endothelial cells and smooth muscles of a bronchial artery; (m) transverse section of nerve fibers; (n) the layers of ECs and SM of the SVC. In addition, imaging of the IF staining for EMCN is shown in (C). The whole image of Fshr-ZsGreen and EMCN staining in the heart at a magnification of ×40 in the left upper panel, from which a representative of pulmonary artery at a magnification of 400 is shown in (a) at a magnification of ×400 (a); a representative of aorta is presented in (b). Representative images at higher magnification of ×1000: (c) cardiomyocytes in transverse orientation with a venule and (d) a layer of endothelial cells of pulmonary artery. Abbreviations: CM, cardiomyocytes; SM, smooth muscle; ECs, endothelial cells; N, never; B, brown adipose. Magnifications and scale bars are indicated as in the figure. Two orientations of the ascending aorta were examined for Fshr-ZsGreen after staining for α-SMA or EMCN: the longitudinal section (D-a to c) and the cross section (D-d to f). (D-a) shows the entire image of the ascending aorta stained for α-SMA at a magnification of ×100, while representative images at a higher magnification of ×1000 are presented in (D-b) for α-SMA staining and (D-c) for EMCN staining. The entire image of the transversely sectioned aorta (D-d) and representative images at a higher magnification of ×1000 for α-SMA (D-e) and EMCN (D-f). Abbreviations: TI, tunica intima, TM, tunica media, AV, aortic valve, SM, smooth muscles, Sub. CT, subendothelial connective tissue. Arrows: empty white arrows indicate arterioles positively stained for α-SMA in (b); empty arrowheads point to endothelial cells positively stained for either α-SMA or EMCN. Scale bars: 100 μm for (a and d) and 20 μm for (b, c, e, and f).
Figure 6
Fshr-ZsGreen expression in the lung and kidney.
Detection of Fshr-ZsGreen expression and immunofluorescence (IF) staining with PD-L1 was performed in lung sections at different magnifications. The whole image of the frozen sectioned lung is shown in the left panel at ×40 magnification (A - left panel). Representative areas are shown in the right panels at magnifications of ×400 (A-a to d) and ×1000 (A-e to h). They are the ciliated columnar cells of primary bronchi (a and c), the bronchioles with alveoli (b and f), respiratory bronchiole with bronchial gland (c and g) and alveoli (d and h). Arrows: empty white arrowheads-type I pneumocytes, white arrowheads-type II pneumocytes and white arrows-macrophages. Abbreviations: C, ciliated epithelium; PA, pulmonary arteriole; L, lumen; RB, respiratory bronchiole; BG, bronchial gland; A, alveoli; AD, alveolar duct. Magnifications: ×40 for the left image of the whole section, ×400 for (a–d), and ×1000 for (e–h). Scale bars: 1000 μm for the left panel, 50 μm for (a–d), and 20 μm for (e–h). Fshr-ZsGreen expression and staining with Col1a1 were examined in the sectioned kidney under confocal fluorescence microscopy at three magnifications (B). The images in the top panel are images of the whole section at ×40 magnification (a–d). The images in the middle panel show the colocalization of Fshr expression with positive staining for Col1a1 in the glomerulus and renal tubes (proximal and distal convoluted tubes) at ×400 magnification (e and f), while the bottom panel shows images of the glomerulus (g) and arteriole (h) at ×1000 magnification. Magnification: ×1000. Scale bars: 100 μm for (a–d), 50 μm for (e and f), and 20 μm for (g and h). Abbreviations: A, arteriole; PCT, proximal convoluted tubule; DCT, distal convoluted tubule; g, glomerulus.
Figure 7
Identification of Fshr-ZsGreen expression in the liver.
Frozen sectioned liver tissue was stained for Col1a1 (A), CD31 (B), or KCNMA1 (C), followed by florescent imaging for Fshr-ZsGreen and each of these stained molecules simultaneously. In the section stained for Col1a1 (A), two representative areas are shown at magnifications of ×400 and ×1000 as indicated: (1) hepatic cells with a central vein (CV) (a and c) and (2) hepatic artery (b and d). In the section stained for CD31 (B), a representative area of hepatic cells with a CV is shown at lower (a) and higher (b) magnifications. In the section stained for KCNMA1, three representative areas are presented at two magnifications as follows: (1) hepatic cells with a CV (a and b); (2) hepatic cells with peripheral nerve fibers (c and d); and (3) small nerve fibers located around a vein (e and f).
Figure 8
Visualization of Fshr-ZsGreen expression in the pancreas.
Visualized Fshr-ZsGreen expression was obtained in frozen sections of the pancreas under fluorescence microscopy after immunostaining with antibodies against NG3, insulin, or glucagon at two magnifications (×400 and ×1000). Images of Fshr-ZsGreen expression with NG3, insulin, and glucagon staining are shown in A, B, and C, respectively. Arrows: white arrows indicate acinar cells with stronger Fshr-ZsG expression.
Figure 9
Fshr-ZsGreen expression in the thyroid.
Fshr-ZsGreen expression was detected by its colocalization with immunostaining of TSH in frozen thyroid sections. The left panel is an entire image of the section, and two representative areas are in the right panels at higher magnifications, demonstrating Fshr-ZsGreen expression in follicular cells and parafollicular cells (C-cells) at the edge (a and b) and the center of the thyroid (c and d). Arrows: white arrowheads indicate follicular cells, and white arrows indicate parafollicular cells. Magnification: ×40 for the whole image.
Figure 10
Detection of Fshr-ZsGreen expression in the skin.
Fluorescence images of Fshr-ZsGreen were taken in two types of skin (A): thick skin (A-a) and thin skin (A-b). Then, immunofluorescence (IF) staining was performed using an antibody against CD34 to identify stem cells with Fshr-ZsGreen expression in the hair follicles (B) at lower (B-a) and higher (B-b) magnifications (×400 and ×1000, respectively). Abbreviations: HF, hair follicle; SG, sweat gland; FT, fat tissue; DP, dermal papillae. Magnifications: ×400 for (A and B-a), ×1000 for (B-b). Scale bars: 50 μm for (A and B-a) and 20 μm for (B-b).
Figure 11
Fshr-ZsGreen expression in skeletal muscle.
The whole image of frozen sectioned skeletal muscle (gastrocnemius) was taken at a lower magnification (×40) after the section was stained with anti-α-SMA antibody, as shown in the left panel (a). Then, longitudinal sections (b and c) and cross-sections (d and e) were imaged at higher magnifications (×400 and ×1000), respectively. In addition, frozen sections stained with antibodies against PAX7 (f and g) and TH (h and i) were imaged at two magnifications (×400 and ×1000) as indicated. Arrows: (1) In (b–e), empty white arrowheads indicate both Fshr-ZsGreen- and α-SMA-positive satellite cells; empty white arrows point to only Fshr-ZsGreen-positive satellite cells without α-SMA staining; white arrowheads indicate muscle fibrils with strong Fshr-ZsGreen expression but no α-SMA staining. (2) In (f and g), white arrowheads indicate muscle fibrils with strong Fshr-ZsGreen expression, blue arrows point to muscle fibrils with both Fshr-ZsGreen and TH expression, and red arrowheads indicate peripheral nerves with both Fshr-ZsGreen and TH expression. Magnifications: ×40 for (a), ×400 for (b, d, f, and h), and ×1000 for (c, e, g, and i). Scale bars: 1000 μm for (a), 50 μm for (b, d, f, and h), and 20 μm for (c, e, g, and i).
Figure 12
Examination of Fshr-ZsGreen expression in the spleen and bone marrow.
To identify Fshr-ZsGreen expression in immune cells of the spleen, immunofluorescence (IF) staining was performed in frozen sections of the spleen. Two antibodies against either CD11B or CD3 were used to identify myeloid-lineage cells or T-cells. Fshr-ZsGreen expression in myeloid-lineage cells with staining of CD11B is shown in (A), in which the left panel is the whole image of the spleen at a low magnification and its three representative areas are presented at higher magnifications (×400 and ×1000): (1) an area located at the edge showing strong Fshr-ZsGreen and CD11B expression (a and b); (2) an area of red pulp (c and d); (3) an area of white pulp (e and f). Fshr-ZsGreen expression in T cells with staining of CD3 is shown in (B), in which a large piece of spleen is shown in a and three representative areas are presented at a magnification of 100x (b-trabeculae; c-a WP area and d-a RP area). Images for bone marrow sections with staining of F4/80 are shown in (C) (a-the center of bone marrow and b-an area close to the cortex). Abbreviations: RP, red pulp; WP, white pulp; BM, bone marrow; F, fibroelastic capsule; T, trabeculae; and MZ, marginal zone. Scale bars are indicated in each image.
Figure 13
Fshr-ZsGreen expression in the representative areas of the brain.
Fshr expression in three representative areas of the brain - the olfactory bulbs (a, d, and g), pallidum (b, e, and h), and hippocampus (c, f, and j). Each section was immunofluorescently stained with antibodies against GFAP, Iba1, or NeuN that recognized markers for astrocytes (a–c), microglia (d–f), or neuron (g–j), respectively. Their colocalizations are indicated by white arrowheads. Abbreviation: OLB, olfactory bulb. Magnifications: ×400 for (a, c, and f) and ×1000 for (b, d, e, f, g, and h). Scale bars are indicated in each image.
Figure 14
Confirmation of Fshr-ZsGreen expression by immunofluorescence (IF) staining with a specific antibody against mouse Fshr and droplet digital RT-PCR (ddRT-PCR).
The Fshr-ZsGreen expression described above was further confirmed by IF staining using an antibody against mouse Fshr and ddRT-PCR. The frozen tissue sections used for this confirmation include bone, BAT, thyroid, cardiac muscles, kidney, liver, lung, aorta, ovary, and testis (A), demonstrating Fshr-ZsGreen colocalization with Fshr-positive staining in these tissues/organs. Fshr expression at the mRNA level in different tissues/organs was examined by ddRT-PCR (B) (the representative of two experiments). The results indicate that Fshr is expressed in all examined tissues/organs (n=3). Based on their expression levels, they can be categorized into three groups: (1) high (H), including lung and kidney, ranging from 1005 to 1843 copies/μL; (2) middle (M), including thoracic (T) vertebra, skull, femur, jejunum, liver, tooth, tibia, and muscle, ranging from 173 to 475 copies/μL; and (3) low (L), including duodenum, pancreas, brain, WAT, thyroid, BAT, tongue, bladder, heart, stomach, spleen, skin, cartilage, and tail, ranging from 5.4 to 81 copies/μL.
Appendix 1—figure 1
No non-specific Fshr-ZsGreen expression in the examined tissues/organs from B6 mice.
Appendix 1—figure 2
Negative controls for IFs with anti-Fshr antibody.
Appendix 1—figure 3
FSHR expression in the liver and lung detected by scRNA-seq from DISCO (https://immunesinglecell.org/genepage/FSHR).
Appendix 1—figure 4
FSHR expression in bone marrow and heasrt detected by scRNA-seq detected by scRNA-seq from DISCO (https://immunesinglecell.org/genepage/FSHR).
Appendix 1—figure 5
FSHR expression in the breast and heart detected by scRNA-seq detected by scRNA-seq from DISCO (https://immunesinglecell.org/genepage/FSHR).
Appendix 1—figure 6
FSHR expression in skeletal muscle and thymus detected by scRNA-seq from DISCO (https://immunesinglecell.org/genepage/FSHR).
Appendix 1—figure 7
FSHR expression in the testis and ovary detected by scRNA-seq from DISCO (https://immunesinglecell.org/genepage/FSHR).
Appendix 1—figure 8
FSHR exxpression detected by scRNA-seq from GTEx (https://www.gtexportal.org/home/gene/FSHR#singleCell).
Appendix 1—figure 9
FSHR expression in human cells detected by scRNA-seq from BioGPS (http://biogps.org/#goto=searchresult).
Appendix 1—figure 10
FSHR expression in rat cells detected by scRNA-seq from BioGPS (http://biogps.org/#goto=searchresult).
Appendix 1—figure 11
FSHR expression in adipose tissues detected by scRNA-seq from Single Cell Portal (https://singlecell.broadinstitute.org/single_cell).
Appendix 1—figure 12
FSHR expression in the brain detected by scRNA-seq from Single Cell Portal.
Appendix 1—figure 13
FSHR expression in the liver detected by scRNA-seq from Single Cell Portal (https://singlecell.broadinstitute.org/single_cell).
Appendix 1—figure 14
FSHR expression in the heart and vascular system detected by scRNA-seq from Single Cell Portal (https://singlecell.broadinstitute.org/single_cell).
Appendix 1—figure 15
FSHR expression in the kidney detected by scRNA-seq from Single Cell Portal (https://singlecell.broadinstitute.org/single_cell).
Appendix 1—figure 16
16 FSHR expression in the lung detected by scRNA-seq from Single Cell Portal.
Appendix 1—figure 17
FSHR expression in the ovary and pancreas detected by scRNA-seq from Single Cell Portal.
Appendix 2—figure 1
First set of Integration detection PCR primer designs.
Appendix 2—figure 2
The schematic for the first set of genotyping PCR primer design and conditions.
Appendix 2—figure 3
Second set of junction PCR primer designs.
Appendix 2—figure 4
A schematic for the second set of genotyping PCR primer design and condition.
Appendix 2—figure 5
PCR primer designs.
Tables
Appendix 2—table 1
Primer sequences.
| Primer | Sequence (5'–3') | Tm(°C) | Product size (bp) |
|---|---|---|---|
| EGE-YHN-013-A-WT-F2 | ACTTCCACTCCAGAAAGAATCCCT | 58 | WT:166Mut:937 |
| EGE-YHN-013-A-WT-R2 | CTCTTCCATAGCCCTCTCTCCAG | 58 | |
| EGE-YHN-013-A-Mut-F | CGACACCGTGTACAAGGCCAAGTC | 64 | Mut:316 |
| EGE-YHN-013-A-WT-R | TAATGGTCCCTGACCTATCTGCCAT | 61 | |
| EGE-YHN-013-A-WT-F | ATCACTGTGTCCAAGGCCAAGATCC | 63 | Mut:542 |
| EGE-YHN-013-A-Mut-R | TACATGAAGGCGGCGGACAAGATG | 63 |
Appendix 2—table 2
Sequences for genotyping F0 and F1.
| Primer | Sequence (5'–3') | Tm(°C) | Product size (bp) |
|---|---|---|---|
| EGE-YHN-013-A-L-GT-F | ACTCAGGTTGTGGCCAGATGGTTTC | 63 | Mut:2188 |
| EGE-YHN-013-A-Mut-R | TACATGAAGGCGGCGGACAAGATG | 63 | |
| EGE-YHN-013-A-Mut-F | CGACACCGTGTACAAGGCCAAGTC | 64 | Mut:2074 |
| EGE-YHN-013-A-R-GT-R | TGGCCTCACAAAGACAGCACAGATT | 62 | |
| EGE-YHN-013-A-R-GT-F | TGGAGGAGAACCCTGGACCTATGG | 62 | Mut:2636 |
| EGE-YHN-013-A-R-GT-R | TGGCCTCACAAAGACAGCACAGATT | 62 |
Appendix 2—table 3
Sequences for genotyping heterozygotes and homozygotes.
| Primer | Sequence (5'–3') | Tm(°C) | Product size (bp) |
|---|---|---|---|
| EGE-YHN-013-A-WT-F2 | ACTTCCACTCCAGAAAGAATCCCT | 58 | WT:166Mut:937 |
| EGE-YHN-013-A-WT-R2 | CTCTTCCATAGCCCTCTCTCCAG | 58 | |
| EGE-YHN-013-A-WT-F | ATCACTGTGTCCAAGGCCAAGATCC | 63 | Mut:542 |
| EGE-YHN-013-A-Mut-R | TACATGAAGGCGGCGGACAAGATG | 63 |
Appendix 3—table 1
The primary antibodies used for IFs.
| # | Samples | The primary Abs.[rabbit anti-mouse (IgG)] | Sources | Cat. No. | Dilutions |
|---|---|---|---|---|---|
| 1 | WAT | Anti-Ucp1 pAb | Servicebio | GB112174 | 1:400 |
| 2 | BAT | Anti-Ucp1 pAb | Servicebio | GB112174 | 1:400 |
| Anti-Peripherin pAb | Servicebio | GB111635 | 1:1100 | ||
| Anti-Tyrosine hydroxylase pAb | Servicebio | GB11181 | 1:800 | ||
| 3 | Heart | Anti-Endomucin pAb | Servicebio | GB112648 | 1:600 |
| Anti--α-SMA Ab | Servicebio | GB111364 | 1:200 | ||
| 4 | Liver | Anti-CD31 pAb | Servicebio | GB11063-2 | 1:100 |
| Anti-Collagen I pAb | Servicebio | GB11022-3 | 1:800 | ||
| Anti-KCNMA1/BK channel Ab | Bioss | bs-4775R | 1:200 | ||
| 5 | Spleen | Anti -CD3 pAb | Servicebio | GB11014 | 1:400 |
| Anti -CD11b pAb | Servicebio | GB11058 | 1:500 | ||
| 6 | Lung | Anti-PD-L1/CD274 pAb | ABclonal | A1645 | 1:100 |
| 7 | Kidney | Anti-Laminin antibody | Bioss | bs-0821R | 1:300 |
| Anti-Col1a1 pAb | Servicebio | GB11022-3 | 1:800 | ||
| 8 | Muscle | Anti-Tyrosine Hydroxylase pAb | Servicebio | GB11181 | 1:800 |
| Anti-α-SMA pAb | Servicebio | GB111364 | 1:500 | ||
| Anti-CD31 pAb | Servicebio | GB11063-2 | 1:100 | ||
| Anti-PAX7 pAb | Servicebio | GB113190 | 1:2500 | ||
| 9 | Aorta | Anti-Endomucin pAb | Servicebio | GB112648 | 1:600 |
| Anti--α-SMA pAb | Servicebio | GB111364 | 1:200 | ||
| 10 | Testis | Anti-Stra8 pAb | Bioss | bs-1903R | 1:300 |
| 11 | Pancreas | Anti-Insulin pAb | Servicebio | GB11334 | 1:400 |
| Anti-Glucagon pAb | Servicebio | GB11097 | 1:800 | ||
| Anti-Neurogenin3 Ab | Bioss | bs-0922R | 1:300 | ||
| 12 | Brain | Anti-NeuN pAb | Servicebio | GB11138 | 1:500 |
| Anti-GFAP pAb | Servicebio | GB11096 | 1:800 | ||
| 13 | Femur | Anti-Osteocalcin pAb | Servicebio | GB11233 | 1:100 |
| Anti-Trap pAb | Servicebio | GB11416 | 1:400 | ||
| Anti-Tyrosine hydroxylase pAb | Servicebio | GB11181 | 1:800 | ||
| 14 | Skin | Anti-CD34 pAb | Servicebio | GB111693 | 1:500 |
| 15 | Thyroid | Anti-Tshr pAb | Servicebio | GB113007 | 1:500 |
| 16 | Colon | Anti-CD34 pAb | Servicebio | GB111693 | 1:500 |
| Anti-CD133 pAb | Servicebio | GB113807 | 1:1000 | ||
| 17 | Duodenum | Anti-Taf4 pAb | Servicebio | GB111725 | 1:900 |
| 18 | Jejunun | Anti-CD34 pAb | Servicebio | GB111693 | 1:500 |
| Anti-CD133 pAb | Servicebio | GB113807 | 1:1000 | ||
| 19 | Ovary | Anti-Taf4 pAb | Servicebio | GB111725 | 1:950 |
| Anti-CD34 pAb | Servicebio | GB111693 | 1:500 | ||
| 20 | Bladder | Anti-SET pAb | Servicebio | GB113290 | 1:5000 |
| 21 | Prostate | Anti-SET pAb | Servicebio | GB113290 | 1:5000 |
| 22 | Testis | Anti-SET pAb | Servicebio | GB113290 | 1:5000 |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Atlas of Fshr expression from novel reporter mice
eLife 13:RP93413.
https://doi.org/10.7554/eLife.93413.3
