Tgfbr1 regulates lateral plate mesoderm and endoderm reorganization during the trunk to tail transition
- Instituto Gulbenkian de Ciência, Rua da Quinta Grande, Portugal
- Gulbenkian Institute for Molecular Medicine, Avenida Prof. Egas Moniz, Portugal
- Developmental Biology Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, United States
Figures
Figure 1 with 1 supplement
In situ hybridization showing expression patterns of the main mesodermal markers.
(A–d’) Expression of somatic lateral plate mesoderm (LPM) marker Irx3 (A, B) and splanchnic LPM marker Foxf1 (C, D) in control (A, C) and Tgfbr1−/− (B, D) E9.5 embryos. Next to the images of the …
Figure 1—figure supplement 1
Expression of the intermediate mesoderm (IM) marker Pax2 in Tgdfr1−/− embryos.
(A–b”) Pax2 expression in E9.5 control (A–a”) and Tgfbr1−/− (B–b”) embryos. (a–a”) and (b–b”) show sections through the region marked by the rectangle in A’ and B’. (C–d”) Pax2 expression in E10.5 …
Figure 2 with 1 supplement
Main vascular tree of the Tgfr1−/− embryos.
Whole-mount immunostaining for Pecam1 (red) labeling endothelial cells in E9.5 control (A, a) and mutant (C, c) embryos. Nuclei shown in cyan. Transversal sections through regions marked by the …
Figure 2—figure supplement 1
Pericloacal mesenchyme derives from the mesoderm adjacent to the allantois.
(A) Whole-mount in situ hybridization showing Foxf1 expression in E10.5 wild-type embryos. Yellow arrows show expression in the pericloacal mesenchyme. Inset shows a ventral view in the pericloacal …
Figure 3 with 2 supplements
Posterior primitive streak contributes to the pericloacal mesenchyme and gut endoderm.
Whole-mount in situ hybridization showing expression of Foxf1 in E8.5 Tgfbr1−/− (A) and control (B) embryos. al – allantois, g – gut, PS – primitive streak, L – lateral view, V – ventral view, D – …
Figure 3—figure supplement 1
Characterization of the recombination activity of the Tstr-creERT transgenics.
These transgenics were analyzed by crossing them with ROSA26R-YFP mice. While non-treated embryos showed only rare events of spontaneous recombination (a), administration of tamoxifen at early …
Figure 3—figure supplement 2
Estimating the time required for recombination after tamoxifen administration in Tstr-creERT::ROSA26R-YFP embryos.
No evident sign of recombination was observed after up to 6 hr of treatment (a–c), only a few scarce spontaneous events. Embryos harvested 8 hr after tamoxifen administration exhibited early signs …
Figure 4
Effects of Tgfbr1 in the lateral plate mesoderm (LPM), but not in the tail bud, are mediated by Isl1.
Whole-mount in situ hybridization showing expression of Sox2 (A–C) and Uncx4.1/Tbxt (D–F) in the E9.5 control (A, D), Isl1−/− (B, E), and Tgfbr1−/− (C, F) embryos. Isl1−/− embryos form tail bud …
Figure 5
Main vascular tree of the Isl1−/− embryos.
Whole-mount immunostaining for Pecam1 (red) labeling endothelial cells in E9.5 control (A) and mutant (C) embryos. (a, c) Optical transversal sections through regions marked by the dashed lines in A …
Figure 6 with 1 supplement
Endoderm of the Tgfbr1 KO.
Expression of Foxa2 in E9.5 control (A, a) and Tgfbr1 KO (B, b) embryos. a and b show sagittal sections though the tail region. Keratin 8 staining of the cloaca region in the control (C, c) and …
Figure 6—figure supplement 1
Whole-mount in situ hybridization on E9.5 wild-type (A) and Tgfbr1−/− (B) embryos with a probe for Shh.
In wild-type embryos, the endoderm forms the cloaca at the level of the developing hindlimb (arrow) and extends into the emerging tail bud. In the mutant embryo, the endoderm finishes at the …
Figure 7 with 1 supplement
Analysis of the contribution of the visceral endoderm to the embryonic gut.
GFP expression from the Afp-GFP transgenics was analyzed at E8.5 (A–B’), E9.5 (C–D’’), or E10.5 (E–F’’’) in wild-type (A, A’, C–C’’, E, E’) or Tgfbr1−/− (B, B’, D–D’’, F–F’’’) embryos. (C’ and D’) …
Figure 7—figure supplement 1
Analysis of visceral endoderm (VE) dispersal in wild-type and Tgfbr1 mutant E7.5 embryos.
No differences can be seen in the mutant embryo relative to the wild-type control.
Figure 8 with 2 supplements
Tail gut endoderm has contribution from the posterior pool of tail bud cells.
(A) Whole-mount in situ hybridization showing expression of Apela in E10.5 wild-type embryo. (B) Sagittal section through the region marked by rectangle in A shows presence of Apela-stained …
Figure 8—figure supplement 1
Tail gut of E9.5 wild-type embryo.
(A, C) Apela staining in the wild-type tail bud at E9.5. (C) shows a series of transversal sections through the Apela-positive region shown in the whole-mount image in A. (B, b) Keratin 8-stained …
Figure 8—figure supplement 2
DiI labeling of the Apela-positive region in the E9.5 tail bud.
(A–c3) Control showing injected region prior to culture. Sagittal and transversal sections shown in b–c3 show absence of DiI label in the gut. (D–i’2) DiI labeling of E9.5 embryos. Embryos shown in D…
Figure 9
Schematic representation of Tgfbr1 activity on the posterior epiblast/primitive streak (PS) region during the trunk to tail transition.
At E8.5 embryo undergoes turning, associated with anterior relocation of the allantois along the ventral side of the embryo. In wild-type embryos (top panel), Tgfbr1 acts upstream of Isl1, which …
Author response image 1
Image showing an example of an ISH procedure with a probe against Tgfbr1, showing widespread and low expression.
The lower picture shows a ventral view of a stained wild type E10.5 embryo.
Tables
Table 1
Genotyping primers.
| Genotyping primers | ||
|---|---|---|
| Tgfbr1 mutant allele | Forward | CTACTGTGTTTCAAATGGGAGGGC |
| Reverse | GGCCTGTCGGATCCTATCATC | |
| Tgfbr1 wild-type allele | Forward | CTACTGTGTTTCAAATGGGAGGGC |
| Reverse | ACATACAAATGGCCTGTCTCG | |
| Isl1 mutant allele | Forward | GCCACTATTTGCCACCTAGC |
| Reverse | AGGCAAATTTTGGTGTACGG | |
| Isl1 wild-type allele | Forward | GCCACTATTTGCCACCTAGC |
| Reverse | CAAATCCAAAGAGCCCTGTC | |
| Cre recombinase | Forward | CGAGTGATGAGGTTCGCAAG |
| Reverse | CCTGATCCTGGCAATTTCGGCT | |
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (M. musculus) | Isl1Cre | Jackson Labs | Stock # 024242 RRID:IMSR_JAX:024242 | Yang et al., 2006 |
| Strain, strain background (M. musculus) | ROSA26-R-gal | Jackson Labs | Stock #003474, RRID:IMSR_JAX:003474 | Soriano, 1999 |
| Strain, strain background (M. musculus) | ROSA26-R-EYFP | Jackson Labs | Stock #006148, RRID:IMSR_JAX:006148 | Srinivas et al., 2001 |
| Strain, strain background (M. musculus) | Tgfbr1+/− | Kwon et al., 2008 eLife 9, e56615 | ||
| Strain, strain background (M. musculus) | Alf-GFP | Kwon et al., 2008 Dev. Cell 15, 509–520 | ||
| Antibody | Pecam1 | Abcam | Cat #ab28364, RRID:AB_726362 | |
| Antibody | Keratin 8 | Developmental Studies Hybridoma Bank | Troma 1, RRID:AB_2891089 | |
| Antibody | Epcam | Biolegend | Cat #118202, RRID:AB_1089027 | |
| Antibody | GFP | Aveslabs | Cat #GFP-1020 | |
| Antibody | Sheep antidigoxigenin Fab fragments | Roche | Cat #11093274910, RRID:AB_514497 | AP-conjugated |
| Recombinant DNA reagent | T-Str-promoter | Clements et al., 1996 Mech. Dev. 56, 139–149 | Primitive streak specific promoter from Tbxt | |
| Recombinant DNA reagent | creERT | Jurberg et al., 2013 Dev. Cell 25, 451–462 | Tamoxifen-inducible cre recombinase | |
| Sequence-based reagent | Oligonucleotides | Table 1 | ||
| Commercial assay or kit | DIG RNA Labeling Mix | Roche | Cat #11277073910 | |
| Commercial assay or kit | NBT/BCIP solution | Roche | Cat #11681451001 | |
| Commercial assay or kit | Blocking reagent | Roche | Cat #11096176001 | |
| Chemical compound, drug | CellTracker CM-DiI | Life Technologies | Cat #C7000 | |
| Chemical compound, drug | Proteinase K | Roche | Cat #3115801001 | |
| Chemical compound, drug | Tamoxifen | Sigma | Cat #T5648 | |
| Chemical compound, drug | RapiClear | SUNJin lab | Cat #1.49 |
