(A) Morphological categories of budding yeast cells using brightfield microscopy and DAPI staining were used to determine G2/M arrest. Cells that arrest at G2/M shift toward a large bud state. G2/M-a…
Original membranes corresponding to Figure 1C.
Original files corresponding to Figure 1C.
Original membranes corresponding to Figure 1F.
Original files corresponding to Figure 1F.
(A) Above: percentage of G2/M-arrested cells in a 2-DSB DDC2-AID strain after DNA damage induction in a liquid culture. Cultures were split 4 hr after galactose treatment to induce DNA damage by …
Original membranes corresponding to Figure 2A.
The 7 hr ± IAA samples were added to the last two wells.
Original files corresponding to Figure 2A.
Original membranes corresponding to Figure 2B.
Original files corresponding to Figure 2B.
Original membranes corresponding to Figure 2C.
Original files corresponding to Figure 2C.
Original membranes corresponding to Figure 2D.
Original files corresponding to Figure 2D.
(A) Adaptation assay of 50 G1 cells on a YEP-Gal plate after 24 hr for 2-DSB (WT), 2-DSB DDC2-AID, 2-DSB RAD9-AID, 2-DSB RAD24-AID, and 2-DSB RAD53-AID with TIR1. (B) Adaptation assay of 50 G1 cells …
(A) Morphological profile of a 2-DSB background where 1 mM auxin (IAA) was added 2 hr before DSB induction with galactose. Western blot of a 2-DSB strain probed with α-Rad53. α-Rad53 shows both an …
Original membranes corresponding to Figure 2—figure supplement 2A.
Original files corresponding to Figure 2—figure supplement 2A.
Original membranes corresponding to Figure 2—figure supplement 2B.
Original files corresponding to Figure 2—figure supplement 2B.
Original membranes corresponding to Figure 2—figure supplement 2C.
Original files corresponding to Figure 2—figure supplement 2C.
Original membranes corresponding to Figure 2—figure supplement 2D.
Original files corresponding to Figure 2—figure supplement 2D.
Original membranes corresponding to Figure 2—figure supplement 2E.
Original files corresponding to Figure 2—figure supplement 2E.
(A) Profile of DAPI-stained cells in a 2-DSB DDC2-AID strain after HO induction. Cultures were split 4 hr after Gal-HO induction. Cells were divided based on cell morphology and number of DAPI …
(A) Percentage of G2/M cells in a 2-DSB chk1∆ strain following DNA damage. Data are shown from three independent experiments, with error bars representing the standard error of the mean (SEM). …
Original membranes corresponding to Figure 3A.
Original files corresponding to Figure 3A.
Original membranes corresponding to Figure 3C.
Original files corresponding to Figure 3C.
Original membranes corresponding to Figure 3D.
Original files corresponding to Figure 3D.
Original membranes corresponding to Figure 3E.
Original files corresponding to Figure 3E.
Original membranes corresponding to Figure 3F.
Original files corresponding to Figure 3F.
(A) Adaptation assay for a tel1∆ strain. Cultures were grown in YEP-Lac and put on a YEP-Gal plate. 50 G1 cells were selected to monitor their morphology after 4 and 24 hr on the YEP-Gal plate. (B) …
Original membranes corresponding to Figure 3—figure supplement 1B.
Original files corresponding to Figure 3—figure supplement 1B.
(A) Adaptation assay of 50 G1 cells on a YEP-Gal plate with 2-DSB dun1∆. G2/M arrest was determined based on cell morphology as shown in Figure 1A. Data is shown from three trials with standard …
Original membranes corresponding to Figure 4A.
Original files corresponding to Figure 4A.
Original membranes corresponding to Figure 4B.
Original files corresponding to Figure 4B.
Original membranes corresponding to Figure 4C.
Original files corresponding to Figure 4C.
(A) Percentage of G2/M-arrested cells for 2-DSB DDC2-AID after HO induction. Data is shown from three trials with standard error of the mean (SEM). Western blot probed with α-Rad53 and α-Myc. …
Original membranes corresponding to Figure 5A.
The 24 hr ± IAA samples were added to the last two wells.
Original files corresponding to Figure 5A.
Original membranes corresponding to Figure 3C.
Original files corresponding to Figure 3C.
Original membranes corresponding to Figure 3D.
Original files corresponding to Figure 3D.
Original membranes corresponding to Figure 3E.
Original files corresponding to Figure 3E.
(A, B) Western blots probed with α-Myc for Ddc2-9xMyc and Ddc2-9xMyc-AID in a 1-DSB and 2-DSB, respectively. α-Pgk1 is used as a loading control. (C) Relative levels of Ddc2 in a 1-DSB and 2-DSB …
Original membranes corresponding to Figure 5—figure supplement 1A.
Original files corresponding to Figure 5—figure supplement 1A.
Original membranes corresponding to Figure 5—figure supplement 1B.
Original files corresponding to Figure 5—figure supplement 1B.
(A) Percentage of G2/M-arrested cells for 2-DSB MAD2-AID after HO induction. Data is shown from three trials with standard error of the mean (SEM). Western blot probed with α-Rad53 and α-Myc. …
Original membranes corresponding to Figure 6A.
Original files corresponding to Figure 6A.
Original membranes corresponding to Figure 6C.
Original files corresponding to Figure 6C.
(A) Adaptation assay of 1-DSB and 2-DSB where morphology is measured for up to 24 hr and 48 hr, respectively. A second copy of Ddc2 with a GAL1,10 promotor, Ddc2 overexpression (Ddc2oe), was …
(A) Morphological profile of MAD2-AID after HO induction on a YEP-Gal or YEP-Gal-IAA plate. Galactose was added to an overnight culture of Mad2-AID in YEP-Lac. 4 hr after adding galactose, cells …
Original membranes corresponding to Figure 6—figure supplement 2B.
Original files corresponding to Figure 6—figure supplement 2B.
Original membranes corresponding to Figure 6—figure supplement 2C.
Original files corresponding to Figure 6—figure supplement 2C.
(A) Morphological profile of a 2-DSB MAD2-AID and DDC2-AID MAD2-AID strains after HO induction. Cultures were added onto YEP-Gal ± IAA plates 15 hr after adding HO induction. Ctrl samples were …
Original membranes corresponding to Figure 6—figure supplement 3A.
Original files corresponding to Figure 6—figure supplement 3A.
(A) Percentage of G2/M-arrested cells for 2-DSB BUB2-AID after HO induction. Data is shown from three trials with standard error of the mean (SEM). Western blot probed with α-Rad53 and α-Myc. …
Original membranes corresponding to Figure 7A.
Original files corresponding to Figure 7A.
Original membranes corresponding to Figure 7C.
Original files corresponding to Figure 7C.
(A) Morphological profile of a 2-DSB BUB2-AID strain with the auxin-Gal plating assay. Cultures were added onto YEP-Gal ± IAA plates 4 hr after HO induction. Western blot probed with α-Rad53 and …
Original membranes corresponding to Figure 7—figure supplement 1A.
Original files corresponding to Figure 7—figure supplement 1A.
Original membranes corresponding to Figure 7—figure supplement 1C.
Original files corresponding to Figure 7—figure supplement 1C.
(A) Adaptation assay of 1-DSB and 2-DSB strains tracking the morphology of 50 G1 cells on a YEP-Gal plate. The percentage of G2/M-arrested cells was shown 4 hr and 24 hr after placement of YEP-Gal …
Growth rate of strains were measured in YPD (2% dextrose) in H2A and H2B mutants for up to 10 hr. Cultures were grown in YPD until they reached an OD600 of 0.1. The OD of each strain was then …
Figure | Strain | Timepoint comparison* | p-Value | Significance | Post hoc test† |
---|---|---|---|---|---|
Figure 2A | DDC2-AID | 0 vs 5 + IAA | <0.0001 | **** | Sidak |
0 vs 6 + IAA | <0.0001 | **** | Sidak | ||
0 vs 7 + IAA | <0.0001 | **** | Sidak | ||
0 vs 8 + IAA | 0.0009 | *** | Sidak | ||
0 vs 9 + IAA | 0.054 | ns | Sidak | ||
Figure 3D | DDC2-AID CHK1∆ | 0 vs 5 + IAA | <0.0001 | **** | Sidak |
0 vs 6 + IAA | <0.0001 | **** | Sidak | ||
0 vs 7 + IAA | 0.10 | ns | Sidak | ||
0 vs 8 + IAA | 0.25 | ns | Sidak | ||
0 vs 9 + IAA | 0.072 | ns | Sidak | ||
Figure 2B | RAD9-AID | 0 vs 5 + IAA | <0.0001 | **** | Sidak |
0 vs 6 + IAA | <0.0001 | **** | Sidak | ||
0 vs 7 + IAA | <0.0001 | **** | Sidak | ||
0 vs 8 + IAA | 0.0055 | ** | Sidak | ||
0 vs 9 + IAA | 1.00 | ns | Sidak | ||
Figure 3E | RAD9-AID CHK1∆ | 0 vs 5 + IAA | 0.00050 | *** | Sidak |
0 vs 6 + IAA | 0.0052 | ** | Sidak | ||
0 vs 7 + IAA | 0.21 | ns | Sidak | ||
Figure 2C | RAD24-AID | 0 vs 5 + IAA | <0.0001 | **** | Sidak |
0 vs 6 + IAA | <0.0001 | **** | Sidak | ||
0 vs 7 + IAA | 0.00 | *** | Sidak | ||
0 vs 8 + IAA | 0.36 | ns | Sidak | ||
0 vs 9 + IAA | 0.90 | ns | Sidak | ||
Figure 3F | RAD24-AID CHK1∆ | 0 vs 5 + IAA | 0.00010 | *** | Sidak |
0 vs 6 + IAA | 0.00020 | *** | Sidak | ||
0 vs 7 + IAA | 0.10 | ns | Sidak | ||
Figure 5D | RAD53-AID TIR1(F74G) | 18 vs 18 + IAA | 0.35 | ns | Sidak |
21 vs 21 + IAA | 0.96 | ns | Sidak | ||
24 vs 24 + IAA | 0.42 | ns | Sidak | ||
Figure 5E | RAD9-AID pRAD9-AID | 18 vs 18 + IAA | 0.80 | ns | Sidak |
21 vs 21 + IAA | 0.99 | ns | Sidak | ||
24 vs 24 + IAA | 0.84 | ns | Sidak | ||
Figure 6—figure supplement 3A | DDC2-AID MAD2-AID AND MAD2-AID | 18 + IAA vs 18 + IAA | 0.95 | ns | Sidak |
21 + IAA vs 21 + IAA | 0.64 | ns | Sidak | ||
24 + IAA vs 24 + IAA | 0.97 | ns | Sidak |
Timepoints are relative to when galactose was added.
A one-way ANOVA was used to test for significant differences.
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Antibody | Anti-Rad53; (mouse monoclonal) | Abcam | Cat# ab166859; RRID:AB_2801547 | WB (1:1000) |
Antibody | Anti-Rad53; (rabbit polyclonal) | Abcam | ab104232 | WB (1:1000) |
Antibody | Anti-Myc; (mouse monoclonal) | Abcam | Cat# ab16918; RRID:AB_30256 | WB (1:1000) |
Antibody | Anti-Pgk1; (mouse monoclonal) | Abcam | Cat# ab32; RRID:AB_30359 | WB (1:5000) |
Antibody | Anti-Rad9; (rabbit polyclonal) | Usui et al., 2009 | N/A | WB (1:4000) |
Antibody | ECL TH Anti-mouse IgG horseradish peroxidase from sheep | GE Healthcare | NXA931V Lot 16937010 | WB (1:10,000) |
Antibody | ECL TH Anti-rabbit IgG horseradish peroxidase from donkey | GE Healthcare | NA934V lot 6969611 | WB (1:10,000) |
Chemical compound, drug | Indole-3-acetic acid | Sigma-Aldrich | I3750-25G-A | 1 mM |
Chemical compound, drug | 5-Ph-IAA | Sigma-Aldrich | SML3574-25MG | 1 µM |
Chemical compound, drug | Formaldehyde | Sigma-Aldrich | 47608 | 4% |
Chemical compound, drug | VECTASHIELD Antifade Mounting Medium with DAPI | Vector Laboratories | Cat# H-1200 | 1 μg/ml |
Chemical compound, drug | Prometheus Protein Biology Products 20–313 OneBlock Western-CL Blocking Buffer, For Chemiluminescent Blots | Genesee Scientific | Cat# 20-313 | Blocking buffer for western blots |
Commercial assay or kit | ECL Prime Western Blotting System | MilliporeSigma | GERPN2232 | |
Strain, strain background (Saccharomyces cerevisiae) | cerevisiae: strain background S228c | See Supplementary file 1a for full strain list | N/A | Strains used in this study |
Strain, strain background (S. cerevisiae) | JKM179 | Lee et al., 1998 | Yeast strain | MATα ade1 leu2-3 lys5 trp1 ::hisG ura3-52 hoΔ hmlΔ::ADE1 hmr Δ::ADE1 ade3:: GAL::HO |
Strain, strain background (S. cerevisiae) | DW184 | This study | Yeast strain | TIR1-myc6::URA3 |
Strain, strain background (S. cerevisiae) | DW417 | This study | Yeast strain | HOcse6::HPH TIR1 -myc6::URA3 |
Strain, strain background (S. cerevisiae) | DW418 | This study | Yeast strain | Ddc2-AID*–9xMyc::KAN |
Strain, strain background (S. cerevisiae) | DW419 | This study | Yeast strain | Rad9-AID*–9xMyc::KAN |
Strain, strain background (S. cerevisiae) | DW420 | This study | Yeast strain | Rad24-AID*–9xMyc::KAN |
Strain, strain background (S. cerevisiae) | DW421 | This study | Yeast strain | Rad53-AID*–9xMyc::KAN |
Strain, strain background (S. cerevisiae) | DW426 | This study | Yeast strain | chk1∆::NAT |
Strain, strain background (S. cerevisiae) | DW647 | This study | Yeast strain | Ddc2-AID*–9xMyc::KAN chk1∆::NAT |
Strain, strain background (S. cerevisiae) | DW427 | This study | Yeast strain | Rad9-AID*–9xMyc::KAN chk1∆::NAT |
Strain, strain background (S. cerevisiae) | DW428 | This study | Yeast strain | Rad24-AID*–9xMyc::KAN chk1∆::NAT |
Strain, strain background (S. cerevisiae) | DW429 | This study | Yeast strain | Rad53-AID*–9xMyc::KAN chk1∆::NAT |
Strain, strain background (S. cerevisiae) | DW625 | This study | Yeast strain | dun1∆::KAN |
Strain, strain background (S. cerevisiae) | DW626 | This study | Yeast strain | Dun1-AID*–9xMyc::KAN |
Strain, strain background (S. cerevisiae) | DW641 | This study | Yeast strain | Dun1-AID*–9xMyc::KAN chk1∆::NAT |
Strain, strain background (S. cerevisiae) | FZ009 | This study | Yeast strain | Mad2*–9xMyc-AID::NAT |
Strain, strain background (S. cerevisiae) | FZ010 | This study | Yeast strain | Ddc2-AID*–9xMyc ::KAN Mad2*–9xMyc -AID::NAT |
Strain, strain background (S. cerevisiae) | DW455 | This study | Yeast strain | mad2Δ::KAN |
Strain, strain background (S. cerevisiae) | GM180 | Memisoglu et al., 2019 | Yeast strain | pGal::Ddc2::LEU2 |
Strain, strain background (S. cerevisiae) | DW648 | This study | Yeast strain | HOcse6::HPH pGal:: Ddc2::LEU2 |
Strain, strain background (S. cerevisiae) | DW649 | This study | Yeast strain | HOcse6::HPH pGal:: Ddc2::LEU2 mad2∆::NAT |
Strain, strain background (S. cerevisiae) | DW642 | This study | Yeast strain | HOcse6::HPH Ddc2-AID*–9xMyc::KAN |
Strain, strain background (S. cerevisiae) | DW643 | This study | Yeast strain | HOcse6::HPH Rad9-AID*–9xMyc::KAN |
Strain, strain background (S. cerevisiae) | DW644 | This study | Yeast strain | HOcse6::HPH Rad24-AID*–9xMyc::KAN |
Strain, strain background (S. cerevisiae) | DW645 | This study | Yeast strain | HOcse6::HPH Rad53-AID*–9xMyc::KAN |
Strain, strain background (S. cerevisiae) | DW650 | This study | Yeast strain | pGal::Ddc2::LEU2 mad2∆::NAT |
Strain, strain background (S. cerevisiae) | GM539 | Memisoglu et al., 2019 | Yeast strain | Ddc2-9xMyc::KAN |
Strain, strain background (S. cerevisiae) | FZ001 | This study | Yeast strain | MATα HOcse6::HPH |
Strain, strain background (S. cerevisiae) | JY542 | This study | Yeast strain | HOcse6::HPH tel1∆::KAN |
Strain, strain background (S. cerevisiae) | FZ024 | This study | Yeast strain | HOcse6::HPH Rad9-AID*–9xMyc::KAN |
Strain, strain background (S. cerevisiae) | FZ025 | This study | Yeast strain | HOcse6::HPH Rad24-AID*–9xMyc::KAN |
Strain, strain background (S. cerevisiae) | FZ026 | This study | Yeast strain | HOcse6::HPH Rad53-AID*–9xMyc::KAN |
Strain, strain background (S. cerevisiae) | FZ173 | This study | Yeast strain | HOcse6::HPH Rad24-AID*–9xMyc::KAN TIR1(F74G)::URA3 |
Strain, strain background (S. cerevisiae) | FZ174 | This study | Yeast strain | HOcse6::HPH Rad9-AID*–9xMyc::KAN TIR1(F74G)::URA3 |
Strain, strain background (S. cerevisiae) | FZ175 | This study | Yeast strain | HOcse6::HPH Rad53-AID*–9xMyc::KAN TIR1(F74G):: URA3 |
Strain, strain background (S. cerevisiae) | YSL53 | Lee et al., 1998 | Yeast strain | HOcse5::URA3 |
Strain, strain background (S. cerevisiae) | GEM188 | This study | Yeast strain | HOcse2::LYS2 |
Strain, strain background (S. cerevisiae) | FZ201 | This study | Yeast strain | Rad9-AID*–9xMyc::KAN pRAD9-AID*–9xMyc |
Strain, strain background (S. cerevisiae) | FZ155 | This study | Yeast strain | bfa1∆::KAN |
Strain, strain background (S. cerevisiae) | yMA11 | This study | Yeast strain | H2A-S129A H2B-T129A |
Strain, strain background (S. cerevisiae) | yMA12 | This study | Yeast strain | H2AS129E H2B-T129E |
Strain, strain background (S. cerevisiae) | yMA13 | This study | Yeast strain | H2B-T129A |
Strain, strain background (S. cerevisiae) | yMA14 | This study | Yeast strain | H2B-T129E |
Strain, strain background (S. cerevisiae) | yBL257 | This study | Yeast strain | H2A-S129E |
Strain, strain background (S. cerevisiae) | yBL259 | This study | Yeast strain | H2A-S129A |
Strain, strain background (S. cerevisiae) | FZ062 | This study | Yeast strain | Mad1*–9xMyc-AID::NAT |
Strain, strain background (S. cerevisiae) | FZ165 | This study | Yeast strain | Bfa1*–9xMyc-AID::NAT |
Strain, strain background (S. cerevisiae) | FZ167 | This study | Yeast strain | Bub2*–9xMyc-AID::NAT |
Sequence-based reagent | GAT1p1B | This paper | PCR primers | GCTCAGTGTGCGTTATGCTT |
Sequence-based reagent | GAT1p2B | This paper | PCR primers | TTCAGGTCTCGGTTGCTCTT |
Sequence-based reagent | VE162 Ddc2-AID For | This paper | PCR primers | ATCTAACCACACTAGAGGAGGCCGATTCATTATATATCTCAATGGGACTGCCTAAAGATCCAGCCAAACCTCC |
Sequence-based reagent | VE163 Ddc2-AID Rev | This paper | PCR primers | ATTACAAGGTTTCTATAAAGCGTTGACATTTTCCCCTTTTGATTGTTGCCCAGTATAGCGACCAGCATTCACATAC |
Sequence-based reagent | DW217 Rad9-AID 1 F | This paper | PCR primers | GGTTTTCACGATGATATTACGGACAATGATATATACAACACTATTTCTGAGGTTAGACCTAAAGATCCAGCCAAACCTCC |
Sequence-based reagent | DW218 Rad9-AID 1 R | This paper | PCR primers | CTAAATTTTTTTTTATTTAATCGTCCCTTTCTATCAATTATGAGTTTATATATTTTTATAATTCAGTATAGCGACCAGCATTCACATAC |
Sequence-based reagent | DW208 Rad24-AID 1 F | This paper | PCR primers | CAGATTCAGATCTGGAAATACTCCCTAAAGATCCAGCCAAACCTCC |
Sequence-based reagent | DW209 Rad24-AID 1 R | This paper | PCR primers | GTGGAATATTTCCTGGGGTTTTCTCGTCAAATTTAAAGAGTAAAAAGCCTAAAGATCCAGCCAAACCTCC |
Sequence-based reagent | DW199 Rad53AID 1 F | This paper | PCR primers | GGTTAAAAGGGCAAAATTGGACCAAACCTCAAAAGGCCCCGAGAATTTGCAATTTTCGCCTAAAGATCCAGCCAAACCTCC |
Sequence-based reagent | DW200 Rad53AID 1 R | This paper | PCR primers | CCATCTTCTCTCTTAAAAAGGGGCAGCATTTTCTATGGGTATTTGTCCTTGGCAGTATAGCGACCAGCATTCACATAC |
Recombinant DNA reagent | pKan-9xMyc-AID | Morawska and Ulrich, 2013 | pJH2892 | Backbone: pSM409 |
Recombinant DNA reagent | pNAT-9xMyc-AID | Morawska and Ulrich, 2013 | pJH2899 | Backbone: pSM409 |
Recombinant DNA reagent | sTIR1::URA3 | Nishimura et al., 2009 | pNHK53 | |
Recombinant DNA reagent | GAL-DDC2 | Paciotti et al., 2000 | pML100 | Backbone: pML95 |
Recombinant DNA reagent | ADH1-OsTIR1(F74G) | Yesbolatova et al., 2020 | pMK420 | |
Recombinant DNA reagent | bRA90 | Anand et al., 2017 | bRA90 | |
Recombinant DNA reagent | bG059 | This study | bG059 | Backbone: bRA90 |
Recombinant DNA reagent | bG060 | This study | bG060 | Backbone: bRA90 |
Recombinant DNA reagent | pRad9-3HA | Lazzaro et al., 2008 | pFL36.1 | Backbone: pRS306 |
Recombinant DNA reagent | pRad9-9xMyc-AID | This study | pFZ052 | Backbone: pRS306 |
Recombinant DNA reagent | pBL15 – HTA1 gRNA1 | This study | pBL15 | Backbone: BRA89 |
Recombinant DNA reagent | pBL16 – HTA2 gRNA2 | This study | pBL16 | Backbone: BRA89 |
Recombinant DNA reagent | pKL004 – HTB1 gRNA1 | This study | pKL004 | Backbone: BRA89 |
Recombinant DNA reagent | pKL005 – HTB2 gRNA1 | This study | pKL005 | Backbone: BRA89 |
Software, algorithm | Prism 7.00 | GraphPad Software, Inc. | N/A | |
Software, algorithm | Image Lab | Bio-Rad | N/A | |
Software, algorithm | FiJi | ImageJ | N/A | |
Gene (S. cerevisiae) | Ddc2 | Saccharomyces Genome Database | Systematic name YDR499W | |
Gene (S. cerevisiae) | Rad9 | Saccharomyces Genome Database | Systematic name YDR217C | |
Gene (S. cerevisiae) | Rad24 | Saccharomyces Genome Database | Systematic name YER173W | |
Gene (S. cerevisiae) | Rad53 | Saccharomyces Genome Database | Systematic name YPL153C | |
Gene (S. cerevisiae) | Chk1 | Saccharomyces Genome Database | Systematic name YBR274W | |
Gene (S. cerevisiae) | Dun1 | Saccharomyces Genome Database | Systematic name YDL101C | |
Gene (S. cerevisiae) | Tel1 | Saccharomyces Genome Database | Systematic name YBL088C | |
Gene (S. cerevisiae) | Mad2 | Saccharomyces Genome Database | Systematic name YJL030W | |
Gene (S. cerevisiae) | Mad1 | Saccharomyces Genome Database | Systematic name YGL086W | |
Gene (S. cerevisiae) | Bub2 | Saccharomyces Genome Database | Systematic name YMR055C | |
Gene (S. cerevisiae) | Bfa1 | Saccharomyces Genome Database | Systematic name YJR053W |
Strains and Primers used in this study.
(a) Strains used in this study. (b) Primers used in this study.