ME3BP-7 is a targeted cytotoxic agent that rapidly kills pancreatic cancer cells expressing high levels of monocarboxylate transporter MCT1
- Ludwig Center, Sidney Kimmel Comprehensive Cancer Center, The Johns Hopkins University School of Medicine, United States
- Department of Neurosurgery, The Johns Hopkins University School of Medicine, United States
- Department of Oncology, The Johns Hopkins University School of Medicine, United States
- Department of Surgery, The Johns Hopkins University School of Medicine, United States
- Howard Hughes Medical Institute, United States
- Lustgarten Pancreatic Cancer Research Laboratory, Sidney Kimmel Comprehensive Cancer Center, The Johns Hopkins University School of Medicine, United States
- Department of Biomedical Engineering, Johns Hopkins University, United States
- Department of Pathology, The Johns Hopkins University School of Medicine, United States
- Department of Molecular and Comparative Pathobiology, The Johns Hopkins University School of Medicine; Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University, United States
- Division of Nuclear Medicine and Molecular Imaging, The Russell H. Morgan Department of Radiology and Radiological Science, The Johns Hopkins University School of Medicine, United States
- Bloomberg~Kimmel Institute for Cancer Immunotherapy, Sidney Kimmel Comprehensive Cancer Center, United States
Figures
Figure 1
3-Bromopyruvate (3BP) sensitivity of pancreatic ductal adenocarcinoma (PDAC) cell lines.
(A) Response of six different PDAC cell lines to 3BP. The indicated cell lines were exposed to increasing doses of 3BP for 72 hr and evaluated with a SYBR green growth assay. Data are represented as the mean ± SD of three technical replicates and are normalized to untreated controls. (B) Expression levels of MCT1, MCT4, and GLUT1 (TPM) and corresponding IC50s of 3BP. (C) Immunohistochemistry performed on PDAC cell lines with monoclonal mouse antibody against monocarboxylate transporter 1 (MCT1).
Figure 2
Monocarboxylate transporter 1 (MCT1) mediates 3-bromopyruvate (3BP) activity.
(A) Strategy for CRISPR-based knockout of SLC16A1 in MIA PaCa-2 cells. Created using BioRender.com. (B) Table of knockout clones. (C) Immunohistochemical analyses performed on representative KO clones with monoclonal mouse antibody against MCT1 (1:2000 dilution). (D) IHC performed with MCT1 antibody on pooled monoclonal MCT1 KO cells used to test the MCT1-specific activity of 3BP and ME3BP-7. (E, F) Comparison of cell growth over time of MIA PaCa-2 and MIA PaCa-2 MCT1 KO in the absence and presence of 3BP (50 µM) normalized to time point 0 hr. Data are represented as the mean ± SD of two technical replicates. (G) Dose-response curves of MIA PaCa-2 cells and MIA PaCa-2 MCT1 KO at 36 hr. Cell viability normalized to the number of cells at 0 hr. Data represent the mean ± SD of two technical replicates.
Figure 3
New formulations and serum stability of 3-bromopyruvate (3BP) in cyclodextrin complexes.
(A) HPLC: Evaluation of different microencapsulated β-cyclodextrin complexes using size-exclusion chromatography (SEC). The agents examined were (i) 3BP (1 mg/mL), (ii) succinyl-β-CD (20 mg/mL), (iii) a mixture of 10 µL of 3BP and 10 µL succinyl-β-CD, and (iv) ME3BP-7 (10 mg/mL). Samples were monitored at 220 nm as shown in A–D. (B) Serum stability assay using DLD-1 cells. (C) ME3BP-7 specificity assessed with MIA PaCa-2 parental and MIA PaCa-2 monocarboxylate transporter 1 (MCT1) KO cells.
Figure 4 with 2 supplements
Comparison of monocarboxylate transporter 1 (MCT1)-specific cytotoxicity of 3-bromopyruvate (3BP), ME3BP-7, and current standard of care agents for pancreatic ductal adenocarcinoma (PDAC) upon short exposures.
Viability of MCT-1 isogenic panel after (A) drug exposure for 30 min at 200 µM. (B) Drug exposure for 30 min at 100 µM. (C) Drug exposure for 2 hr at 200 µM. (D) Drug exposure for 2 hr at 100 µM.
Figure 4—figure supplement 1
Incucyte data for 15 min exposure for higher doses of various drugs.
(A) Drug exposure for 15 min at 800 µM. (B) Drug exposure for 15 mins at 400 µM. (C) Drug exposure for 15 min at 200 µM.
Figure 4—figure supplement 2
Linear scatter plots comparing the growth (or death) of MIA PaCa-2 parental after short exposure to 3-bromopyruvate (3BP), ME3BP-7 (reds), and current standard pancreatic ductal adenocarcinoma (PDAC) chemotherapeutic agents (grays).
(A) Drug exposure for 30 min at 200 µM. (B) Drug exposure for 2 hr at 200 µM. (C) Drug exposure for 30 min at 100 µM. (D) Drug exposure for 2 hr at 100 µM.
Figure 5 with 1 supplement
ME3BP-7 inhibits tumor growth of orthotopically implanted pancreatic cancer cell line Panc 02.13 with high monocarboxylate transporter 1 (MCT1) expression.
(A) Timeline and design of in vivo tumor experiments. Created using BioRender.com. (B) Bioluminescence images of nude mice-bearing orthotopic Panc 02.13 tumors. (C) Mean fold change in radiance from day of treatment initiation (**p<0.01, ***p<0.001, one-way ANOVA). (D) Weights of residual tumors harvested upon termination of therapy (**p<0.01, Mann-Whitney U test). BLI (BioLuminescence Imaging).
Figure 5—figure supplement 1
Body weight changes over the course of ME3BP-7 administration in various murine models (A) Panc 02.13 in nude mice, (B) TM01212 in NSG mice, and (C) TM01098 in NCG mice.
Figure 6 with 2 supplements
ME3BP-7 reduces tumor burden in orthotopically implanted human patient-derived xenograft TM01212 with diffuse expression of monocarboxylate transporter 1 (MCT1).
(A) Timeline and design of in vivo therapeutic study. Created using BioRender.com. (B) Immunohistochemical analyses of orthotopic PDX TM01212 showing diffuse but uniform expression of MCT1. (C) Representative ultrasound image of orthotopically implanted tumors in NSG mice. (D) Mean fold change in tumor volume (n=10) from day of treatment initiation. (E) Weights of residual tumors harvested upon termination of therapy. (F, G) H&E of lung and liver with metastases from untreated animals. (H) Number of metastatic lesions harvested from control and treated mice upon termination of therapy (**p<0.01, Mann-Whitney U test). PDX (patient derived xenograft), US (ultrasound) MWF (Monday, Wednesday, Friday).
Figure 6—figure supplement 1
Representative H&E images of organs of NSG mice treated with ME3BP-7 for 4 weeks: (A) heart, (B) lung, (C) kidney, (D) pancreas, (E) liver, and (F) spleen ×10.
Figure 6—figure supplement 2
ME3BP-7 reduces tumor burden in orthotopically implanted human patient-derived xenografts from a pancreatic ductal adenocarcinoma (PDAC) metastatic site with focally expressed monocarboxylate transporter 1 (MCT1) (TM01098).
(A) Timeline and design of in vivo therapeutic study. Created using BioRender.com. (B) Immunohistochemical (IHC) sections of orthotopic PDx (TM01098) showing focal expression of (C) representative ultrasound image of orthotopically implanted tumors. (D) Mean tumor volumes of 7 and 10 NSG mice in each group as determined by ultrasound measurements on indicated days. (E) Weights of residual tumors harvested at end of therapy (**p<0.01, Mann-Whitney U test).
Figure 7 with 3 supplements
Immunohistochemistry performed on a pancreatic ductal adenocarcinoma (PDAC) tissue microarray with monocarboxylate transporter 1 (MCT1) antibody.
(A) Overview (1×) of immunohistochemical (IHC) analyses performed on tissue microarray (HPanA150CS03, BioMax US) of pancreatic carcinoma cases with MCT1 antibody. (B) IHC of normal pancreas (10×) from the same microarray with MCT1 antibody. (C) Representative examples of uniform high, uniform moderate, and focal high expression of MCT1 in human PDAC samples from the array (10×).
Figure 7—figure supplement 1
Violin plot of TCGA data for pancreatic ductal adenocarcinomas (PDACs).
Figure 7—figure supplement 2
Genotype-Tissue Expression (GTEx) dataset showing expression of monocarboxylate transporter 1 (MCT1) across 51 tissue types.
Figure 7—figure supplement 3
Immunohistochemical (IHC) analyses of normal tissues from human TMA BC001130 (10×).
(A) Pancreas, (B) lung, (C) esophagus, (D) heart, (E) kidney, (F) ovary, (G) brain, (H) intestinal lymph node, (I) liver, and (J) testis.
Videos
Video 1
Time-lapse movies of specific killing of monocarboxylate transporter 1 (MCT1)-expressing cells, untreated controls.
Video 2
Time-lapse movies of specific killing of monocarboxylate transporter 1 (MCT1)-expressing cells with 3-Bromopyruvate (3BP).
Video 3
Time-lapse movie of monocarboxylate transporter (MCT) WT vs KO exposed to oxaliplatin (200 µM) for 2 hr.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus, female) | M. musculus NOD-Prkdcem26Cd52Il2rgem26Cd22/NjuCrl (NCG) | Charles River GmbH | ||
| Strain, strain background (M. musculus, female) | M. musculus Crl:NU(NCr)-Foxn1nu(Athymic nude) | Charles River GmbH | ||
| Strain, strain background (M. musculus, female) | M. musculus NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) | Jackson Laboratories | ||
| Cell line (Homo sapiens) | HEK293T | ATCC | Cat #CRL-3216 | |
| Cell line (H. sapiens) | MIA PaCa-2 | ATCC | Cat #CRL-1420 | |
| Cell line (H. sapiens) | Panc 02.13 | ATCC | Cat #CRL-2554 | |
| Cell line (H. sapiens) | PSN-1 | ATCC | Cat #CRL-3211 | |
| Cell line (H. sapiens) | AsPC-1 | ATCC | Cat # CRL-1682 | |
| Cell line (H. sapiens) | BxPC-3 | ATCC | Cat # CRL-1687 | |
| Cell line (H. sapiens) | CFPAC-1 | ATCC | Cat #CRL-1918 | |
| Cell line (H. sapiens) | DLD-1 | ATCC | Cat #CCL-21 | |
| Cell line (H. sapiens) | MIA PaCa-2 MCT1 KO | This study | N/A | |
| Cell line (H. sapiens) | DLD-1 MCT1 KO | This study | N/A | |
| Cell line (H. sapiens) | MIA Paca-2 red | This study | N/A | |
| Cell line (H. sapiens) | MIA PaCa-2 MCT1 KO green | This study | N/A | |
| Cell line (H. sapiens) | DLD-1 MCT1 KO | This study | N/A | |
| Cell line (H. sapiens) | Panc 02.13 luc | This study | N/A | |
| Cell line (H. sapiens) | PSN-1 luc | This Study | N/A | |
| Cell line (H. sapiens) | Pancreatic cancer patient derived xenograft | Jackson Laboratories | TM01098 | |
| Cell line (H. sapiens) | Pancreatic cancer patient derived xenograft | Jackson Laboratories | TM01212 | |
| Antibody | Mouse anti MCT1 monoclonal | Santa Cruz Biotech | sc-365501 | |
| Recombinant DNA reagent | Firefly Luciferase lentivirus | Cellomics Tech | PLV-10003–50 | |
| Recombinant DNA reagent | Incucyte Nuclight Green Lentivirus (puro) | Sartorius | 4624 | |
| Recombinant DNA reagent | Incucyte Nuclight Red Lentivirus (puro) | Sartorius | 4625 | |
| Sequence-based reagent | Alt-R CRISPR Cas9 crRNAs (ACCATGCCATTCAGGCTAGT) | IDT | N/A | |
| Sequence-based reagent | and Alt-R CRISPR-Cas9 tracrRNA | IDT | 1072532 | |
| Peptide, recombinant protein | Cas9 Nuclease | IDT | 10081059 | |
| Commercial assay or kit | Agilent DNA ScreenTape | Agilent | Cat #5067–5576 | |
| Commercial assay or kit | Agilent DNA ScreenTape Sample Buffer | Agilent | Cat #5067–5577 | |
| Commercial assay or kit | Agilent DNA Ladder | Agilent | Cat #5067–5578 | |
| Commercial assay or kit | Luciferase Assay System | Promega | Cat #E1501 | |
| Chemical compound, drug | 1% Penicillin-Streptomycin | Thermo Fisher Sci | Cat #15140122 | |
| Chemical compound, drug | 4–15% Mini-PROTEAN TGX Precast Protein Gels | Bio-Rad | Cat #456–1086 | |
| Chemical compound, drug | 5-Fluoruracil | Selleck chem | Cat #S1209 | |
| Chemical compound, drug | Gemcitabine | Selleck chem | Cat #S1149 | |
| Chemical compound, drug | Irinotecan hydrochloride | Selleck chem | Cat #S5026 | |
| Chemical compound, drug | Oxaliplatin | Selleck chem | Cat #S1224 | |
| Chemical compound, drug | Bromopyruvic acid | Sigma Aldrich | Cat #16490–10 G | |
| Chemical compound, drug | Succinyl-β-cyclodextrin | Sigma Aldrich | Cat #85990–5 G | |
| Chemical compound, drug | 2-Hydroxypropyl-β-cyclodextrin | Sigma Aldrich | Cat #778966–100 G | |
| Chemical compound, drug | Dimethyl Sulfoxide (DMSO) | Sigma Aldrich | Cat #C6295 | |
| Chemical compound, drug | Fetal Bovine Serum (FBS) | HyClone | Cat #16777–006 | |
| Chemical compound, drug | RPMI 1640 medium | Gibco | Cat #11875–119 | |
| Chemical compound, drug | DMEM medium | Gibco | Cat #11995065 | |
| Chemical compound, drug | EMEM medium | ATCC | Cat #30–2003 | |
| Chemical compound, drug | EPITHELIAL CELL MEDIUM-Complete Kit | Science Cell Research | Cat #4101 | |
| Chemical compound, drug | Phosphate Buffered Saline (PBS) | Thermo Fisher | Cat #J60465.K2 | |
| Chemical compound, drug | Glycerol | Sigma Aldrich | Cat #G5516 | |
| Chemical compound, drug | Phusion Flash High-Fidelity PCR Master Mix | Thermo Fisher | Cat #F548S | |
| Chemical compound, drug | Pierce ECL Western Blotting Substrate | Thermo Fisher | Cat #32106 | |
| Chemical compound, drug | Protease inhibitor | Millipore Sigma | Cat #4693159001 | |
| Chemical compound, drug | RediJect D-Luciferin Ultra Bioluminescent Substrate | PerkinElmer | Cat #770505 | |
| Chemical compound, drug | SsoAdvanced Universal SYBR Green Supermix | Bio-Rad | Cat #1725270 | |
| Chemical compound, drug | Trypsin | Gibco | Cat #25300054 | |
| Other | Tissue Microarray | US Biomax, Inc | BC001130 | |
| Other | Tissue Microarray | US Biomax, Inc. | HPanA150CS03 |
Additional files
-
Supplementary file 1
Gross pathology and assessment of potential tissue damage in organs of mice treated for 4 weeks (12 doses) with ME3BP-7.
- https://cdn.elifesciences.org/articles/94488/elife-94488-supp1-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/94488/elife-94488-mdarchecklist1-v1.pdf
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
ME3BP-7 is a targeted cytotoxic agent that rapidly kills pancreatic cancer cells expressing high levels of monocarboxylate transporter MCT1
eLife 13:RP94488.
https://doi.org/10.7554/eLife.94488.3
