Sperm motility in mice with oligo-astheno-teratozoospermia restored by in vivo injection and electroporation of naked mRNA
Figures
Distribution of i-particles NIRFIP-180 in testis injected via the rete testis route.
(A) A solution containing 0.05% Fast Green and 1% fluorescent i-particles NIRFiP-180 was prepared, 10 µl was injected into the seminiferous tubules of adult males, through the rete testes and its efferent channels. Injection was performed at constant pressure under a binocular microscope. The progression of filling of the seminiferous tubules was monitored thanks to the Fast Green. (B) The testes were only filled to 2/3 capacity in order to prevent damage to the tissue. (C) Representative distribution of fluorescent i-particles NIRFiP-180 in a whole cross-section of an injected testis. Nuclei were counterstained with DAPI (blue emission) to reveal tubules. (D) Enlargement of a seminiferous tubule showing particles localized inside the lumens of the tubules. Scales bars: 1 mm and 500 µm.
EEV and mRNA maps.
(A) EEV-plasmid map. The EEV-plasmid contains GFP, EVB ori, GFP, Luciferase, and EBNA sequences under the control of the GAGs promoter. (B) The mCherry plasmid contains the mCherry gene under the control of a T7 promoter. (C) The EEV-Armc2 plasmid contains GFP, oriP, EBNA, and Armc2 sequences under the control of the CMV and T7 promotors. (D) mCherry-mRNA was synthesized as described in Material and Methods. It was validated by agarose gel electrophoresis: Lane 1: DNA size marker ladder (100 bp), lane 2: capped mCherry-mRNA (IVT product), lane 3: mCherry-mRNA after DNAse treatment. Capped and poly A-tailed mCherry-mRNA migrated to the expected size of 876 bp.
-
Figure 1—figure supplement 1—source data 1
PDF file containing original agarose gel electrophoresis for Figure 1—figure supplement 1D indicating the relevant bands.
- https://cdn.elifesciences.org/articles/94514/elife-94514-fig1-figsupp1-data1-v1.zip
-
Figure 1—figure supplement 1—source data 2
Original files for agarose gel electrophoresis analysis displayed in Figure 1—figure supplement 1D.
- https://cdn.elifesciences.org/articles/94514/elife-94514-fig1-figsupp1-data2-v1.zip
Damaged tubules observed by optical microscopy following overstimulation.
Adult mouse testes were in vivo injected and over electroporated using 10 square electric pulses to induce damage. (A) Control testis (no injection/electroporation). (B1, B2) Over electroporated testes showing damaged tubules as pearly white striations. Scale bars: 1 mm.
In vivo injection and electroporation do not alter the morphological structure of the testes, seminiferous tubules, or sperm cells.
Testicular morphology was not affected by in vivo injection and electroporation of EEV-GFP (A) or GFP-mRNA (B). Controls correspond to contralateral testes injected/electroporated with control solution (PBS, 0.05% FG). (A1, B1) Comparison of the testicular morphology of adult testes injected with nucleic acid vectors or control solutions. (A2, B2) Comparison of testicular weight and (A3, B3) testicular length on day 7 after injection/electroporation. Data are represented as a box plot median (n = 4 for each condition). A Wilcoxon matched pairs test was used to assess the significance of any differences in testis weights and lengths, and p values of ≤0.05 were considered statistically significant. (C) Intact testicular structure after in vivo injection and electroporation with EEV-GFP and GFP-mRNA. Comparison of testicular cross-section structures. Testes paraffin sections were stained with eosin/hematoxylin and observed by light microscopy (×20 magnification). (C1) Control, (C2) EEV-GFP injected, and (C3) GFP-mRNA injected. Scales bars: 1000 µm. (D) Seminiferous tubule structures are not affected by in vivo injection and electroporation with EEV-GFP and GFP-mRNA. Enlargement of cross sections showing the fine structure of a seminiferous tubule for control (D1), EEV-GFP (D2), and GFP-mRNA (D3). In each tubule, the different layers of spermatogenic cells are indicated, Sertoli cells (S), spermatogonia (Sg), spermatocytes (Scytes), round spermatids (Stids), mature spermatid cells (m-Sptids), Leydig cells (L). Scales bars: 20 µm. (E) The area of seminiferous tubules is not affected by in vivo injection and electroporation with EEV-GFP and GFP-mRNA. Comparison of the seminiferous tubule diameter after injection of nucleic acid vectors or control solutions. Data are represented as a box plot median. The areas of seminiferous tubules (μm2) were measured for round cross sections of n > 35 tubules per testis section (n = 5 testis sections per condition). Statistical significance was verified using a Student’s t-test. (F) Injection/electroporation does not impact epididymal sperm cells. Representative sperm observed by light microscopy on day 7 after injection/electroporation with Control solution (F1), EEV-GFP (F2), or GFP-mRNA (F3). Scale bars: 10 μm. (F4) Percentage of normal epididymal sperm cells in each condition. The number of males was n = 5 for EEV-GFP; n = 6 for GFP-mRNA, and n = 9 for WT. More than 150 sperm by males were analyzed. Statistical significance was verified using a one-way ANOVA test.
Kinetics of EEV-GFP expression following in vivo injection/electroporation: whole testicular expression.
(A1–H1) Whole-mount testes on days 0, 1, 7, 14, 21, 28, 35, and 42 after in vivo injection/electroporation with EEV-GFP. (A2–H2) Under fluorescence observation, GFP expression was detectable in transfected testes from 12-week-old B6D2 mice. (C3–H3) Insets show the absence of autofluorescence in non-transfected control testes, observed under ×4 magnification. The GFP expression presented a punctiform pattern in seminiferous tubules and was detected from 1 to 42 days. Scales bars: 1 mm and 100 μm.
Kinetics of GFP-mRNA expression following in vivo injection/electroporation: whole testicular expression.
(A1–F1) Whole-mount testes on days 0, 1, 7, 15, 21, and 28 after in vivo injection/electroporation with GFP-mRNA. (A2–F2) Under fluorescence observation, GFP expression was detectable in transfected testes from 12-week-old B6D2 mice. (A3–F3) Insets show the absence of autofluorescence in non-transfected control testes, observed under ×4 magnification. The GFP expression presented a continuous pattern in seminiferous tubules and was detected from day 1 to day 15. Scale bars: 1 mm and 100 μm. (G) Comparison of the percentage of injected mice exhibiting reporter gene expression. Mice injected with GFP-mRNA exhibited GFP expression from day 1 to day 21. Mice injected with EEV-GFP exhibited GFP expression from day 1 to day 49 (for EEV-GFP n = 11 on day 1; n = 13 on day 2; n = 10 on day 3; n = 14 on day 7; n = 5 on day 10; n = 12 on day 15; n = 11 on day 21; n = 12 on day 28; n = 15 on day 35; n = 17 on day 42 and n = 9 on day 49; for GFP-mRNA n = 3 on day 1; n = 4 on day 3; n = 15 on day 7; n = 21 on day 15; n = 15 on day 21, and n = 5 on day 28).
Testicular expression of mCherry-mRNA following in vivo electroporation.
(A1, B1, C1, D1, E1, F1) Whole-mount testes on days 0, 1, 7, 14, 21, and 28 after in vivo injection/electroporation. (A2, B2, C2, D2, E2, F2) Using fluorescence microscopy, transfected testes from 12-week-old B6D2 mice express red mCherry fluorescence. mCherry was detected in a diffuse pattern throughout the seminiferous tubules from day 1 to day 15. (A3, B3, C3, D3, E3, F3) images showing the absence of autofluorescence in non-transfected control testes observed at ×4 magnification. Scales bars: 1 mm and 100 μm.
Decay over time of the number of mice exhibiting reporter gene expression following injection/electroporation of the three different mRNAs.
Mice were injected on day 0 with LUC-mRNA, GFP-mRNA, or mCherry-mRNA, and the number of mice showing bioluminescence or fluorescence in the testis was counted at different time points. For LUC-mRNA, n = 5 mice at each time point. For mCherry-mRNA n = 3 on day 1; n = 4 on day 3; n = 15 on day 7; n = 21 on day 15; n = 15 on day 21; n = 5 on day 28; and n = 5 on day 35; and for GFP-mRNA n = 3 on day 12; n = 7 on day 2; n = 7 on day 3; n = 12 on day 7; n = 13 on day 15; n = 10 on day 21; n = 9 on day 28; n = 17 on day 35; and n = 5 on day 42.
Stability of mRNA-GFP in HEK cells and seminiferous tubule cells.
(A–C) Analysis of mRNA-GFP stability in HEK cells. (A) Quantification of relative GFP mRNA levels (2−ΔCT) at 24-, 48-, and 60-hr post-transfection. (B) RT-qPCR amplification curves of GFP and (C) GAPDH transcripts at the indicated time points, showing a progressive decrease in GFP signal over time while GAPDH expression remained constant. (D–F) Analysis of mRNA-GFP stability in mouse seminiferous tubule cells after in vivo injection and electroporation. (D) Quantification of relative GFP mRNA levels (2−ΔCT) at 0-, 1-, 7-, and 14-day post-transfection. (E) RT-qPCR amplification curves of GFP and (F) ACTB transcripts at corresponding time points. mRNA-GFP remained detectable for up to two weeks in seminiferous tubules, indicating enhanced transcript stability in the testicular environment.
Kinetics of EEV and mRNA expression by in vivo bioluminescence imaging.
(A) In vivo bioluminescence imaging quantification of luciferase expression over time following injection/electroporation of EEV-GFP-luc. (A1) EEV-GFP-Luc was injected into the testes and electroporated on day 0. Bioluminescence signal was quantified at several time points. Results are expressed as a percentage of the maximal signal (mean ± SEM; n = 5 mice up to D2; n = 4 from D3 to D28; n = 3 from D35 to D98; and n = 3 from D105 to D119). (A2) In vivo bioluminescence images of a representative mouse at several time points after administering EEV-GFP-LUC or PBS, and ex vivo bioluminescence images of testes after 119 days. (B) In vivo bioluminescence imaging quantification of luciferase expression over time induced by injection/electroporation of LUC-mRNA. (B1) LUC-mRNA was injected into the testes and electroporated on day 0. Bioluminescence signal was quantified in the whole testis at several time points. Results are expressed as a percentage of the maximal signal (mean ± SEM; n = 5 mice). (B2) In vivo bioluminescence images of a representative mouse at several time points after administering LUC-mRNA or PBS, and ex vivo bioluminescence images of caput, testes, and cauda after 28 days. (C) Decay over time of the number of mice expressing reporter genes. Mice were injected on day 0 with LUC-mRNA or EEV-GFP-LUC and the number of mice showing bioluminescence in the testis was counted at different time points, from day 1 to day 119. For EEV-GFP: n = 13 at D1; n = 13 at D2; n = 4 from D3 to D28; n = 3 from D35 to D98; and n = 3 from D105 to D119. For LUC-mRNA: n = 5 mice for all-time points.
Testicular and cellular GFP-mRNA expression measured on optically cleared testis after 3D image reconstructions from lightsheet microscopy imaging.
Testes were injected/electroporated with GFP-mRNA on day 0. On day 1, whole testes were fixed and subjected to optical clearing. (A) Testes were observed before and after optical clearing on a binocular microscope. The right image shows the transparency of the testis after complete clearing, revealing the blue mesh throughout the organ. (B) The 3D internal structure of a cleared testis was reconstructed from the lightsheet microscopy images. The reconstruction was possible only for a half testis due to optical issues. Two opposing faces of the same testis are presented, allowing the distribution of GFP fluorescence throughout the seminiferous tubules to be measured. Pink fluorescence corresponds to the autofluorescence of interstitial cells located around the seminiferous tubules. Scale bars A: 1 mm and B: 500 µm.
Cellular expression of EEV-GFP following in vivo injection/electroporation.
Testes were injected/electroporated with EEV-GFP on day 0. On day 1 and on day 7, whole testes were fixed and subjected to optical clearing. Cleared tests were observed by fluorescence microscopy. (A1–A3) On day 1, transfected seminiferous tubules showed dotted green fluorescence at low magnification (×10/0.45). Nuclei were counterstained with DAPI (blue staining) to reveal the structure of the seminiferous tubules. At the cellular level, fluorescence was detectable (B1–B3) in germ cells including spermatogonia (Sg), spermatocytes (Scytes), and round spermatids (RStids), as well as (C1–C3) in Sertoli cells (SC). (D1–D3) On day 7, the GFP signal was lower at low magnification (×10/0.45) and detectable (E1–E3) only in Sertoli cells (×40/1.15 WI) (n = 3) (PTc = peri-tubular myoid cell). E4 is an enlargement of the red square in E3, allowing the cell type to be identified. Scale bars: 100, 15, and 3 μm.
Cellular expression of GFP-mRNA following in vivo injection/electroporation.
Testes were injected/electroporated with GFP-mRNA on day 0. On days 1 and 7, whole testes were fixed and subjected to optical clearing. Cleared testes were observed by fluorescence microscopy. (A1–A3) On day 1, transfected seminiferous tubules showed strong broad-ranging green fluorescence at low magnification (×100/0.45). Nuclei were counterstained with DAPI (blue staining) to reveal the structure of the seminiferous tubule. At the cellular level, fluorescence was detectable in germ cells (B1–B3) including spermatogonia (Sg), spermatocytes (Scytes) and round spermatids (RStids), mature spermatid cells (m-Sptids) and Sertoli cells (SC). B4 is an enlargement of the red square in B3, allowing the cell types to be identified. (D1–D3) On day 7, the GFP signal remained strong at low magnification (×10/0.45) and was still detectable in (E1–E3) all germ cell types and Sertoli cells (×40/1.15 WI) (n = 3). E4 is an enlargement of the red square in E3, showing that testicular sperm were also stained. Scale bars: 100, 15, and 3 μm.
Cellular expression of mCherry-mRNA following in vivo injection/electroporation.
Cross sections (20 µm) of mouse testes on day 1 (AB) and day 7 (CD) after in vivo injection and electroporation with mCherry-mRNA, observed under fluorescence microscopy. Red signals correspond to successfully transfected testicular tubular cells; nuclei were counterstained with DAPI (blue). At the cellular level, mCherry fluorescence was detectable in Sertoli cells (SC); spermatogonia (SG); spermatocytes (Scytes); round spermatids (RStids), and mature spermatids (m-Sptids); Scale bars: 10 and 5 µm.
GFP-mRNA expression in germ cells following in vivo injection and electroporation.
Testes were injected and electroporated with GFP-mRNA on day 0. On day 1, the testes were dissociated, and the resulting seminiferous tubule cell suspension was cultured for 12 hr. Live seminiferous cells were then observed by fluorescence microscopy (LD plan-Neofluar 40x/0.6 Korr M27). (A) Representative images of GFP expression in elongated sperm. Panels show brightfield, DAPI staining (nuclei in blue), GFP fluorescence (green), merged channels, and overlay with brightfield. Magnified views of selected cells are shown below each row, highlighting strong cytoplasmic GFP signals in elongated sperm. (B) Representative images of GFP expression in pachytene spermatocytes. Same panel layout as in (A). Enlarged views show paired pachytene spermatocytes displaying robust cytoplasmic GFP fluorescence. (C) Representative images of GFP expression in round spermatids. Same panel layout as above, showing isolated round spermatids with clear GFP fluorescence in the cytoplasm. Higher magnification confirms successful mRNA transfection and translation. Scale bars: 50 and 5 µm. (D) Percentage of GFP-positive and GFP-negative cells in the analyzed population. (E) Distribution of GFP-positive cells across different germ cell types, showing higher uptake in spermatocytes compared with round and elongated spermatids. (F) Average diameters of spermatocytes and round spermatids, indicating cell size differences in the population analyzed.
Expression of GFP following mRNA injection in seminiferous tubules.
Representative images of seminiferous tubule fluorescence, used to produce seminiferous tubule cell suspensions for qRT-PCR and fluorescence imaging assays. Tubules were collected one day after in vivo injection and electroporation of GFP mRNA. Strong GFP fluorescence is visible along the tubular segments, indicating efficient uptake and translation of mRNA in germ cells. Images were acquired using a fluorescence stereomicroscope. Scale bars: 200 µm.
ARMC2 localization in dissociated testicular cells observed by immunofluorescence.
Cells from WT and Armc2 KO mice were counterstained with Hoechst (A1–B1) and stained with antibodies against tubulin (A2–B2, green signal) and ARMC2 (A3–B3, red signal). (A4–B4) Overlay of the different staining. In WT mice, ARMC2 is located in the flagellum of spermatids. In KO mice, no ARMC2 signal (red fluorescence) was observed in any cells.
Armc2 expression and localization in mice testis.
(A) IF experiment on dissociated spermatogenic cell from WT male. (A1) Nuclei were counterstained with DAPI (blue staining), (A2) tubulin (green signal), and (A3) ARMC2 (red signal). (A4) overlay. ARMC2 is located in the flagellum of spermatids. Scale bars: 5 μm. (B) Cross-sections of seminiferous tubules (B1) Nuclei were counterstained with DAPI (blue staining), (B2) and (B2) ARMC2 (red signal). (B3) overlay. B4 is an enlargement of the red square in B3, showing that only elongating/mature spermatids were stained. (C) Expression of Armc2 in mouse spermatogenic cells based on the RNA-sequencing study from Gan et al., 2013. Primitive type A spermatogonia (priSG-A) were isolated from 6 dpp mice; type A spermatogonia (SG-A) and type B spermatogonia (SG-B) were from 8 dpp mice; preleptotene spermatocytes (plpSC) and pachytene spermatocytes (pacSC) were from 17 dpp mice; and round spermatids (rST), elongating spermatids (eST), and spermatozoa (SZ) were from 60 dpp mice. Artificial units (AU). Dpp: day post-partum.
In vivo co-injection of Armc2-mRNA and eGFP-mRNA followed by electroporation does not affect testes morphology and weight.
Adult WT mouse testes were injected with a solution containing Armc2-mRNA and eGFP-mRNA. After injection, the testes were electroporated and mice were euthanized two weeks later. (A) Whole testis under white and blue lights on a fluorescence microscope. (A1) Control testes not injected/electroporated. (A2) Testes injected with Armc2-mRNA and eGFP-mRNA. eGFP-mRNA was co-injected to follow the transfection efficiency. (B) Ratio of injected/electroporated testis weights to control testis weights at several time points post-injection (3-, 6-, 10-, 15-, 21-, 28-, and 35-day post-surgery). n = 1 mouse per time.
Validation of Armc2-mRNA in HEK cells.
HEK cells were transfected with Armc2-mRNA or EEV-Armc2. ARMC2 protein was detected by Western blot with an anti-HA primary antibody. The expected size of the ARMC2 protein is 98 kDa.
-
Figure 12—figure supplement 1—source data 1
PDF file containing original western blots for Figure 12—figure supplement 1D, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/94514/elife-94514-fig12-figsupp1-data1-v1.zip
-
Figure 12—figure supplement 1—source data 2
Original files for western blot analysis displayed in Figure 12—figure supplement 1D.
- https://cdn.elifesciences.org/articles/94514/elife-94514-fig12-figsupp1-data2-v1.zip
Sperm motility is restored in Armc2 KO mice at 21 and 35 days after injection and electroporation of Armc2-mRNA.
(A) Adult Armc2 KO mouse testes were injected with a solution containing Armc2-mRNA. After injection, the testes were electroporated. At different times (3-, 6-, 10-, 15-, 21-, 28-, and 35-day post-injection), sperm were extracted from the cauda epididymis of the injected testis, and the sample was then examined with a CASA system to identify the percentage of motile spermatozoa (A1). n = 2 for day 15, n = 3 for days 3, 6, and 21, n = 4 for day 10, and n = 5 for days 28 and 35. (A2) Sperm motility parameters of Armc2−/−-rescued sperm in comparison to Armc2+/+ sperm. The motility parameters measured were: averaged path velocity (VAP); straight line velocity (VSL); curvilinear velocity (VCL); amplitude of lateral head displacement (ALH); beat cross frequency (BCF); straightness (STR); linearity (LIN). Black dots: sperm cells from Armc2 null mice, green dots: sperm cells from Armc2 null mice 35 days after injection with Armc2-mRNA. Results are expressed as mean ± SD. (A3) Sperm motility population of Armc2−/−-rescued sperm in comparison to Armc2−/− sperm. Black column: sperm cells from Armc2 null mice, green column: sperm cells from Armc2 null mice 35 days after injection with ARmc2-mRNA. Statistical significance was verified using a Mann–Whitney sum test. Data are displayed as mean ± SEM. p values of *≤0.05, **≤0.01, or ***≤0.001 were considered to represent statistically significant differences. (B) Morphology of sperm cells in Armc2 KO mice injected or not with Armc2-mRNA. (B1, B2) Microscopic observation of epididymal sperm cells from a mature WT mouse. (B3, B4) Epididymal sperm cells from a mature Armc2 KO mouse 35 days after injection/electroporation with Armc2-mRNA. (B5, B6) Epididymal sperm cells from a control Armc2 KO male. Normal sperm cells were observed in the injected condition with Armc2-mRNA (white arrows). Scale bars: 10 µm.
Morphology of sperm cells from WT, Armc2 KO, and Armc2-rescued males.
Microscopic observation of epididymal sperm cells from WT, Armc2 KO, and Armc2 KO-Armc2-mRNA injected males at ×20 (left column), ×40 (middle column), and ×100 (right column) magnifications. In the rescue condition, rescued sperm cells were labeled with a white asterisk. Scale bars: 100, 50, and 10 µm.
Armc2−/−-rescued sperm can fertilize eggs and produce embryos by in vitro fertilization (IVF).
(A) Illustrations showing eggs/embryos obtained 24 hr after egg collection in the following conditions. (A1) W/O sperm, (A2) IVF with Armc2−/− sperm from Armc2−/− males (#444), (A3) IVF with Armc2−/− rescued sperm from Armc2−/− males treated with mRNA-Armc2 (males #399, #389, and #406), and (A4) IVF with WT B6D2 sperm. Green and red asterisks show 2-cell embryos, red asterisks showing 2-cell embryos obtained by parthenogenesis. White asterisks show unfertilized oocytes or degenerated. (B) Histograms showing the mean percentage ± SD of alive eggs reaching the 2-cell embryo stage at 24 hr after IVF without sperm (n = 4), with Armc2−/− sperm (n = 4), with Armc2−/− rescued sperm (n = 5), and with WT B6D2 sperm (n = 5). Statistical significance was verified using a one-way ANOVA test. (C) The table presents the data pertaining to the number of 2-cell embryos obtained by IVF with Armc2−/− rescued sperm from five different Armc2−/− males treated with mRNA-Armc2 (males #399, #406, #389, #388, and #395). The data is presented in terms of the percentage of 2-cell embryos obtained in relation to the total number of eggs collected.
Armc2−/−-rescued sperm can fertilize eggs and produce embryos by ICSI.
Comparative analysis of the percentage of blastocysts produced by ICSI with spermatozoa from wild-type (WT), Armc2−/−, and Armc2−/−-rescued individuals. For Armc2−/−-rescued individuals, only motile sperm were injected.
Videos
3D-microscopic reconstructions of faces 1 and 2 of a testis injected with GFP-mRNA.
3D-microscopic reconstructions of faces 1 and 2 of a testis injected with GFP-mRNA.
CASA recording of WT epididymal sperm cells.
CASA recording of Armc2 KO epididymal sperm cells.
CASA recordings of epididymal sperm cells from Armc2 KO mice on days 21 and 35, respectively, after injection/electroporation with Armc2-mRNA.
CASA recordings of epididymal sperm cells from Armc2 KO mice on days 21 and 35, respectively, after injection/electroporation with Armc2-mRNA.
Tables
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | B6D2 F1 hybrid (Å C57BL/6JRj × Å DBA/2) | Janvier laboratories | Adult male mice, 8–25 weeks old | |
| Strain, strain background (Mus musculus) | CD1 female | Janvier laboratories | 6–7 weeks old, used for IVF/ICSI | |
| Genetic reagent (Mus musculus) | Armc2 KO | CRISPR–Cas9 | Adult male mice, 8–15 weeks old; Coutton et al., 2019 | |
| Cell line (Homo sapiens) | HEK293T | ATCC | CRL-3216; RRID:CVCL_0063 | Transfection experiments with EEV-Armc2 and mRNA |
| Biological sample (Mus musculus) | Testicular cells and sperm | Freshly isolated from Mus musculus | ||
| Biological sample (Mus musculus) | Egg | Freshly isolated from Mus musculus | ||
| Antibody | anti-HA (Rabbit polyclonal) | Sigma-Aldrich | 11867423001;RRID:AB_390916 | 1:5000 for Western blot |
| Antibody | anti-tubulin (Guinea pig polyclonal) | Swiss Institute of Bioinformatics | AA345; RRID:AB_2139275 | 1:100 for immunofluorescence |
| Antibody | anti-ARMC2 (Rabbit polyclonal) | Sigma-Aldrich | HPA053696; RRID:AB_2679152 | 1:50 for immunofluorescence |
| Recombinant DNA reagent | mCherry plasmid | Dr. Conti, UCSF | CMV/T7 promoter; amplified in E. coli, (Homo sapiens) | |
| Sequence-based reagent | Armc2_WT Forward; Armc2_WT Reverse | Genscript | PCR primers | For genotyping Armc2 WT allele (Mus musculus) |
| Sequence-based reagent | Armc2_KO Forward; Armc2_KO Reverse | Genscript | PCR primers | For genotyping Armc2 KO allele (Mus musculus) |
| Sequence-based reagent | Gfp Forward; Gfp Reverse | Genscript | PCR primers | For GFP expression analysis in seminiferous tubules (Mus musculus) |
| Sequence-based reagent | Gadph Forward; Gadph Reverse | Genscript | PCR primers | For qPCR normalization in HEK cells (Homo sapiens) |
| Commercial assay or kit | NucleoBond Xtra Midi kit | Macherey-Nagel | 740410-50 | For plasmid purification |
| Chemical compound, drug | Ketamine | Centravet | Anesthesia for mice | |
| Chemical compound, drug | Xylazine | Centravet | Anesthesia for mice | |
| Chemical compound, drug | Fast Green | Sigma-Aldrich | F7258 | 0.05% in injections |
| Software, algorithm | Imaris | Oxford Instruments | 3D reconstruction of cleared testes | |
| Software, algorithm | FIJI | Open-source | Image analysis | |
| Other | Armc2-mRNA | Trilink | CleanCap AG, poly(A) 120, 3 HA-FLAG; injected 300 ng/µl (Mus musculus) | |
| Other | EGFP-mRNA | Trilink | Used as reporter; co-injected with Armc2-mRNA (Mus musculus) | |
| Other | mCherry-mRNA | Trilink | Transcribed in vitro; capped and polyadenylated; 300 ng/µl (Homo sapiens) |
Primer sequences used for mouse genotyping and Gfp expression analysis in HEK cells and mouse seminiferous tubules.
| Primer sequences (5′–3′) | Final concentration (µM) | ||
|---|---|---|---|
| Genotyping | |||
| Armc2_WT | Forward | GGCCCGAGCACGCTTCTA | 0.4 |
| Reverse | TTCATGTAAGAACTATCCAGGACCA | 0.4 | |
| Armc2_KO | Forward | TGGGACGCAGCCCTGTAA | 0.4 |
| Reverse | AACCCAAAGCTCCAGCATCTC | 0.4 | |
| Expression | |||
| Gfp | Forward | ACGACTTCTTCAAGTCCGCC | 0.08 |
| Reverse | TCTTGTAGTTGCCGTCGTCC | 0.08 | |
| Gadph Human | Forward | TCTCTGCTCCTCCTGTTCGA | 0.33 |
| Reverse | TTCCCGTTCTCAGCCTTGAC | 0.33 | |
| Gadph mice | Forward | ||
| Reverse | |||