Development of a new genotype–phenotype linked antibody screening system
Figures
System to link the antigen-binding feature with the Ig repertoire genetic information.
(A) Single cell-sorted B cells were subjected to two processes: Ig-seq database building and Ig-expressing transformant library preparation. Antigen-binding Ig transformants were collected by sorting in bulk and the sequences of the unique CDR3 regions and clones of interest were identified by referring to the Ig-seq database. The duration of each steps are indicated. (B) To express both Ig heavy and kappa/lambda chains in a single-expression vector, we generated a dual-expression vector. Four gene fragments were assembled by the Golden Gate method using the BsaI restriction enzyme. They included: (1) the destination vector containing the Ig kappa constant gene and the ccdB Chloramphenicol cassette for negative selection, (2) fragments containing the Ig heavy constant gene fused to Venus derived from the donor vector, (3) the Ig heavy variable gene fragment, and (4) the Ig light variable gene fragment. (C) Individually purified plasmids were transiently transfected to the floating human FreeStyle 293 cell line. Igs were expressed on the cell surface in 2 days, and expression levels were confirmed and normalized by Venus expression, since the Ig heavy chain was fused to Venus at the cytoplasmic domain tail.
The Ig repertoires are visualized using the in-house software.
Overview of heavy (V–D–J) and light (V–J) chain usages (A), and the repertoire clonality (B) is shown. (C) The mutation rates and their positions of heavy chains in three cell populations (PR8+, H2+, PR8 +H2+) are compared. (D) The lengths of CDR3 of heavy chains of three cell populations (PR8+, H2+, PR8 +H2+) are compared.
Progression flowchart.
The process for efficiently isolating influenza cross-reactive antibodies from mouse germinal center B cells with high affinity is shown. Experiment outcome flow numbers of clones in each step are indicated.
Sorting strategy.
CD43 MACS B cells from the spleen purified using negatively charged beads were sorted for IgG1 + cells and then separated into H2 and PR8. The majority of cross-reactive IgG1 + cells (red box) were CD38 + cells, most likely in the memory compartment. For reference, the CD38 staining pattern of total live B cells is shown at the bottom right.
Isolation of H2 and H1-reactive B cells.
(A) Mixture of Ig-expressing transformant libraries stained with HA probes. (B) Three strong HA-binding populations, H1+H2+ (cross), H2+ (H2), and H1+ (H1), were sorted and collected in a bulk fashion. Then, these three collected populations were and sequenced. (C) The bulk Ig-seq data were referred to as the single-cell Ig-seq data. Heatmap indicates the appearance rate of individual clone in each box shown in B (H1, H2, or Cross) among sorted 2981 cells of mixture of 190 clone transformants. H1+H2+ (cross) clones are shown on the right columns. High to low appearance rate reflects red to blue color. (D) The individual flow cytometry profile of 13 ‘Cross’ transformants obtained by the bulk examination are shown and red labeled ones are also found by the individual examination(red). (E) A summary of the results in comparison of the bulk and individual examination methods.
SPR profiles of kinetics analysis of nine clones, A6p4, B10p2, C10p2, A2p1, D11p4, E11p2, G6p2, D4p4, and G12p4 using a BIAcore 3000 machine (GE Healthcare).
Two hundred and eighty-four clones are plotted in a two-dimensional map of phylogeny trees for heavy and light chain genes.
Nine mAb clones are overlaid in green. Six ‘cross’ clones are located in a major cluster. B10p2 and C10p2 are co-localized and distant from the cluster. A6p4 is uniquely located in the map.
The affinity of antigen-antibody binding (in this case, probe and membrane-bound antibody expressing cell) can be inferred from the population shift (flow cytometry analysis).
Competition assay of ‘cross’ Ig-transformants using C179, a broadly-reactive mAb binding to the Stem region of HA, and NSP2 (Narita strain-specific mAb), a strain-specific mAb that binds to the head region of HA.
On the right panel, two stem-reactive clones (see Table 1) were examined reciprocally with combination of transformant and recombinant antibodies.
Tables
Affinities (Kd) of the antibodies to six HA antigens from strains A/Okuda/1957(H2N2), termed H2, A/Puerto Rico/8/1934(H1N1), termed PR8, A/California/2009 (X-179A) [H1N1] Pdm09, termed Cal, A/Texas/50/2012 (X-223) [H3N2], termed H3, A/Egypt/N03072/2010(H5N1), termed H5, and A/Brisbane/59/2007 (H1N1), termed Stem, were determined using surface plasmon resonance analysis.
H2, PR8, Cal, and H5 belong to group 1, and H3 belongs to group 2. High (red), Middle (orange), and Low (blue).
| Group | 1 | 1 | 1 | 2 | 1 | 1 |
|---|---|---|---|---|---|---|
| H2 | PR8 | Cal | H3 | H5 | Stem | |
| A6p4 | 4.51E-08 | 1.41E-06 | 1.14E-05 | 2.91E-05 | 1.59E-08 | |
| B10p2 | 6.75E-09 | 2.3E-09 | 3.29E-09 | |||
| C10p2 | 1.66E-09 | 1.29E-09 | 5.66E-10 | 4.26E-08 | ||
| A2p1 | 2.49E-06 | 1.42E-07 | 1.14E-05 | 1.25E-04 | 1.91E-05 | |
| D11p4 | 7.93E-07 | 1.72E-06 | 1.04E-06 | 1.36E-05 | 1.05E-11* | |
| E11p2 | 4.4E-08 | 1.86E-08 | 1.67E-06 | 2.92E-07 | 2.37E-07 | |
| G6p2 | 3.51E-08 | 3.53E-08 | 1.44E-08 | 1.78E-05 | 3.05E-08 | |
| D4p4 | 1.1E-05 | 1.78E-05 | 6.4E-05 | 4.38E-05 | 2.47E-05 | |
| G12p4 | 1.45E-07 | 1.52E-07 | 5.7E-07 | 9.44E-07 | 1.58E-07 |
-
Surface plasmon resonance (Biacore) KD (M).
-
*
The affinity of D11p4 for H5 was low and inaccurate (Figure 2—figure supplement 1).
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Aequorea coerulescens) | venus | RIKEN BRC; Nagai et al., 2002 | ||
| Strain, strain background (Escherichia coli) | DH5α | Thermo Fisher Scientific | EC0112 | competent cells |
| Genetic reagent (F’ Episome) | ccdB | Thermo Fisher Scientific | V79020 | pcDNA3.1 (+) Mammalian Expression Vector |
| Cell line (Homo sapiens) | FreeStyle 293 | Thermo Fisher Scientific | R79007 | |
| Transfected construct (M. musculus) | Antibody expression vector | This paper | Plasmid construct to transfect and express the antibody. | |
| Biological sample (M. musculus) | Mouse splenocytes | This paper | CLEA Japan, Inc. | |
| Antibody | Anti-CD43 MicroBeads (Mouse monoclonal) | Miltenyi Biotec, Inc. | 130-049-801 | Add 10 μL of Anti-CD43 (Ly-48) MicroBeads (mouse) per 10⁷ total cells (1:1000 dilution) |
| Recombinant DNA reagent | pcDNA3.4-mIgG1 (plasmid) | This paper | To obtain a large amount of secretory antibodies | |
| Recombinant DNA reagent | pcDNA3.4-kappa (plasmid) | This paper | To obtain a large amount of secretory antibodies | |
| Sequence-based reagent | BsaI_IL6sp_L | This paper | PCR primers | CTAGGGTCTCAAGCAGATGAACTCCTTCTCCACAAGCG |
| Sequence-based reagent | mC_G_new2_BsaI | This paper | PCR primers | TCCTAGGTCTCCCACACACAGGGGCCAGTGGATAGAC |
| Peptide, recombinant protein | Anti-HA antibodies | This paper | Nine cross reactive antibodies | |
| Commercial assay or kit | BsaI-HFv2 | New England Biolabs | NEB #R3733 | |
| Commercial assay or kit | T4 DNA ligase | New England Biolabs | M0202T | |
| Chemical compound, drug | AddaVax | InvivoGen | vac-adx-10 | adjuvant |
| Software, algorithm | BONSCI | in-house software | Ig database construction and visualization of the Ig repertoire | |
| Other | CM5 sensor chip | GE Healthcare Technologies | BR100530 | 3 sensor chips |
Additional files
-
Supplementary file 1
Supplementary tables.
(a) Oligonucleotides. (b) Oligonucleotides.
- https://cdn.elifesciences.org/articles/95346/elife-95346-supp1-v1.docx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/95346/elife-95346-mdarchecklist1-v1.docx