Testosterone-induced metabolic changes in seminal vesicle epithelium modify seminal plasma components with potential to improve sperm motility
Figures
Effects of seminal vesicle fluid and prostate fluids on sperm motility.
(A) The effects of secretions from the prostate and seminal vesicles on sperm motility were directly compared. The effects of secretions from the prostate (Pros) or seminal vesicles (SV) on the motility parameters of epididymal sperm were tested: (B) motile, (C) progressive motile, (D) curvi-linear velocity (VCL), (E) straight-line velocity (VSL), and (F) linearity (LIN) is the ratio of VSL to VCL of sperm that was incubated with the mixture of seminal vesicle secretions or prostate extracts. (G) Viscosity of a solution containing prostate or seminal vesicle secretion with a protein concentration of 10 mg/ml. (H) Experimental design to evaluate the effect of seminal vesicle secretions collected from male mice treated with or without flutamide (50 mg/kg subcutaneously every day for 7 days) on sperm. Note that the donor mice for sperm and seminal vesicle secretions were different. Performed bioassay using seminal vesicle fluid after treatment with vehicle (Ctrl) or flutamide: (I) motile, (J) progressive motile, (K) LIN, and (L) VSL. (M) The high mitochondrial membrane potential (hMMP) was checked by the JC-1 kit. Antimycin (Anti) was used as the negative control for hMMP. Data are mean ± SEM. n = 3–9 independent replicates. The viscosity measurement data were from n = 3 repeated experiments using pooled prostate or seminal vesicle extracts from at least 20 mice. Percentage data were subjected to arcsine transformation before statistical analysis. (B–G, I–L) Significance was tested in comparison using Student’s t-test. (M) Since the results of the Bartlett test were significant, a two-way ANOVA using a generalized linear model was performed. Both the flutamide administration and antimycin addition were significant. The interaction was not significant. Games–Howell was performed as a post hoc test. Different letters represent significantly different groups. Data were considered statistically significant at p < 0.05.
-
Figure 1—source data 1
Raw data and sample metadata for Figure 1.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig1-data1-v1.xlsx
Sperm quality control data and exploratory research into the effects of seminal vesicle secretions on sperm fertilization.
(A) The baseline information for the epididymal sperm used in Figure 1, Figure 1—figure supplement 2A. Curvi-linear velocity; VCL, straight-line velocity; VSL, and linearity; LIN is the ratio of VSL to VCL of sperm incubated in HTF medium 1 hr. (B) Serum testosterone levels in seminal vesicle secretion donors. (C) Typical flow cytometry patterns for JC-1 staining. From left to right: Unstained, untreated (HTF), and antimycin-treated sperm. R7 and R8 were gated to obtain positive rates of over 60% for HTF and antimycin, respectively. (D) The effect of various drugs on the proportion of high mitochondrial membrane potential (hMMP; R7). Data are mean ± SEM. At least three independent replicates. (B) Significance was tested in comparison using Student’s t-test. (D) Percentage data were subjected to arcsine transformation before statistical analysis. Differences between groups were assessed by one-way analysis of variance (ANOVA). When ANOVA was significant, differences among values were analyzed by Tukey’s Honest Significant Difference test for multiple comparisons. Different letters represent significantly different groups. Data were considered statistically significant at p < 0.05.
-
Figure 1—figure supplement 1—source data 1
Raw data and sample metadata for Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig1-figsupp1-data1-v1.xlsx
Characteristics of the seminal vesicle in aging mice.
(A) The effects of secretions from aged seminal vesicle fluid on sperm motility. Straight-line velocity; VSL, motile, and progressive motile. (B) Serum testosterone (T4) levels in young (3 months old) or aged (12 months) mice. (C) The high mitochondrial membrane potential (hMMP) was checked by the JC-1 kit. (D) Hematoxylin/eosin (HE) staining in seminal vesicles of young and aged mice. Scale bar = 50 µm for left panel and 20 µm for right panel. (E) Representative images staining for Ki67. Scale bar = 50 µm. (F) The localization of the androgen receptor (AR; NR3C4) in the seminal vesicles of aged mice. Scale bar = 50 µm. (E, F) Images were obtained at ×10 magnification. Data are mean ± SEM. At least three independent replicates. Percentage data were subjected to arcsine transformation before statistical analysis. (A, B) Significance was tested in comparison using Student’s t-test. (C) A two-way ANOVA was performed. Tukey’s Honest Significant Difference test was performed as a post hoc test. Both the age and antimycin treatment were significant. The interaction was not significant. Different letters represent significantly different groups. Data were considered statistically significant at p < 0.05.
-
Figure 1—figure supplement 2—source data 1
Raw data and sample metadata for Figure 1—figure supplement 2.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig1-figsupp2-data1-v1.xlsx
Gating strategy of flow cytometry for sperm.
(A) Gating strategy for the selection of single sperm. Using forward scatter (FSC)-A and side scatter (SSC)-A dot plots, similar size and complexity cells were firstly selected (R1). In FSC-A and FSC-H dot plots and FSC-A and FSC-W dot plots, similar-size cells were accumulated near area; thus, using these plots, again similar-size cells were selected (R2 and R3). The cells in R3 were used for the below analysis. (B) The dot plots of 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazolyl carbocyanine iodide (JC-1) green (x-axis) and red (y-axis). The percentage of JC-1 red-positive sperm (R7) was used for the analysis.
The testosterone–androgen receptor pathway inhibits the cell proliferation of seminal vesicle epithelial cells.
(A) The localization of the androgen receptor (AR; NR3C4) in seminal vesicle of control (Ctrl) mice and those treated with flutamide (Flut). Scale bar = 50 µm from ×10 magnification for left panel and 20 µm from ×20 magnification for right panel in each group. (B, C) Cell proliferation and apoptosis in seminal vesicle of control (Ctrl) mice and those treated with flutamide (Flut): (B) Representative images of Ctrl and Flut staining for Ki67 (top) and TUNEL (bottom). Scale bar = 20 µm. (C) Percentage of Ki67-positive cells (top) and TUNEL-positive (bottom) in Ctrl and Flut-treated seminal vesicle sections. (D) Experimental design to evaluate the effects of testosterone on the proliferation of seminal vesicle epithelial cells in vitro. The epithelial cells were cultured with or without testosterone for 8 days. (E) Growth curves of seminal vesicle epithelial cells that were cultured with 0 (c), 1, 10, and 100 ng/ml of testosterone. (F, G) Cell cycle status was determined by flow cytometry. Data are mean ± SEM. n = 3–5 mice or independent replicates. Each replicate experiments with 3–6 wells containing pooled cells from 3 to 5 mice. Percentage data were subjected to arcsine transformation before statistical analysis. Significance was tested in comparison to Ctrl using Student’s t-test. The cell number data at d8 was compared with the control using Dunnett’s test. Data were considered statistically significant at p < 0.05.
-
Figure 2—source data 1
Raw data and sample metadata for Figure 2.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig2-data1-v1.xlsx
Gating strategy of flow cytometry for seminal vesicle epithelial cells.
Gating strategy for the selection of single sperm. Using forward scatter (FSC)-A and side scatter (SSC)-A dot plots, similar size and complexity cells were firstly selected (R1). In FSC-A and FSC-H dot plots and FSC-A and FSC-W dot plots, similar-size cells were accumulated near area; thus, using these plots, again similar-size cells were selected (R2 and R3). The cells in R3 were applied to the propidium iodide (PI) histogram plot. Labeling DNA with PI allows fluorescence-based analysis of the cell cycle. The intensity of PI fluorescence correlates with the amount of DNA in each cell. Comparing the G1 and G2 phases, the amount of DNA doubles in the G2 phase, so the fluorescence intensity of the cell population also doubles.
Testosterone changes the expression of genes involved in metabolic pathway in seminal vesicle epithelial cells.
(A) Volcano plot of differentially expressed genes. RNA sequencing was performed using RNA extracted from the seminal vesicle epithelial cells cultured with or without 100 ng/ml testosterone. Genes with a significant expression change are highlighted as red dots. A total of 4460 genes were significant for a cutoff of p < 0.05. (B) MA plot of differentially expressed results. The seminal vesicle-specific genes are highlighted as red dots rather than significant genes. (C) Top 10 genes upregulated or downregulated by testosterone, respectively, for altered gene expression. Data are mean fold changes ± SEM. n = 3 independent replicates. (D) Conducted KEGG analysis to identify differences in pathway enrichment by testosterone, identifying the most variability in metabolic pathway genes. It shows the number of differentially expressed genes annotated to Gene Ontology shows (x-axis). p-value (adjusted) which measures the statistical significance of a possible functional enrichment for each term.
-
Figure 3—source data 1
Raw data and sample metadata for Figure 3.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig3-data1-v1.xlsx
Testosterone regulates glucose metabolism and mitochondrial ATP production in seminal vesicle epithelial cells.
(A–C) Extracellular acidification rate (ECAR) analysis by an extracellular flux analyzer in seminal vesicle epithelial cells cultured with 100 ng/ml testosterone (Testo) or vehicle (Ctrl) for 7 days: (A) ECAR kinetics of seminal vesicle epithelial cells using an extracellular flux analyzer. (B) Glucose induced ECAR and (C) oligomycin-sensitive ECAR. (D, E) The concentrations of pyruvate and lactate in the culture supernatant. These measurements were normalized based on cell count and viability. (D) Pyruvate concentration in the medium where seminal vesicle epithelial cells were cultured with or without testosterone for 24 hr. (E) Lactate concentration. (F–J) Mitochondrial respiration measurement by an extracellular flux analyzer: (F) Oxygen consumption rate (OCR) kinetics of seminal vesicle epithelial cells with or without 100 ng/ml testosterone. (G) Basal OCR, (H) FCCP uncoupled respiration, (I) spare respiratory capacity, and (J) oligomycin-sensitive respiration. Data are mean ± SEM of n = 3 replicate experiments with 3–6 wells containing pooled cells from 3 to 5 mice or medium. Student’s t-test was used to compare Ctrl and Testo. The cells were normalized to 10,000 viable cells/well immediately before analysis. Data were considered statistically significant at p < 0.05. The viability of the cells before experiments was 86–93%.
-
Figure 4—source data 1
Raw data and sample metadata for Figure 4.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig4-data1-v1.xlsx
Effect of testosterone on gene expression of enzymes involved in the glucose metabolic pathway in seminal vesicle epithelial cells.
To elucidate the effects of testosterone on gene expression of enzymes involved in glucose catabolism and anabolism in seminal vesicle epithelial cells. ctrl: 7 days of culture with vehicle. Testo: 7 days of culture with 100 ng/ml testosterone. Data are mean ± SEM of n = 3 replicate experiments with 3–6 wells containing pooled cells from 3 to 5 mice. Student’s t-test was used to compare Ctrl and Testo. Data were considered statistically significant at p < 0.05.
-
Figure 5—source data 1
Raw data and sample metadata for Figure 5.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig5-data1-v1.xlsx
ACLY expression in in vivo seminal vesicle.
(A) Representative western blot images of ACLY and α-tubulin in three sets of seminal vesicle collected from 50 mg/kg flutamide subcutaneously for 7 days (Flut) or vehicle treated mice (Ctrl). (B) Quantification of Acly mtNd1, mtNd6, and Acc gene expression by RT-qPCR. Data are mean ± SEM. Student’s t-test was used for comparison between the two groups (n = 3). Data were considered statistically significant at p < 0.05. (C) ACLY immunostaining: seminal vesicles from wild-type mice, flutamide-treated mice, and 12-month-old aging mice. Scale bar is 50 µm.
-
Figure 5—figure supplement 1—source data 1
Raw data and sample metadata for Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig5-figsupp1-data1-v1.xlsx
-
Figure 5—figure supplement 1—source data 2
PDF file containing original western blots for Figure 5—figure supplement 1A, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig5-figsupp1-data2-v1.pdf
-
Figure 5—figure supplement 1—source data 3
Original files for western blot analysis displayed in Figure 5—figure supplement 1A.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig5-figsupp1-data3-v1.zip
Testosterone enhances glucose uptake and fatty acid synthesis via GLUT4 trans-localization in seminal vesicle epithelial cells.
(A) The glucose uptake ability of seminal vesicle epithelial cells was detected using fluorescence-tagged glucose. The cells were cultured with 100 ng/ml testosterone and/or indinavir (100 µM) for 7 days and then further treated with glucose uptake probe-green for 15 min, and intracellular fluorescence was measured by flow cytometry (n = 4). (B) Lipid accumulation in the medium where seminal vesicle epithelial cells were incubated for 24 hr (n = 6). (C) Left panel: Immunostaining of GLUT4 in cultured cell with 100 ng/ml testosterone or vehicle (in vitro model). Right panel: Immunostaining of GLUT4 in flutamide-treated or vehicle mice derived seminal vesicle (in vivo model). Representative images from the same field of view. Left, merged image (fluorescence overlaid with bright-field). Middle, fluorescence channel only. Right, magnified view of the boxed region in the left panel. Scale bar is 10 µm (left panel) or 50 µm (right panel). (D) Western blot images of GLUT4 and α/β-tubulin in three sets of seminal vesicle epithelial cells cultured with 100 ng/ml testosterone (Testo) or in vehicle (Ctrl) for 7 days. Quantitative analysis of GLUT4 relative to α-tubulin obtained from western blot. (E) Fatty acid composition in the medium was analyzed using gas chromatography. (F) Quantification of Elovl family gene expression by RT-qPCR. (G) Pathway of glucose assimilation to oleic acid. Data are mean ± SEM. n = 3–6 independent replicates. Each replicate experiment with 3–6 wells containing pooled cells from 3 to 5 mice or medium. (A, B) The glucose uptake and lipid measurements were normalized based on cell count and viability. A two-way ANOVA was performed. Both the Indinavir and testosterone treatments were significant. The interaction was significant. Tukey’s Honest Significant Difference test was performed as a post hoc test. Different letters represent significantly different groups. Student’s t-test was used for comparison between the two groups. Data were considered statistically significant at p < 0.05.
-
Figure 6—source data 1
Raw data and sample metadata for Figure 6.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig6-data1-v1.xlsx
-
Figure 6—source data 2
PDF file containing original western blots for Figure 6D, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig6-data2-v1.pdf
-
Figure 6—source data 3
Original files for western blot analysis displayed in Figure 6D.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig6-data3-v1.zip
Oleic acid synthesis in vivo regulated by the testosterone–androgen receptor system.
(A) Fatty acid composition of seminal vesicle extracts in flutamide-treated (Flu) or vehicle mice (Ctrl) pretreated with a methylation kit was analyzed by gas chromatography. *Moles contained per unit weight of seminal vesicle secretions. (B) Quantification of Elovl6 gene expression by RT-qPCR. Data are mean ± SEM. Student’s t-test was used for comparison between the two groups (n = 5). Data were considered statistically significant at p < 0.05.
-
Figure 6—figure supplement 1—source data 1
Raw data and sample metadata for Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig6-figsupp1-data1-v1.xlsx
The effects of lipid mixture (LM) on sperm function.
The LM improves the VSL of sperm. Here, LM means that sperm were cultured in HTF medium containing an LM for 1 hr, and the control (LM 0%) means without LM. Curvi-linear velocity; VCL, straight-line velocity; VSL, and linearity; LIN is the ratio of VSL to VCL. Data are mean ± SEM of n = 4 replicate experiments. Percentage data were subjected to arcsine transformation before statistical analysis. Differences between groups were assessed by one-way analysis of variance (ANOVA). When ANOVA was significant, differences among values were analyzed by Tukey’s Honest Significant Difference test for multiple comparisons. Different letters represent significantly different groups. Data were considered statistically significant at p < 0.05.
-
Figure 6—figure supplement 2—source data 1
Raw data and sample metadata for Figure 6—figure supplement 2.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig6-figsupp2-data1-v1.xlsx
-
Figure 6—figure supplement 2—source data 2
Results of the reanalysis of Figure 6—figure supplement 2 using nonparametric tests and effect sizes with 95% confidence intervals are excerpted from the response to the reviewer.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig6-figsupp2-data2-v1.pdf
Testosterone-regulated ACLY induces metabolic shifts in seminal vesicle epithelial cells.
(A) Western blot images of ACLY and α/β-tubulin in three sets of seminal vesicle epithelial cells cultured with 100 ng/ml testosterone (Testo) or in vehicle (Ctrl) for 7 days. (B) Quantitative analysis of ACLY relative to α-tubulin obtained from western blot. (C) shRNA knockdown experiments of ACLY in seminal vesicle epithelial cells. ACLY protein levels in scrambled shRNA or ACLY shRNA-transfected seminal vesicle epithelial cells cultured with or without 100 ng/ml testosterone were determined by western blot. (D) Number of cells at 7 days after incubation. (E, F) Changes in oxygen consumption of seminal vesicle epithelial cells were analyzed by a flux analyzer: (E) Oxygen consumption rate (OCR) kinetics of seminal vesicle epithelial cells transfected with scrambled shRNA or ACLY shRNA. (F) Basal OCR. (G) The impact of ACLY knockdown on testosterone-induced fatty acid synthesis was measured. These measurements were normalized based on cell count and viability. The viability of the cells before experiments was 67–81%. (H–I) Fatty acid composition in the cultured supernatants was analyzed using gas chromatography. (H) Palmitate (C16:0). (I) Stearic acid (C18:0). (J) Oleic acid (C18:1). (K–N) The effect of culture supernatants of testosterone-treated cells on sperm motility was evaluated, especially after ACLY knockdown. (K) Motile. (L) Progressive motile. (M) Straight-line velocity; VSL. (N) Linearity; LIN. Data are mean ± SEM. n = 3–6 independent replicates. Repeated experiments were performed with cells recovered from 3 wells containing pooled cells from 3 to 5 mice. Student’s t-test was used for comparison between the two groups. Percentage data were subjected to arcsine transformation before statistical analysis. (B) Significance was tested in comparison using Student’s t-test. (D, G–M) A two-way ANOVA was performed. Tukey’s Honest Significant Difference test was performed as a post hoc test. (D) Both the ACLY knockdown and testosterone treatment were significant. The interaction was significant. (G) Both the ACLY knockdown and testosterone treatment were significant. The interaction was not significant. (H, I) Only the ACLY knockdown was significant. The interaction was not significant. (J) Both the ACLY knockdown and testosterone treatment were significant. The interaction was significant. (F, N) Since the results of the Bartlett test were significant, a two-way ANOVA using a generalized linear model was performed. Games–Howell was performed as a post hoc test. (E) Only the ACLY knockdown was significant. The interaction was not significant. (N) Testosterone treatment was significant. The interaction was significant. Different letters represent significantly different groups. Data were considered statistically significant at p < 0.05.
-
Figure 7—source data 1
Raw data and sample metadata for Figure 7.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig7-data1-v1.xlsx
-
Figure 7—source data 2
PDF file containing original western blots for Figure 7A, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig7-data2-v1.pdf
-
Figure 7—source data 3
PDF file containing original western blots for Figure 7C, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig7-data3-v1.pdf
-
Figure 7—source data 4
Original files for western blot analysis displayed in Figure 7A, C.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig7-data4-v1.zip
Testosterone regulates the metabolic activity of human seminal vesicle epithelial cells.
(A) Representative image of human seminal vesicle epithelial cells. (B) Growth curves of seminal vesicle epithelial cells with 100 ng/ml testosterone (Testo) or without (Ctrl). (C–H) Extracellular acidification rate (ECAR) kinetics and oxygen consumption rate (OCR) kinetics of human seminal vesicle epithelial cells after 6 days of culture with or without 100 ng/ml testosterone using a flux analyzer. (D) Glucose-induced ECAR and (E) oligomycin-sensitive ECAR. (G) Basal OCR and (H) FCCP uncoupled respiration. (I) The glucose uptake ability of seminal vesicle epithelial cells was detected using fluorescence-tagged glucose. (J) Lipid accumulation in the medium where human seminal vesicle epithelial cells were incubated for 24 hr. (K–M) Fatty acid composition in the cultured supernatants was analyzed using gas chromatography. (K) Palmitate (C16:0). (L) Stearic acid (C18:0). (M) Oleic acid (C18:1). Data are mean ± SEM. n = 3 independent replicates. Student’s t-test was used for comparison between the two groups. (C–J) These measurements were normalized based on cell count and viability. The viability of the cells before experiments was 88–96%. (I, K, L) Since the results of the Bartlett test were significant, a two-way ANOVA using a generalized linear model was performed. Games–Howell was performed as a post hoc test. Both the Indinavir and testosterone treatment were significant. The interaction was significant. (J) A two-way ANOVA was performed. Tukey’s Honest Significant Difference test was performed as a post hoc test. Both the indinavir and testosterone treatments were significant. The interaction was significant. Different letters represent significantly different groups. Data were considered statistically significant at p < 0.05.
-
Figure 8—source data 1
Raw data and sample metadata for Figure 8.
- https://cdn.elifesciences.org/articles/95541/elife-95541-fig8-data1-v1.xlsx
Testosterone-induced metabolic reprogramming in seminal vesicle epithelial cells.
Testosterone promotes glucose uptake by changes in the localization of GLUT4 in seminal vesicle epithelial cells. ATP-citrate-lyase (ACLY) activated by testosterone promotes fatty acid synthesis by skipping some tricarboxylic acid (TCA) cycle steps. Simultaneously, cell proliferation in the epididymal epithelial cells is suppressed. Testosterone also promotes the synthesis of oleic acid from acetyl-CoA synthesized by ACLY.
Results of reanalysis of supplementary Figure 5 using nonparametric tests and effect sizes with 95% confidence intervals.
Upper part; Differences between groups were assessed by Kruskal–Wallis test, differences among values were analyzed by Dunn’s post-hoc comparisons (Bonferroni corrected) for multiple comparisons. Different letters represent significantly different groups. Lower part; The effect sizes with 95 % confidence intervals. For example, Cliff's Δ = -1 (95% CI ~ -0.6) in VSL's “LM 0 vs LM1” means that LM 1% values exceed LM 0 %values in all pairs.
Tables
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mouse, inbred, male) | C57BL/6NCrl | Jackson Laboratory Japan (originated from Charles River) | Strain #:027; RRID:IMSR_CRL:027 | |
| Strain, strain background (Mouse, outbred, female) | Crl: CD1 (ICR) | Jackson Laboratory Japan (originated from Charles River) | Strain #:022; RRID:IMSR_CRL:022 | |
| Cell line (Homo sapiens) | Human seminal vesicle epithelial cells | ScienCell | 4460 | |
| Cell line (Mus musculus) | Mouse seminal vesicle epithelial cells | This paper | Isolation and culture conditions are described in the Methods section. | |
| Transfected construct (M. musculus) | U6 shRNA lentiviral vector targeting Acly | VectorBuilder | mAcly[shRNA#1], ID;VB900215-4814zyj | Target sequence; GCAGCAAAGATGTTCAGTAAA |
| Transfected construct (M. musculus) | Scramble control shRNA lentiviral vector | VectorBuilder | Scramble shRNA control, ID;VB010000-9526zpu | Target sequence; CCTAAGGTTAAGTCGCCCTCG |
| Antibody | Rabbit monoclonal anti-AR antibody | Abcam | ab133273, RRID:AB_11156085 | 1:100 |
| Antibody | Rabbit polyclonal anti-Ki67 antibody | Abcam | ab15580, RRID:AB_443209 | 1:1000 |
| Antibody | Rabbit monoclonal anti-ACLY antibody | Abcam | ab40793, RRID:AB_722533 | IF; 1:200, WB; 1:10,000 |
| Antibody | Rabbit polyclonal anti-GLUT4 antibody | Abcam | ab33780, RRID:AB_2191441 | IF; 1:200, WB; 1:100 |
| Antibody | Cy3-labeled goat polyclonal anti-rabbit IgG | Sigma | C-2306, RRID:AB_258792 | 1:200 |
| Antibody | Rabbit polyclonal anti-α/β-Tubulin antibody | Cell Signaling | 2148S, RRID:AB_2288042 | 1:1000 |
| Antibody | Goat polyclonal HRP-conjugated anti-rabbit IgG secondary antibody | Cell Signaling | 7074S, RRID:AB_2099233 | 1:4000 |
| Commercial assay or kit | Rodent testosterone ELISA kit | Endocrine Technologies | ERKR7016 | |
| Commercial assay or kit | MitoPT JC-1 Assay Kit | ImmunoChemistry Technologies | 911 | |
| Commercial assay or kit | In Situ Cell Death Detection Kit, POD | Roche | 11684817910 | |
| Commercial assay or kit | VECTASTAIN Elite ABC kit / LifeABC kit | Vector | PK-6101 | |
| Commercial assay or kit | VECTASHIELD Mounting Medium with DAPI | Vector | H-1200 | |
| Commercial assay or kit | Glucose Uptake Assay Kit-Green | DOJINDO | UP02 | |
| Commercial assay or kit | Pyruvate Assay Kit | Cell Biolabs | MET-5029 | |
| Commercial assay or kit | Lactate Assay Kit | DOJINDO | L256 | |
| Commercial assay or kit | Total lipid quantification kit | Cell Biolabs | STA-617 | |
| Commercial assay or kit | Fatty acid methylation kit | Nacalai Tesque | 06482-04 | |
| Commercial assay or kit | Fatty acid methyl ester purification kit | Nacalai Tesque | 06483-94 | |
| Chemical compound, drug | Testosterone | Sigma | T-1500 | 100 ng/ml in ethanol |
| Chemical compound, drug | Flutamide | Sigma | F-9397 | Androgen receptor antagonist; 50 µg/g BW, s.c. |
| Chemical compound, drug | eCG | Asuka Seiyaku | ||
| Chemical compound, drug | hCG | Asuka Seiyaku | ||
| Chemical compound, drug | Indinavir | Sigma | SML0189 | 100 nM in water |
| Chemical compound, drug | Oligomycin | Sigma | O4876 | |
| Chemical compound, drug | 2-Deoxy-Glucose | Sigma | D8375 | |
| Chemical compound, drug | FCCP | Sigma | SML2959 | |
| Chemical compound, drug | Rotenone | Sigma | R8875 | |
| Chemical compound, drug | Antimycin A | Sigma | A8674 | |
| Chemical compound, drug | Lipid mixture | Sigma | L0288 | |
| Chemical compound, drug | Poly-L-lysine | Nacalai Tesque | 28356-84 | Dissolve poly-L-lysine in water to a concentration of 10 µg/ml, dispense 800 µl into a 12-well plate (2 µg/cm²), and incubate overnight at 37°C. |
| Chemical compound, drug | Collagen-coated plates | IWAKI | 4815-010 | |
| Chemical compound, drug | Epithelial Cell Medium | ScienCell | 4101 | |
| Software, algorithm | ImageJ | National Institutes of Health | Software version 2.1.0/1.53u, RRID:SCR_003070 | |
| Software, algorithm | CellSens imaging software | EVIDENT | Software version 4.1.1 | |
| Software, algorithm | Agilent Seahorse Wave software | Agilent Technologies Inc | Software version 3.0.0.41, RRID:SCR_019540 | |
| Software, algorithm | RaNA-seq pipeline (Fastp, Salmon, DESeq2) | Prieto and Barrios, 2019, PMID: 31730197 | ||
| Software, algorithm | R | Version 4.3.1, RRID:SCR_001905 | ||
| Software, algorithm | CASA software | Hamilton Thorne | Software version 1.11.9 |
Additional files
-
Supplementary file 1
Primer sequences used for quantitative real-time PCR.
- https://cdn.elifesciences.org/articles/95541/elife-95541-supp1-v1.docx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/95541/elife-95541-mdarchecklist1-v1.docx