Endocytic recycling is central to circadian collagen fibrillogenesis and disrupted in fibrosis
- Wellcome Centre for Cell-Matrix Research, Faculty of Biology, Medicine and Health, University of Manchester, United Kingdom
- Division of Molecular and Cellular Function, Faculty of Biology, Medicine and Health, University of Manchester, United Kingdom
- Blond McIndoe Laboratories, Faculty of Biology, Medicine and Health, University of Manchester, United Kingdom
- Department of Biomedicine and Centre for Cancer Biomarkers, Norwegian Center of Excellence, University of Bergen, Norway
- Manchester University National Health Service Foundation Trust, Manchester Academic Health Science Centre, United Kingdom
Figures
Figure 1 with 10 supplements
Collagen-I is endocytosed and reassembled into fibrils.
(A) Fluorescent images of tail tendon incubated with Cy3-colI for 5 days, showing the presence of collagen-I within the cells, and fibril-like fluorescence signals outside of cells. Hoechst stain was used to locate cells within the tendon. Area surrounded by yellow box expanded on the right, and cells with Cy3-colI present intracellularly pointed out by yellow triangles. Area surrounded by gray box expanded on the right, and fibril-like fluorescence signals indicated with white arrows. Scale bar = 50 µm. Representative of N=3. (B) Bar chart showing an increase of percentage of fluorescent iTTFs incubated with 1.5 µg/mL Cy3-colI over time (left), and an increase of percentage of fluorescent iTTFs incubated with increasing concentration of Cy3-colI for 1 hr (right), suggesting a non-linear time-dependent and dose-dependent uptake pattern. N=3. (C) Flow cytometry imaging of iTTFs incubated with 5 µg/mL Cy3-labeled collagen-I for 1 hr, showing that collagen-I is taken up by cells and held in vesicular-like structures. Images acquired using ImageStream at ×40 magnification. Scale bar = 10 μm. Cy3 – Cy3 channel, BF/Cy3 – merged image of BF and Cy3. Representative of >500 cells images collected per condition. (D) Fluorescent images of iTTFs transduced with Rab5-GFP and incubated with Cy3-labeled collagen-I. Yellow arrows point to labeled collagen co-localizing with Rab5 in intracellular structures. Representative of N=3. Scale bar = 10 µm. (E) Fluorescent images of iTTFs incubated with 5 µg/mL Cy3-colI for 1 hr, trypsinized and replated in fresh media, and further cultured for 72 hr. Top labels denote the fluorescence channel corresponding to proteins detected. Merged image color channels as denoted on top left. Representative of N>3. Scale bar = 20 µm. (F) Fluorescent image series of Cy3-colI incubated at different concentrations for 72 hr, either cell-free (right panel), or with iTTFs (+fibroblasts, left panel). Representative of N=3. Scale bar = 20 µm. Red box – zoomed out to the bottom left and separated according to fluorescence channel. White arrows highlighting Cy3-positive fibrils assembled by fibroblasts when incubated with 0.1 µg/mL Cy3-colI. (G) Quantification of the area of Cy3-positive fibrils in cell-free cultures, quantified per image area. N=3. (H) Quantification of the area of Cy3-positive fibrils in +fibroblasts cultures, corrected to number of nuclei per image area. N=3. (I) Comparison of total area of Cy3-positive fibrils in cell-free and +fibroblast cultures at 0.1 µg/mL concentration, as quantified per image area. N=3. ****p<0.0001.
Figure 1—figure supplement 1
Circular dichroism spectra of unlabeled (black), Cy3-labeled (orange, Cy3-colI), and Cy5-labeled (blue, Cy5-colI) collagen-I in acetic acid showing the helical positive peak at 223 nm in each of the spectra.
Figure 1—figure supplement 2
Mass photometry of unlabeled (black), Cy3-labeled (orange, Cy3-colI), and Cy5-labeled (blue, Cy5-colI) collagen-I in acetic acid.
Figure 1—figure supplement 3
Temperature-induced thermal unfolding of collagen-I monitored at 223 nm.
The thermal transition is the same for each of the labeled and non-labeled collagen-I with a mid-point melting temperature of 44°C.
Figure 1—figure supplement 4
Fluorescent images of tail tendon either not incubated with fluorescently labeled collagen-I (control, bottom), or incubated with fluorescently labeled collagen-I for 5 days – Cy3-colI as added for the first 3 days, removed, and then with 5FAM-labeled collagen-I (FAM-colI) added in the last 2 days.
Images show presence of collagen-I within the cells, and fibril-like fluorescence signals outside of cells. Hoechst stain was used to locate cells within the tendon. Area surrounded by yellow box expanded on the right highlighting a cell with only Cy3-colI present intracellularly. Area surrounded by gray boxes expanded on the right, highlighting fibril-like fluorescence signals that are either FAM-colI positive only, or have co-localization of both Cy3-colI and FAM-colI. Representative of N=2.
Figure 1—figure supplement 5
Representative dot plots from flow cytometry analysis representing Cy3 gates used in control and iTTFs incubated with 1 µg/mL Cy3-labeled collagen (Cy3-colI) for 18 hr.
Representative of N>3.
Figure 1—figure supplement 6
Representative dot plots from flow cytometry analysis representing Cy5 gates used in control and iTTFs incubated with 1 µg/mL Cy5-labeled collagen (Cy5-colI) for 18 hr.
Representative of N>3.
Figure 1—figure supplement 7
Bar chart showing a progressive increase of percentage of fluorescent iTTFs incubated with 1.5 µg/mL Cy5-colI over time (left), and an increase of percentage fluorescent iTTFs incubated with increasing concentration of Cy5-colI for 1 hr (right), suggesting a non-linear time-dependent and dose-dependent uptake pattern.
N=3.
Figure 1—figure supplement 8
Flow cytometry imaging of iTTFs incubated with 5 µg/mL Cy5-labeled collagen-I for 1 hr, showing that collagen-I is taken up by cells and held in vesicular structures.
Images acquired using ImageStream at ×40 magnification. Scale bar = 10 μm. Cy5 – Cy5 channel, BF/Cy5 – merged image of BF and Cy5. Representative of >500 cells images collected per condition.
Figure 1—figure supplement 9
Fluorescent image series of iTTFs incubated with Cy3-labeled collagen-I at 0 min (t=0 min), 69 min (t=69 min), and 107 min (t=107 min) after addition (rows) and viewed from different angles (columns), with cell mask (cyan) to distinguish the cell volume.
White arrows point to intracellular collagen in vesicular-like structures. Representative of N=3. Scale bar = 20 µm.
Figure 1—figure supplement 10
iTTFs were incubated with Cy3-colI (magenta) for 1 hr, trypsinized, replated, and allowed to stick down for 18 hr, before being fixed and stained with collagen-I (ColI, green) and counterstained with DAPI (blue).
Arrowhead indicating co-localization of labeled collagen-I with endogenous collagen-I. Scale bar = 10 µm. Representative of N=3.
Figure 2 with 7 supplements
Inhibition of endocytosis leads to changes in collagen-I homeostasis, and endocytosis is a rhythmic event.
(A) Left: fluorescent images of collagen-I (red) counterstained with DAPI (blue) in iTTFs treated with DMSO (top) or Dyng4a (bottom) for 72 hr. Scale bar = 20 µm. Right: quantification of area occupied by collagen-I fibrils, corrected to number of nuclei. N=3 with 5 images from each experiment **p=0.0025. (B) Western blot analysis of conditioned media taken from iTTFs treated with DMSO or Dyng4a for 72 hr, showing a decrease in collagen-I secretion. Top: probed with collagen-I antibody (Col-I), bottom: counterstained with Ponceau (Pon) as control. Protein molecular weight ladders to the left (in kDa). Representative of N=3. (C) Left: fluorescent images of fibronectin (magenta) counterstained with DAPI (blue) in iTTFs treated with DMSO (top) or Dyng4a (bottom) for 72 hr. Scale bar = 20 µm. Right: quantification of area occupied by fibronectin fibrils, corrected to number of nuclei. N=3 with 5 images from each experiment. (D) Percentage Cy3-colI taken up by synchronized iTTFs over 48 hr. Meta2d analysis indicates a circadian rhythm of periodicity of 23.8 hr. Bars show mean ± s.e.m. of N=3 per time point. (E) Percentage of Cy3-colI taken up by synchronized iTTFs, corrected to the maximum percentage uptake of the time course (pink, bars show mean ± s.e.m. of N=3 per time point), compared to the percentage collagen fibril count over time, corrected to the maximum percentage fibril count of the time course (black, fibrils scored by two independent investigators. Bars show mean ± s.e.m. of N=2 with n=6 repeats at each time point).
Figure 2—figure supplement 1
Representative images from flow imaging of iTTFs either incubated with Cy5-colI only (top) or both Alexa Fluor 488-labeled 70 kDa dextran and Cy5-colI (bottom), showing very little co-localization between the two markers after being taken up into cells.
Scale bar = 10 µm. N=3, >800 cells analyzed per experiment.
Figure 2—figure supplement 2
Representative images from flow imaging of iTTFs either incubated with Cy5-colI only (top) or Cy5-colI and unlabeled colI (bottom), showing that in the presence of excess unlabeled collagen, the majority of the Cy5 signal are restricted to the periphery of the cells.
Scale bar = 10 µm. N=3, >800 cells analyzed per experiment.
Figure 2—figure supplement 3
Scatter plot showing Dyngo4a (Dyng), an endocytosis inhibitor, treatment for 1 hr inhibits over 50% of Cy3-colI uptake in iTTFs.
Bars show mean ± s.e.m. of N=6. ****p<0.0001.
Figure 2—figure supplement 4
Alamar Blue assay showing that prolonged treatment of 20 µM Dyngo4a (Dyng) does not inhibit iTTF proliferation.
Figure 2—figure supplement 5
Full scan of Ponceau stain western blot, corresponding to Figure 2B.
Figure 2—figure supplement 6
Quantitative PCR (qPCR) analysis of Col1a1 and Fn1 mRNA levels in DMSO and Dyng-treated iTTFs, corrected to DMSO control, showing a decrease in both collagen-I and fibronectin transcripts.
Two-way ANOVA was carried out. Bars showing mean ± s.e.m. of N=3, ****p<0.0001.
Figure 2—figure supplement 7
Percentage Cy3-colI taken up by synchronized iTTFs over 48 hr.
Fluctuation of Cy3-positive cells was corrected to running average (average of 12 hr). Bars show mean ± s.e.m. of N=3 per time point.
Figure 3 with 2 supplements
Collagen-I recycling can generate fibrils.
(A) Fluorescent image series of iTTFs treated with scrambled control (top panel, scr), and siRNA against col1a1 (bottom panel, siCol1a1). Labels on top denote the fluorescence channel corresponding to proteins detected (ColI – collagen-I, Fn1 – fibronectin). Quantification of collagen-I and fibronectin signal to the right. Representative of N=4. Scale bar = 25 µm. *p=0.021. (B) Fluorescent image series of scr (left column) and siCol1a1 (right column) iTTFs incubated with Cy3-colI. Labels on left denote the fluorescence channel(s) corresponding to proteins detected (ColI – collagen-I, Fn1 – fibronectin). Cy3-colI fibrils highlighted by red arrows, and collagen-I fibrils highlighted by white arrows. Both scr cells and siCol1a1 cells can take up exogenous collagen-I and recycle to form collagen-I fibril. Representative of N>3. Scale bar = 10 μm. (C) Fluorescent image series of siCol1a1 iTTFs treated with DMSO control (left) or Dyngo4a (right) during Cy3-colI uptake, followed by further culture for 72 hr. Labels on left denote the fluorescence channel corresponding to proteins detected (ColI – collagen-I, Fn1 – fibronectin). Quantification of Cy3-colI signal to the bottom. Dyngo4a treatment led to a reduction of Cy3-colI fibrils. Representative of N>3. Scale bar = 20 µm. **p=0.0022.
Figure 3—figure supplement 1
Quantitative PCR (qPCR) analysis of scr and siCol1a1 iTTFs.
N=5. p<0.0001.
Figure 3—figure supplement 2
Bar chart showing the percentage of iTTFs that have taken up 5 µg/mL Cy3-colI (left) or 5 µg/mL Cy5-colI (right) after 1 hr incubation.
Paired t-test was performed, N=4. *p=0.0372.
Figure 4 with 2 supplements
Fibroblasts without endogenous collagen-I can effectively make fibrils by endocytic recycling of exogenous collagen.
(A) Fluorescent images of primary tail tendon fibroblasts isolated from control mice (top panel, CKO-), and tamoxifen-treated collagen-knockout mice (bottom panel, CKO+). Labels on top denote the fluorescence channel corresponding to proteins detected. Quantification of collagen-I and fibronectin fluorescence signal to the right. Representative of N=3. Scale bar = 10 μm. **p=0.0084. (B) Fluorescent images of CKO-/CKO+ tail tendon fibroblasts incubated with Cy3-colI. Labels on top denote the fluorescence channel corresponding to proteins detected. Cy3-colI fibril highlighted by red arrows, and collagen-I fibril highlighted by white arrows. Both CKO- and CKO+ cells can take up exogenous collagen-I and recycle to form collagen-I fibrils. Representative of N>3. Scale bar = 25 μm. (C) Fluorescent image series of CKO+ tail tendon fibroblasts treated with DMSO control (left) or Dyngo4a (right) during Cy3-colI uptake, followed by further culture for 72 hr. Labels on left denote the fluorescence channel corresponding to proteins detected. Quantification of Cy3-colI signal to the bottom. Dyngo4a treatment led to a significant reduction of Cy3-colI fibrils. Representative of N>3. Scale bar = 25 µm. *p=0.00273.
Figure 4—figure supplement 1
Quantitative PCR (qPCR) analysis of CKO- and CKO+ primary tail tendon fibroblasts.
Col1a1ex6 are primers specific to the locus being knocked out, and col1a1 are primers detecting general collagen-I mRNA. N=5. ****p<0.0001.
Figure 4—figure supplement 2
Bar chart showing the % of primary tail tendon fibroblasts that have taken up 5 µg/mL Cy3-colI (left) and Cy5-colI (right) after 1 hr incubation; CKO+ cells have a similar uptake to CKO- when incubated with Cy3-colI, and a slight but significant increase in uptake of Cy5-colI.
N=4. ****p<0.0001.
Figure 5 with 11 supplements
VPS33B controls collagen fibril formation at the plasma membrane in a rhythmic manner.
(A) Electron microscopy images of fibroblasts plated on ACLAR and grown for a week before fixation and imaging. Ctrl culture has numerous collagen-I fibrils, as pointed out by arrows. Yellow arrow points to a fibripositor, and green box is expanded to the left bottom corner, showing the distinct D-banding pattern of collagen-I fibril when observed with electron microscopy. VPSko clones all have fewer and thinner fibrils present in the culture (pointed out by red arrows). Representative of N=3. Scale bar = 0.5 µm. (B) Fluorescence images of collagen-I (red) and DAPI counterstain in ctrl and VPSko iTTFs. Yellow arrows indicating collagen fibrils, and white arrows pointing to collagen-I presence in intracellular vesicles. Representative of N>6. Scale bar = 25 µm. (C) Matrix deposition by ctrl or VPSko iTTFs, after 1 week of culture. Left: decellularized matrix mass. N=4, *p=0.0299. Right: hydroxyproline content presented as a ratio between ctrl and VPSko cells. N=4, *p=0.0254. Ratio-paired t-test used. (D) Fluorescence images of collagen-I (red) and DAPI counterstain in ctrl and VPSoe iTTFs. Representative of N>6. Scale bar = 20 µm. (E) Matrix deposition by ctrl or VPSoe iTTFs, after 1 week of culture. Left: decellularized matrix mass, N=4. Right: hydroxyproline content presented as a ratio between ctrl and VPSoe cells, N=4. Ratio-paired t-test used. (F) Relative collagen fibril count in synchronized ctrl (black) and VPSoe (pink) iTTFs, corrected to the number of fibrils in ctrl cultures at start of time course. Fibrils scored by two independent investigators. Bars show mean ± s.e.m. of N=2 with n=6 at each time point. (G) Western blot analysis of conditioned media taken from ctrl and VPSoe iTTFs after 72 hr in culture. Top: probed with collage-I antibody (ColI), bottom: counterstained with Ponceau (Pon) as control. Protein molecular weight ladders to the left (in kDa). Representative of N=3.
Figure 5—figure supplement 1
Western blot analysis of VPS33B knockout (VPSko) clones compared to control (ctrl) iTTFs.
Top: probed with VPS33B antibody, bottom: probed with GAPDH antibody. Protein molecular weight ladders to the left (in kDa). Representative of N=3.
Figure 5—figure supplement 2
Quantitative PCR (qPCR) analysis of VPS33B expression in the three selected clones.
***p=0.0002, **p=0.0039, *p=0.0163.
Figure 5—figure supplement 3
Alamar blue analysis of proliferation rates of ctrl and VPSko iTTFs.
Representative of N=3.
Figure 5—figure supplement 4
Western blot analysis of VPS33B protein levels in control (ctrl) and VPS33B overexpressing (VPSoe) iTTFs.
Top panel probed with VPS33B antibody. Bottom panel reprobed with vinculin antibody. Protein molecular weight ladders to the left (in kDa). Representative of N=4.
Figure 5—figure supplement 5
Quantitative PCR (qPCR) analysis of VPS33B expression in ctrl and VPSoe iTTFs.
N=4, ****p<0.0001.
Figure 5—figure supplement 6
Single parameter histograms of flow cytometry analysis on ctrl (left) and VPSoe (right) iTTFs, showing a shift in increase of RFP fluorescence and thus expression of VPSoe vector.
Representative of N>4.
Figure 5—figure supplement 7
Alamar blue analysis of proliferation rates of ctrl iTTFs and iTTF VPSoe.
Representative of N=3.
Figure 5—figure supplement 8
MetaCycle analyses of the fibril counts showed a rhythmicity of circa 23 hr in ctrl iTTFs compared with circa 28 hr in iTTF VPSoe.
Figure 5—figure supplement 9
Quantitative PCR (qPCR) analysis of VPS33b mRNA expression levels in iTTF or iTTF VPSoe, treated with siRNA scrambled control (iT scr, iToe scr) or siRNA against VPS33b (iT siVPS, iToe siVPS) and cultured for 72 hr.
N=2.
Figure 5—figure supplement 10
Western blot analysis of conditioned media taken from ctrl and VPSoe iTTFs, treated with either siRNA scrambled control (scr) or siRNA against VPS33B (siVPS) and cultured for 72 hr.
Top: probed with collage-I antibody (ColI), bottom: counterstained with Ponceau (Pon) as control. Protein molecular weight ladders to the left (in kDa). Representative of N=2.
Figure 5—figure supplement 11
Quantitative PCR (qPCR) analysis of Col1a1 mRNA expression levels in iTTF or iTTF VPSoe, treated with siRNA scrambled control (iT scr, iToe scr) or siRNA against VPS33b (iT siVPS, iToe siVPS) and cultured for 72 hr.
N=2.
Figure 6 with 7 supplements
Procollagen-I and VPS33B localize to the same compartments.
(A) Schematic depicting the proposed membrane topologies of VPS33b. (B) iTTFs expressing BFP-tagged VPS33B. Left: BFP tagged on the N-terminal end of VPS33B (VPSnBFP). Right: BFP tagged on the C-terminal end (VPScBFP). Images taken in Airy mode. Representative of N>4. Scale bar = 10 µm. (C) Schematic of the split-GFP system. GFP1-10 barrel is introduced into VPS33B (VPS-barrel), and GFP11 to alpha-1 chain of collagen-I (GFP11-pro⍺1(I)). If the two tagged proteins co-localize (e.g. in a vesicle), a GFP signal will be emitted. (D) Brightfield (top) and fluorescence (middle) images of iTTFs expressing both VPS-barrel and GFP11-pro⍺1(I) constructs. Representative of N=5. Green box is expanded to the bottom, to highlight the punctate fluorescence signals within intracellular vesicular structures, as well as fibril-like structures suggestive of fibril assembly sites. Scale bar = 20 µm. (E) Fluorescence images of VIPAS (green), collagen-I (red), and DAPI counterstain in iTTFs. Representative of N=3. Green box is expanded to the right (flipped 90°) to show strong VIPAS signal encasing collagen-I. Scale bar = 25 µm. (F) Quantification of average number of fibrils per cell (left) and average fibril length (right) in control endogenously tagged Dendra-colI expressing 3T3 cells (ctrl) and Dendra-colI expressing 3T3 overexpressing VPScBFP (VPScBFP). >500 cells quantified per condition. N=12. *p=0.048. (G) Brightfield (left) and fluorescence (middle) images of iTTFs expressing VPS-barrel incubated with conditioned media containing Col1a1-GFP11 for 24 hr. Scale bar = 25 μm. (H) Line charts comparing the percentage of iTTFs that have taken up 5 µg/mL Cy3-colI (left) and Cy5-colI (right) after 1 hr incubation between control (ctrl), VPS33B-knockout (VPSko), and VPS33B-overexpressing (VPSoe) cells, corrected to control. RM one-way ANOVA was performed. N=4. (I) Fluorescence images of iTTFs of different levels of VPS33B expression, fed with Cy5-colI and further cultured for 72 hr. Cultures were counterstained with DAPI. Box expanded to right of images to show zoomed-in images of the fibrils produced by the fibroblasts. Representative of N=2.
Figure 6—figure supplement 1
Computational prediction on membrane topology of VPS33B.
(A) The amino acid sequence of mouse VPS33B as listed in UniProt (P59016). Each predicted putative transmembrane domain (TMD) is highlighted in yellow (TMD1) and an adjacent hydrophobic region in orange (HR2), together with their respective predicted ΔG values (kcal/mol) for TMD insertion in the endoplasmic reticulum (ER) membrane (see B). Potential consensus sites for the addition of N-linked glycans (N-X-S/T) are denoted by a blue Y symbol. (B) The amino acid sequence in A was subjected to the full scan option of the ΔG prediction server for identifying potential transmembrane helices: http://dgpred.cbr.su.se/. (C) Potential topologies of mouse VPS33B in the ER membrane. Based on the predicted ΔG values estimated in B, HR1 is predicted to be poorly inserted into the ER membrane. Hence, VPS33B most likely acquires a tail-anchor (TA) protein topology (see hashed box) as opposed to that of a multi-span transmembrane protein (TMP). Cyt, cytosol; Lum, ER lumen.
Figure 6—figure supplement 2
Outline of the in vitro assay using canine pancreatic as a source of endoplasmic reticulum (ER) membrane; following translation, membrane inserted radiolabeled precursor proteins are recovered by centrifugation and analyzed by SDS-PAGE and phosphorimaging.
The N-glycosylation of lumenal domains, confirmed by treatment with endoglycosidase H (Endo H), indicates successful membrane translocation.
Figure 6—figure supplement 3
Schematics of endogenous, truncated, and OPG2-tagged VPS33b proteins used in this study.
Figure 6—figure supplement 4
Non-glycosylated and N-glycosylated radiolabeled cell-free translation products are respectively indicated by a yellow or magenta circle.
The substrates depicted in Figure 6—figure supplement 3, and the model tail-anchor (TA) protein Sec61β (modified with a C-terminal OPG2 tag), were synthesized as outlined in Figure 6—figure supplement 2 in the absence (odd lanes) and presence (even lanes) of canine pancreatic microsomes (indicated as – or +mic). In each case, a significant proportion of full-length and truncated forms of VPS33b pelleted in the absence of microsomes (indicative of aggregation).
Figure 6—figure supplement 5
Non-glycosylated and N-glycosylated radiolabeled products are respectively indicated by a yellow or magenta circle.
The OPG2-tagged truncated forms of VPS33b depicted in Figure 6—figure supplement 3 were synthesized as described in Figure 6—figure supplement 2 and treated with EndoH (EH) (lanes 3, 6, 9, and 12). In no case were any domains N-glycosylated.
Figure 6—figure supplement 6
Schematics of OPG2-tagged VPS33b and Sec61β chimeric proteins used in this study; chimera 1: residues 414–564 VPS33b, residues 73–94 Sec61β (TA region), OPG2 tag; chimera 2: residues 1–72 Sec61β (N-terminal region), residues 565–587 VPS33b (TMD1), OPG2 tag; chimera 3: residues 1–72 Sec61β (N-terminal region), residues 565–617 VPS33b (TMD1, HR1 and C-terminus), OPG2 tag.
Figure 6—figure supplement 7
Non-glycosylated and N-glycosylated radiolabeled products are respectively indicated by a yellow or magenta circle.
Sec61βOPG2 and chimeras 1–3 depicted in Figure 6—figure supplement 6 were synthesized and treated with EndoH (EH) as outlined in Figure 6—figure supplement 2.
Figure 7
Integrin α11 subunit mediates VPS33B-effects and is required for collagen-I fibrillogenesis.
(A) Top 25 Functional Annotation of proteins detected in biotin-enriched samples when compared to non-enriched samples based on p-values. Y-axis denotes the gene ontology (GO) term, X-axis denotes –log (p-value). (B) Heatmap representation of spectral counting of collagens detected in biotin-enriched surface proteins from control (ctrl), VPS33B-knockout (VPSko), and VPS33B-overexpressing (VPSoe) iTTFs. Scale denotes quantitative value as normalized to total spectra, as determined by Proteome Discoverer. (C) Heatmap representation of spectral counting of integrins detected in biotin-enriched surface proteins from control (ctrl), VPS33B-knockout (VPSko), and VPS33B-overexpressing (VPSoe) iTTFs. Scale denotes quantitative value as normalized to total spectra, as determined by Proteome Discoverer. (D) Heatmap representation of spectral counting of Plod3 and VPS33B detected in biotin-enriched surface proteins from control (ctrl), VPS33B-knockout (VPSko), and VPS33B-overexpressing (VPSoe) iTTFs. Scale denotes quantitative value as normalized to total spectra, as determined by Proteome Discoverer. (E) Western blot analysis of integrin α11 subunit levels in control (ctrl), VPS33B-overexpressing (VPSoe), VPS33B-knockout (VPSko) iTTFs. Top: probed with integrin α11 antibody, bottom: reprobed with GAPDH antibody. Protein molecular weight ladders to the left (in kDa). Representative of N=3. (E) Quantitative PCR (qPCR) analysis of Itga11 transcript levels in ctrl compared to VPSko iTTFs (left), and ctrl compared to VPSoe iTTFs (right). N>3, ****p<0.0001, *p=0.0226. (F) qPCR analysis of Itga11 mRNA expression in ctrl (left) or VPSoe (right) iTTFs treated with either scrambled control (scr) or siRNA against Itga11 (siItga11), collected after 96 hr. N=3, **p=0.0091, ****p<0.0001. (G) Immunofluorescence (IF) images of ctrl and VPSoe iTTFs treated with either control siRNA (scr) or siRNA again Itga11 (siItga11), after 72 hr incubation; collagen-I (red) and DAPI (blue) counterstained. Representative of N=3. Scale bar = 25 µm. (H) Bar chart comparing the percentage of iTTFs that have taken up 5 µg/mL Cy5-colI after 1 hr incubation between fibroblasts treated with scrambled control (ctrl) or siRNA against Itga11 (siItga11), corrected to scr. N=3. **p=0.0062.
Figure 8 with 2 supplements
Fibroblasts derived from idiopathic pulmonary fibrosis (IPF) patients have higher collagen endocytic recycling capacity that is mediated by VPS33B and ITGA11.
(A) Quantitative PCR (qPCR) analysis of patient-derived fibroblasts isolated from control (ctrl) or IPF lungs. Bars showing mean ± s.e.m., 5 patients in each group from 2 independent experiments (technical repeats not shown here). Itga11, *p=0.0259; VPS33B, *p=0.0183. (B) Fold change of percentage Cy5-colI (left) or Cy3-colI (right) taken up by ctrl or IPF lung fibroblasts, corrected to average of control fibroblasts. Bars showing mean ± s.e.m., 5 patients in each group from 2 independent experiments (technical repeats not shown here). **p=0.003.(B) Fluorescent images of ctrl or IPF lung fibroblasts that have taken up Cy3-colI (magenta), followed by further culture for 48 hr in the presence of ascorbic acid, before subjected to collagen-I staining (green). Labels on top denote the fluorescence channel corresponding to proteins detected. Quantification of Cy3-colI signal to the right. IPF fibroblasts produced more Cy3-labeled fibrillar structures. Representative of N=5. Scale bar = 20 µm. *p=0.0135. (C) Fluorescent images of IPF lung fibroblasts treated with siRNA scrambled control (scr), siRNA against VPS33B (siVPS33B), or siRNA against ITGA11 (siITGA11) prior to uptake of Cy5-colI (magenta). This was followed by further culture for 48 hr in the presence of ascorbic acid, before subjected to collagen-I staining (green). Labels on top denote the fluorescence channel corresponding to proteins detected. Quantification of Cy5-colI signal to the right. Both siVPS33B and siITGA11 significantly reduced recycled collagen signals. Representative of n=5 across N=2. Ordinary one-way ANOVA with multiple comparisons (to scr) was performed on quantification of Cy5-colI signal. siVPS33B, *p=0.0341; siITGA11, *p=0.0282.
Figure 8—figure supplement 1
Human lung fibroblasts transiently transfected with GFP-tagged RAB5 (RAB5-GRP, green) and with Cy5-colI added before confocal live imaging.
Individual fluorescence channels were presented here together with merged images on the bottom row (with or without brightfield). Yellow arrowheads point out intracellular structures where Cy5-colI co-localizes with RAB5-GFP. Scale bar = 10 µm.
Figure 8—figure supplement 2
Quantitative PCR (qPCR) analyses of ITGA11 and VPS33B mRNA levels in idiopathic pulmonary fibrosis (IPF) cells treated with siRNA against ITGA11 (siITGA11) or siRNA against VPS33B (siVPS33B).
Ordinary one-way ANOVA with multiple comparisons performed, n=5 across N=2. ITGA11, siITGA11 *p=0.0145, siVPS33B *p=0.0319; VPS33B, siITGA11 *p=0.018, siVPS33B *p=0.0207.
Figure 9 with 2 supplements
The idiopathic pulmonary fibrosis (IPF) fibrotic focus is positive for integrin α11 subunit and VPS33B.
(A) Immunohistochemistry of IPF patient (patient 1) with red dotted line outlining the fibroblastic focus, the hallmark lesion of IPF. Sections were stained with hematoxylin and eosin (H&E), collagen-I (ColI), integrin α11, VPS33B. Scale bar = 50 µm. (B) Immunohistochemistry of IPF patient 4 showing regions of emerging fibrotic remodeling with evidence of fibroblastic foci formation (red asterisks). Sections were stained with H&E, ColI, integrin α11, VPS33B. Scale bar = 100 µm. (C) Immunohistochemistry of 5 µm thick sequential lung sections taken from lungs classified as control (Control 1). Sections were stained with hematoxylin and eosin (H&E), collagen-I (ColI), integrin α11, VPS33B. Scale bar = 100 µm.
Figure 9—figure supplement 1
Immunohistochemistry of 5 µm thick sequential lung sections taken from three additional idiopathic pulmonary fibrosis (IPF) patients (IPF2, IPF3, IPF4).
Red dotted lines outline the fibroblastic focus. Sections were stained with hematoxylin and eosin (H&E), collagen-I (ColI), integrin α11, VPS33B. Scale bar = 100 µm.
Figure 9—figure supplement 2
Immunohistochemistry of 5 µm thick sequential lung sections taken from an additional lung classified as control (Control 2).
Sections were stained with hematoxylin and eosin (H&E), collagen-I (ColI), integrin α11, VPS33B. Scale bar = 100 µm.
Figure 10
Proteins responsible for collagen fibrillogenesis are also co-localized to diseased areas of chronic skin wounds.
(A) Immunohistochemistry of 5 µm thick sequential skin sections taken from normal skin regions of patients with chronic skin wounds (Patient 1, Patient 2, Patient 3, Patient 4). Sections were stained with pentachrome, integrin α11, VPS33B. Scale bars positioned in top left corner: black (unzoomed pentachrome)=100 µm, white (zoomed sections)=50 µm. (B) Immunohistochemistry of 5 µm thick sequential skin sections taken from the chronic wound areas from patients with chronic skin wounds (Patient 1, Patient 2, Patient 3, Patient 4). Sections were stained with pentachrome, integrin α11, VPS33B. Scale bars positioned in top left corner: black (unzoomed pentachrome)=100 µm, white (zoomed sections)=50 µm.
Figure 11
Proposed working model of collagen homeostasis in fibroblasts.
Endogenous collagen is either secreted as protomers (soluble secretion route, not circadian rhythmic) or made into fibrils (fibril assembly route, circadian rhythmic). Secreted collagen protomers can be captured by cells through endocytosis (circadian rhythmic) and recycled to make new fibrils. Integrin α11 and VPS33b direct collagen to fibril formation.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Rabbit polyclonal antibody (pAb) to collagen-I | Aviva Systems Biology | Cat# OARA02579, RRID:AB10873334 | 1:500 (WB) |
| Antibody | Rabbit polyclonal antibody (pAb) to collagen-I | Kerafast | Cat# ENH018 | 1:400 (IF) |
| Antibody | Mouse monoclonal antibody (mAb) to mouse vinculin | Sigma-Aldrich | Cat# V9131, RRID:AB_477629 | 1:1000 (WB) |
| Antibody | Rabbit polyclonal antibody (pAb) to mouse integrin α11 subunit | This paper | Generated from Donald Gullberg’s lab | 1:1000 (WB) |
| Antibody | Mouse monoclonal antibody (mAb) to mouse VPS33B | Proteintech | Cat# 12195-1-AP, RRID:AB_2215198 | 1:500 (WB) |
| Antibody | Rabbit polyclonal antibody (pAb) to mouse VIPAS | Proteintech | Cat# 20771-1-AP, RRID:AB_10695764 | 1:200 (IF) |
| Antibody | Mouse monoclonal antibody (mAb) to FN1 | Sigma-Aldrich | Cat# F6140, RRID:AB_476981 | 1:400 (IF) |
| Antibody | Mouse monoclonal antibody (mAb) to FN1 | Abcam | Cat# ab6328, RRID:AB_305428 | (Include dilution) |
| Antibody | Rabbit polyclonal antibody (pAb) to human VPS33B | Atlas antibodies | Cat# HPA040415, RRID:AB_10795419 | 1:200 (IHC) |
| Antibody | Mouse monoclonal antibody (mAb) integrin α11 210F4 | DOI: 10.1002/cjp2.148 | Generated from Donald Gullberg’s lab | 1:200 (IHC) |
| Antibody | Rabbit polyclonal antibody (pAb) to Collagen-I | Rockland Immunochemicals | 600-401-103.0.5, RRID:AB_217595 | 1:200 (IHC) |
| Antibody | IRDye 680RD Goat anti-Mouse IgG (H+L) | Li-Cor | Cat# 925-68070, RRID:AB_2651128 | 1:10,000 (WB) |
| Antibody | IRDye 800RD Goat anti-Rabbit IgG (H+L) | Li-Cor | Cat# 925-32211, RRID:AB_2651127 | 1:10,000 (WB) |
| Antibody | Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP | Thermo Fisher Scientific | Cat# 32430, RRID:AB_1185566 | 1:1000 (WB) |
| Antibody | Goat anti-Rabbit IgG (H+L) Secondary Antibody, HRP | Thermo Fisher Scientific | Cat# 32460, RRID:AB_1185567 | 1:1000 (WB) |
| Antibody | Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Cyanine3 | Thermo Fisher Scientific | Cat# A10520, RRID:AB_2534029 | 1:500 (WB) |
| Antibody | Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Cyanine5 | Thermo Fisher Scientific | Cat# A10523, RRID:AB_2534032 | 1:500 (WB) |
| Antibody | Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Cyanine3 | Thermo Fisher Scientific | Cat# A10521, RRID:AB_2534030 | 1:500 (WB) |
| Antibody | Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 | Thermo Fisher Scientific | Cat# A-21236, RRID:AB_2535805 | 1:500 (WB) |
| Antibody | Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Cat# A-11029, RRID:AB_2534088 | 1:500 (WB) |
| Antibody | Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Cat# A-11034, RRID:AB_2576217 | 1:500 (WB) |
| Recombinant DNA reagent | pLV-V5-VPS33B-GFP1-10 | This paper | N/A | pLV vector expressing VPS33b-GFP barrell. Available on request. |
| Recombinant DNA reagent | pLV-V5-VPS33B-BFP | This paper | N/A | pLV vector expressing VPS33B tagged with BFP at C terminus. Available on request. |
| Recombinant DNA reagent | pLV-V5-BFP-VPS33B | This paper | N/A | pLV vector expressing VPS33B tagged with BFP at N terminus. Available on request. |
| Recombinant DNA reagent | pCMV-SBP-GFP11-COL1A1 | This paper | N/A | pCMV vector expression COL1A1 tagged with GFP11. Available on request. |
| Recombinant DNA reagent | pcDNA3.1+/C-(K)-DYK | This paper | N/A | pcDMA3.1 vector expression for in vitro translation. Available on request. |
| Recombinant DNA reagent | pcDNA3.1-eGFP-Rab5 | This paper | N/A | pcDNA3.1 vector with Rab5 tagged with eGFP. Available on request. |
| Biological samples (human) | Human control lung tissues | Manchester University NHS Foundation Trust | NRES14/NW/0260 | Not available due to HTA restrictions |
| Biological samples (human) | Human IPF lung tissues | Manchester University NHS Foundation Trust | NRES14/NW/0260 | Not available due to HTA restrictions |
| Biological samples (human) | Human chronic skin wound tissue | Manchester University NHS Foundation Trust | NRES 18/NW/0847 | Not available due to HTA restrictions |
| Biological samples (human) | Human healthy skin wound tissue | Manchester University NHS Foundation Trust | NRES 18/NW/0847 | Not available due to HTA restrictions |
| Chemical compound, drug | Dyngo4a | Abcam | Ab120689 | |
| Chemical compound | TRIzol reagent | Invitrogen | 15596-018 | |
| Chemical compound | Rat tail collagen-I | Corning | 354259 | |
| Chemical compound | Oregon Green 488-Dextran, 70 kDa | Life Technologies | D7173 | |
| Chemical compound | Cy3 NHS Ester | Sigma | GEPA13101 | |
| Chemical compound | Cy5 NHS Ester | Sigma | GEPA15101 | |
| Recombinant protein | Recombinant S. pyogenes Cas9 nuclease protein | IDT | 1081059 | |
| Commercial assay or kit | Gibson Assembly Cloning kit | NEB | E5510S | |
| Commercial assay or kit | Site-Directed Mutagenesis QuikChange kit | Agilent | 200513 | |
| Commercial assay or kit | Novolink Polymer Detection Systems | Leica Biosystems | RE7270-RE | |
| Commercial assay or kit | Rabbit reticulocyte lysate, nuclease treated | Promega | L4960 | |
| Commercial assay or kit | TaqMan Reverse Transcription kit | Applied Biosystems | N8080234 | |
| Commercial assay or kit | SensiFASTSYBR No-ROX kit | Bioline | BIO-98005 | |
| Cell lines (mouse) | NIH3T3-Dendra2-ColI | This paper | N/A | Available on request |
| Cell lines (mouse) | Immortalized mouse tail tendon fibroblasts | This paper | N/A | Available on request |
| Cell lines (human) | Primary human IPF lung fibroblasts | University of Minnesota | N/A | Not available due to HTA restrictions |
| Cell lines (human) | Primary human control lung fibroblasts | University of Minnesota | N/A | Not available due to HTA restrictions |
| Cell lines (human) | HEK293T | This paper | N/A | Available on request |
| Genetic reagent (mouse) | siCol1a1, Mission esiRNA | Merck | EMU069551 | |
| Genetic reagent (mouse) | siItga11, Mission esiRNA | Merck | EMU042761 | |
| Genetic reagent (human) | siITGA11, Mission esiRNA | Merck | EHU145321 | |
| Genetic reagent (mouse) | VPS33B mouse cDNA | GenScript | Omu07060D | |
| Genetic reagent (mouse) | Sec61β modified with a C-terminal OPG2 tag | This paper | N/A | Available on request from Sarah O’Keefe/Steve High |
| Genetic reagent (mouse) | VPS33B A-606-T | This paper | N/A | Available on request from Sarah O’Keefe/Steve High |
| Genetic reagent (mouse) | VPS33B-OPG2 | This paper | N/A | Available on request from Sarah O’Keefe/Steve High |
| Genetic reagent (mouse) | VPS33B-Sec61βTMD | This paper | N/A | Available on request from Sarah O’Keefe/Steve High |
| Genetic reagent (mouse) | VPS33B-Sec61βTMD-OPG2 | This paper | N/A | Available on request from Sarah O’Keefe/Steve High |
| Software, algorithm | Fiji ImageJ | doi:10.1038/nmeth.2019 | https://imagej.net/software/fiji/ | |
| Software, algorithm | MetaCycle | doi:10.1093/bioinformatics/btw405, Version: 1.2.0 | https://github.com/gangwug/MetaCycle; Wu, 2022 | |
| Software, algorithm | Scaffold Proteome Software | doi:10.1002/pmic.200900437 | https://www.proteomesoftware.com/products | |
| Software, algorithm | GraphPad Prism 8 | https://www.graphpad.com/scientific-software/prism/ | https://www.graphpad.com/scientific-software/prism/ | |
| Sequence-based reagent | VPS33B A-606-T | This paper | N/A | Site-directed mutagenesis of VPS33B (then cloned into pcDNA3.1+/ C-(K)-DYK) Forward: ACTGCTGTTACAAACAGTACCCGCCTCATGGAAGCC Reverse: GGCTTCCATGAGGCGGGTACTGTTTGTAACAGCAGT |
| Sequence-based reagent | VPS33B-OPG2 | This paper | N/A | Site-directed mutagenesis of VPS33B (then cloned into pcDNA3.1+/C- (K)-DYK) Forward: GCCAACGGAACAGAAGGACCAAACTTCTACGTACCATTCAGCAACAAAACAGGCTAATCCGATTACAAGGATGACGAC Reverse: CTATTAGCCTGTTTTGTTGCTGAATGGTACGTAGAAGTTTGGTCCTTCTGTTCCGTTGGATTTCACCTCACTCATGGCTTC |
| Sequence-based reagent | VPS33B-Sec61βTMD | This paper | N/A | Site-directed mutagenesis of VPS33B (then cloned into pcDNA3.1+/ C-(K)-DYK) Forward: GTATTGGTTATGTGTCTTCTGTTCATCGCTTCTGTATTTATGTTGCACATTTGGGGCAAGTACACTCGTTCGTAGCTGCGCCTCATCTTGGTGGTGTTCC Reverse: CTACGAACGAGTGTACTTGCCCCAAATGTGCAACATAAATACAGAAGCGATGAACAGAAGACACATAACCAATACTGACTCACTGGAAGCCTTGTCTTCC |
| Sequence-based reagent | VPS33B-Sec61βTMD-OPG2 | This paper | N/A | Site-directed mutagenesis of VPS33B (then cloned into pcDNA3.1+/C-(K)- DYK) Forward: AACGGAACAGAAGGACCAAACTTCTACGTACCATTCAGCAACAAAACAGGCTAATAGCTGCGCCTCATCTTGGTGGTGTTCCTG Reverse: CTATTAGCCTGTTTTGTTGCTGAATGGTACGTAGAAGTTTGGTCCTTCTGTTCCGTTCGAACGAGTGTACTTGCCCCAAATGTGCAAC |
| Sequence-based reagent | 414-564-5M | This paper | N/A | For PCRs to create transcription templates Forward: GCCAACGGAACAGAAGGACCAAACTTCTACGTACCATTCAGCAACAAAACAGGCTAATCCGATTACAAGGATGACGAC Reverse: CTACATCATCATCATCATTGACTCACTGGAAGCCTTGTC |
| Sequence-based reagent | 414-587-5M | This paper | N/A | For PCRs to create transcription templates Forward: GCCAACGGAACAGAAGGACCAAACTTCTACGTACCATTCAGCAACAAAACAGGCTAATCCGATTACAAGGATGACGAC Reverse: CTACATCATCATCATCATCAGGAAGCGCAGGGCTGATAT |
| Sequence-based reagent | 414-FL-5M | This paper | N/A | Forward: GCCAACGGAACAGAAGGACCAAACTTCTACGTACCATTCAGCAACAAAACAGGCTAATCCGATTACAAGGATGACGAC Reverse: CTACATCATCATCATCATGGATTTCACCTCACTCATGGCTTC |
| Sequence-based reagent | 414-N603-FL-5M | This paper | N/A | For PCRs to create transcription templates Forward: GCCAACGGAACAGAAGGACCAAACTTCTACGTACCATTCAGCAACAAAACAGGCTAATCCGATTACAAGGATGACGAC Reverse: CTACATCATCATCATCATGGATTTCACCTCACTCATGGCTTC |
| Sequence-based reagent | 414-FL-OPG2-5M | This paper | N/A | Forward: GCCAACGGAACAGAAGGACCAAACTTCTACGTACCATTCAGCAACAAAACAGGCTAATCCGATTACAAGGATGACGAC Reverse: CTACATCATCATCATCATGCCTGTTTTGTTGCTGAATGGTACGTAGAAGTTTGGTCCTTCTGTTCCGTT |
| Sequence-based reagent | 1-564-5M | This paper | N/A | For PCRs to create transcription templates Forward: CGCAAATGGGCGGTAGGCGTG Reverse: CTACATCATCATCATCATTGACTCACTGGAAGCCTTGTC |
| Sequence-based reagent | 1-587-5M | This paper | N/A | Forward: CGCAAATGGGCGGTAGGCGTG Reverse: CTACATCATCATCATCATCAGGAAGCGCAGGGCTGATAT |
| Sequence-based reagent | 1-FL-5M | This paper | N/A | For PCRs to create transcription templates Forward: CGCAAATGGGCGGTAGGCGTG Reverse: CTACATCATCATCATCATGGATTTCACCTCACTCATGGCTTC |
| Sequence-based reagent | 1-N603-5M | This paper | N/A | For PCRs to create transcription templates Forward: CGCAAATGGGCGGTAGGCGTG Reverse: CTACATCATCATCATCATGGATTTCACCTCACTCATGGCTTC |
| Sequence-based reagent | 1-FL-OPG2-5M | This paper | N/A | For PCRs to create transcription templates Forward: CGCAAATGGGCGGTAGGCGTG Reverse: CTACATCATCATCATCATGCCTGTTTTGTTGCTGAATGGTACGTAGAAGTTTGGTCCTTCTGTTCCGTT |
| Sequence-based reagent | msCol1a1 | This paper | N/A | Primers for qPCRs (ms – mouse, hu – human) Forward: AGAGCATGACCGATGGATTC Reverse: AGGCCTCGGTGGACA |
| Sequence-based reagent | msItga11 | This paper | N/A | Forward: AGATGTCGCAGACTGGCTTT Reverse: CCCTAGGTATGCTGCATGGT |
| Sequence-based reagent | msRplp0 | This paper | N/A | Primers for qPCRs (ms – mouse, hu – human) Forward: ACTGGTCTAGGACCCGAGAAG Reverse: CTCCCACCTTGTCTCCAGTC |
| Sequence-based reagent | msGapdh | This paper | N/A | Forward: CAGCCTCGTCCCGTAGACAA Reverse: CAATCTCCACTTTGCCACTGC |
| Sequence-based reagent | msVPS33B | This paper | N/A | Primers for qPCRs (ms – mouse, hu – human) Forward: GCATTCACAGACACGGCTAAG Reverse: ACACCACCAAGATGAGGCG |
| Sequence-based reagent | huCOL1A1 | This paper | N/A | Forward: GGGATTCCCTGGACCTAAAG Reverse: GGAACACCTCGCTCTCCA |
| Sequence-based reagent | huGAPDH | This paper | N/A | Primers for qPCRs (ms – mouse, hu – human) Forward: GAGTCAACGGATTTGGTCGT Reverse: GACAAGCTTCCCGTTCTCAG |
| Sequence-based reagent | huACTB | This paper | N/A | Forward: GATCATTGCTCCTCCTGAGC Reverse: AAAGCCATGCCAATCTCATC |
| Sequence-based reagent | huITGA11 | This paper | N/A | Primers for qPCRs (ms – mouse, hu – human) Forward: CACGACATCAGTGGCAATAAG Reverse: GACCCTTCCCAGGTTGAGTT |
| Sequence-based reagent | huVPS33B | This paper | N/A | Primers for qPCRs (ms – mouse, hu – human) Forward: GAGCTGCCTGACTTCTCCAT Reverse: GCTTGTCTACTTCGTGTTGCTG |
Additional files
-
Supplementary file 1
Excel spreadsheet of proteins identified in total lysates, report from Proteome Discoverer.
- https://cdn.elifesciences.org/articles/95842/elife-95842-supp1-v1.xlsx
-
Supplementary file 2
Excel spreadsheet of proteins identified in biotin-enriched samples, exported from Proteome Discoverer.
- https://cdn.elifesciences.org/articles/95842/elife-95842-supp2-v1.xlsx
-
Supplementary file 3
Excel spreadsheet of proteins quantified through spectral counting between control, VPSko and VPSoe biotin-enriched samples, report from Proteome Discoverer.
Presented in quantitative value as normalized to total spectra. Gene names of proteins detected shown here.
- https://cdn.elifesciences.org/articles/95842/elife-95842-supp3-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/95842/elife-95842-mdarchecklist1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Endocytic recycling is central to circadian collagen fibrillogenesis and disrupted in fibrosis
eLife 13:RP95842.
https://doi.org/10.7554/eLife.95842.3
