Atoh1 is required for the formation of lateral line electroreceptors and hair cells, whereas FoxG1 represses an electrosensory fate
- Department of Physiology, Development & Neuroscience, University of Cambridge, United Kingdom
- Faculty of Fisheries and Protection of Waters, Research Institute of Fish Culture and Hydrobiology, University of South Bohemia in České Budějovice, Czech Republic
Figures
Figure 1 with 2 supplements
Wild-type gene expression patterns within late-larval sterlet lateral line organs.
Detailed descriptions of the sterlet gene expression patterns shown for reference in this figure, including at earlier stages of lateral line development, have been published (Minařík et al., 2024), except for Neurod4. Sterlet are shown at late yolk-sac larval stages. Black arrowheads indicate examples of neuromasts; white arrowheads indicate examples of ampullary organs. (A, B) Immunostaining for the supporting cell marker Sox2 at stage 45 shows strong expression in neuromasts and much weaker expression in ampullary organs. Sox2 is also expressed in the nares, retina, and taste buds on the barbels and around the mouth. (C, D) In situ hybridisation (ISH) for the hair cell and electroreceptor marker Cacna1d at stage 45 shows expression in neuromasts and ampullary organs. Much weaker Cacna1d expression is seen in taste buds on the barbels; this is not always detectable. (E, F) ISH for the electroreceptor marker Kcnab3 at stage 45 shows expression in ampullary organs only. (G, H) ISH for Atoh1 at stage 42 shows expression in ampullary organs and, more weakly, in neuromasts. (I, J) ISH for Neurod4 at stage 45 shows expression in ampullary organs but not neuromasts. Neurod4 expression is also seen in taste buds on the barbels. (K, L) ISH for Foxg1 at stage 45 shows expression is restricted to neuromast lines, though excluded from the centres of neuromasts where hair cells form (compare with Sox2 expression in supporting cells in panel B, and with Cacna1d expression in hair cells in panel D). Foxg1 expression is also seen in the nares. Abbreviations: b, barbel; di, dorsal infraorbital ampullary organ field; e, eye; n, naris; vi, ventral infraorbital ampullary organ field. Scale bar: 200 μm.
Figure 1—figure supplement 1
Examples of successful disruption of sterlet Neurod4 by CRISPR/Cas9-mediated mutagenesis in G0-injected embryos.
(A) Schematic showing the exon structure (coding exons only) of the sterlet Neurod4 gene relative to conserved domains and the target sites of Neurod4 sgRNAs (Table 1). (B–D) Sterlet crispants at stage 45 after in situ hybridisation for the electroreceptor marker Kcnab3. In comparison to the Tyr control crispant (B), the two Neurod4 crispants (C, D) show no phenotype. Crispant #033 (C) was targeted with Neurod4 sgRNAs 3, 4, 5, and 6 (see panel A and Table 1). Crispant #101 (D) was targeted with Neurod4 sgRNAs 7, 8, and 9 (see panel A and Table 1). (E–I) Outputs from Synthego’s ‘Inference of CRISPR Edits’ (ICE) tool (Conant et al., 2022) applied to Sanger sequence data for the targeted region of genomic DNA extracted from the trunk/tail of each of the Neurod4 crispants shown in panel C and panel D. For crispant #033, the ICE outputs are shown only for Neurod4 sgRNAs 4 and 5 (see panel A and Table 1). ‘Indel %’ (E) shows the percentage of insertions and/or deletions among the inferred sequences in the CRISPR-edited population. ‘Knockout-Score’ (E) indicates the proportion of indels that introduce a frameshift or are at least 21 bp long. Discordance plots (F, G) show the level of discordance between the edited sample Sanger trace file (green) and the control sample trace file (orange). Vertical dotted lines indicate the expected cut sites for the sgRNAs. The increase in discordance near the expected cut site indicates a successful CRISPR edit. Nucleotide sequences from the Sanger trace files and their inferred relative contributions to the edited mosaic population are shown in panel H and panel I. The expected cut sites are represented by vertical dotted lines. The wild-type sequence (0) is marked by an orange ‘+’ symbol in panel H, but is absent in panel I because 100% of the sequence was edited in this crispant. Abbreviations: e, eye; n, naris. Scale bar: 200 μm.
Figure 1—figure supplement 2
Expression of Neurod family genes in late-larval sterlet lateral line organs.
In situ hybridisation in sterlet at stage 45. Black arrowheads indicate examples of neuromasts; white arrowheads indicate examples of ampullary organs. (A, B) Neurod4 is expressed in ampullary organs only. (C, D) Neurod1 is expressed in ampullary organs and neuromasts (and gill filaments; white asterisk). (E, F) No expression was detected in lateral line organs for Neurod2, although expression can be seen in gill filaments (white asterisk). (G, H) Neurod6 is expressed in ampullary organs and neuromasts (and gill filaments; white asterisk). Abbreviations: di, dorsal infraorbital ampullary organ field; e, eye; n, naris; vi, ventral infraorbital ampullary organ field. Scale bar: 200 μm.
Figure 2
Examples of successful disruption of sterlet tyrosinase by CRISPR/Cas9-mediated mutagenesis in G0-injected embryos.
(A) Schematic showing the exon structure (coding exons only) of the sterlet tyrosinase (Tyr) gene relative to conserved domains and the target sites of Tyr sgRNAs (Table 1). (B) Dorsal view of an Atoh1 crispant at stage 45 as a control (Atoh1 is not involved in melanin synthesis). Pigmented melanocytes are visible, particularly around the brain, and the eyes are fully pigmented. (C, D) Examples of Tyr crispants at stage 45 (both targeted with Tyr sgRNAs 1 and 2; see panel A and Table 1) with different degrees of pigment loss (compare with panel B). In both Tyr crispants, significantly fewer melanocytes are visible and the eyes show mosaic loss of pigment. The phenotype is stronger on the right side in both crispants, and stronger in crispant #101 (D) than in crispant #61 (C). (E–I) Outputs from Synthego’s ‘Inference of CRISPR Edits’ (ICE) tool (Conant et al., 2022) applied to Sanger sequence data for the targeted region of genomic DNA extracted from the trunk/tail of each of the Tyr crispants shown in panel C and panel D. ‘Indel %’ (E) shows the percentage of insertions and/or deletions among the inferred sequences in the CRISPR-edited population. ‘Knockout-Score’ (E) indicates the proportion of indels that introduce a frameshift or are at least 21 bp long. Discordance plots (F, G) show the level of discordance between the edited sample Sanger trace file (green) and the control sample trace file (orange). Vertical dotted lines indicate the expected cut sites for the sgRNAs. The increase in discordance near the expected cut site indicates a successful CRISPR edit. Nucleotide sequences from the Sanger trace files and their inferred relative contributions to the edited mosaic population are shown in panel H and panel I. The expected cut sites are represented by vertical dotted lines. The wild-type sequence (0) is marked by an orange ‘+’ symbol in panel H, but is absent in panel I because 100% of the sequence was edited in this crispant. Abbreviations: e, eye; n, naris. Scale bar: 200 μm.
Figure 3 with 2 supplements
Atoh1 is required for the differentiation of lateral line hair cells and electroreceptors.
Sterlet crispants at stage 45 after in situ hybridisation (ISH) for the hair cell and electroreceptor marker Cacna1d, or the electroreceptor-specific marker Kcnab3. Black arrowheads indicate examples of neuromasts; white arrowheads indicate examples of ampullary organs. (A–D) In a control Tyr crispant, Cacna1d expression shows the normal distribution of hair cells in lines of neuromasts, and electroreceptors in fields of ampullary organs flanking the neuromast lines (lateral view: A, B; ventral view: C, D). (E–J) In an Atoh1 crispant (from a different batch to the Tyr crispant shown in A–D), Cacna1d expression is absent on the left side of the head (E, F), except for a few isolated organs in the otic region and on the operculum. Post-ISH Sox2 immunostaining (E1, F1) shows that neuromast supporting cells are still present; however, the signal is too weak to show ampullary organs. A ventral view (G, H) and a lateral view of the right side of the head (I, J; image flipped horizontally for ease of comparison) reveal a unilateral phenotype, with Cacna1d-expressing hair cells and electroreceptors mostly absent from the left side only of the ventral rostrum (asterisk in G, H) and present on the right side of the head (I, J). (K, L) Lateral view of a control Tyr crispant after ISH for Kcnab3, showing the position of electroreceptors in ampullary organs. (M, N) Ventral view of another Tyr crispant showing Kcnab3 expression in ampullary organs. (O–P1) Lateral view of an Atoh1 crispant in which Kcnab3 expression is absent from ampullary organs. Post-ISH Sox2 immunostaining (O1, P1) shows that supporting cells are still present in neuromasts (strong staining) and can also be detected in ampullary organs (much weaker staining). (Q–T) A different Atoh1 crispant after ISH for Kcnab3, shown in ventral view (Q, R: compare with M, N) and lateral view (S, T). Kcnab3 expression reveals a unilateral phenotype: Kcnab3-expressing electroreceptors are mostly absent from the right side (asterisk) but present on the left side. (U–X) Schematic representation of cranial lateral line organs in a stage 45 control Tyr crispant (lateral view, U; ventral view, W) versus a severe Atoh1 crispant in which supporting cells (grey outlines) are present but all hair cells and electroreceptors are missing (lateral view, V; ventral view, X). Abbreviations: app, anterior preopercular ampullary organ field; b, barbel; di, dorsal infraorbital ampullary organ field; dot, dorsal otic ampullary organ field; ds, dorsal supraorbital ampullary organ field; e, eye; m, mouth; n, naris; o, otic capsule; ppp, posterior preopercular ampullary organ field; st, supratemporal ampullary organ field; vi, ventral infraorbital ampullary organ field; vs, ventral supraorbital ampullary organ field. Scale bars: 200 μm.
Figure 3—figure supplement 1
Examples of successful disruption of sterlet Atoh1 by CRISPR/Cas9-mediated mutagenesis in G0-injected embryos.
(A) Schematic showing the exon structure (coding exons only) of the sterlet Atoh1 gene relative to conserved domains and the target sites of Atoh1 sgRNAs (Table 1). (B–D) Sterlet crispants at stage 45 after in situ hybridisation for the hair cell and electroreceptor marker Cacna1d, which is also weakly expressed by taste buds on the barbels (insets show higher power views). In comparison to the Tyr control crispant (B), the two Atoh1 crispants (C, D: both targeted with Atoh1 sgRNAs 1 and 2; see panel A and Table 1) have lost Cacna1d expression in neuromasts and ampullary organs, whereas tastebud expression is unaffected (insets). Crispant #105 (C) retains mosaic Cacna1d expression in dorsal neuromast lines and a cluster of ampullary organs at the tip of the rostrum. Crispant #197 (D) shows complete loss of Cacna1d expression in neuromasts and ampullary organs. (E–I) Outputs from Synthego’s ‘Inference of CRISPR Edits’ (ICE) tool (Conant et al., 2022) applied to Sanger sequence data for the targeted region of genomic DNA (chromosome 1 ohnolog) extracted from the trunk/tail of each of the Atoh1 crispants shown in panel C and panel D. ‘Indel %’ (E) shows the percentage of insertions and/or deletions among the inferred sequences in the CRISPR-edited population. ‘Knockout-Score’ (E) indicates the proportion of indels that introduce a frameshift or are at least 21 bp long. Discordance plots (F, G) show the level of discordance between the edited sample Sanger trace file (green) and the control sample trace file (orange). Vertical dotted lines indicate the expected cut sites for the sgRNAs. The increase in discordance near the expected cut site indicates a successful CRISPR edit. Nucleotide sequences from the Sanger trace files and their inferred relative contributions to the edited mosaic population are shown in panel H and panel I. The expected cut sites are represented by vertical dotted lines. The wild-type sequence (0) is marked by an orange ‘+’ symbol in panel H, but is absent in panel I because 100% of the sequence was edited in this crispant. Abbreviations: b, barbel; e, eye; n, naris. Scale bar: 200 μm.
Figure 3—figure supplement 2
Examples of different phenotypes in Atoh1 crispants.
Sterlet crispants at stage 45 after in situ hybridisation (ISH) for the hair cell/electroreceptor marker Cacna1d or the electroreceptor-specific marker Kcnab3. Black arrowheads indicate examples of neuromasts; white arrowheads indicate examples of ampullary organs. (A–F) The same Atoh1 crispant as in Figure 3E–J. On the left side (A–C), Sox2 immunostaining after ISH for Cacna1d shows supporting cells in neuromast lines (A, B). The same region imaged before the immunostaining (B1) shows almost complete absence of Cacna1d-expressing hair cells in neuromasts and electroreceptors in ampullary organs. In a skin mount from this region (C; location indicated by boxes in B, B1), very faint Cacna1d signal (arrows) can only be detected in a presumed ampullary organ to the left of the neuromasts (white arrowhead) and in the more ventral of the two neuromasts (black arrowhead). Sox2 signal (black dots) reveals the two neuromasts, but not ampullary organs, consistent with post-ISH Sox2 immunostaining being much stronger in neuromasts and weaker or even undetectable in ampullary organs. On the right side of the same crispant (D–F; images flipped horizontally for better comparison with A–C), only a mild phenotype is observed, with many Cacna1d-positive hair cells/electroreceptors seen in neuromasts as well as ampullary organs (E1). In a skin mount from this region (F; location indicated by boxes in E, E1), strong Sox2 signal (black dots) is seen in supporting cells of neuromasts, surrounding Cacna1d-positive hair cells (black arrowheads). Sox2 signal, though messier, is also seen around Cacna1d-positive electroreceptors in some ampullary organs (white arrowheads). (G–H1) An Atoh1 crispant after ISH for electroreceptor-specific Kcnab3. Post-ISH Sox2 immunostaining shows supporting cells in neuromast lines and, more weakly, in ampullary organs (G, H). The same crispant imaged before the immunostaining (G1, H1) shows almost complete absence of Kcnab3-expressing electroreceptors in ampullary organs (white arrowheads highlight barely detectable Kcnab3 expression in two ampullary organs). (I) Control Tyr crispant showing normal Cacna1d expression in neuromasts and ampullary organs, with the different ampullary organ fields labelled. (J–L) Examples of Atoh1 crispants showing differing degrees of mosaic absence of Cacna1d-positive hair cells/electroreceptors, classed as mild (J), moderate (K), and severe (L). The affected regions are highlighted by labelling the relevant ampullary organ field(s) in blue font (compare with panel I). Abbreviations: app, anterior preopercular ampullary organ field; di, dorsal infraorbital ampullary organ field; dot, dorsal otic ampullary organ field; ds, dorsal supraorbital ampullary organ field; e, eye; n, naris; ppp, posterior preopercular ampullary organ field; st, supratemporal ampullary organ field; vi, ventral infraorbital ampullary organ field; vs, ventral supraorbital ampullary organ field. Scale bars: A–B1, D–E1, G–J, 200 μm; C, F, 50 μm.
Figure 4
Atoh1 is required for Pou4f3 and Gfi1 expression in ampullary organs and neuromasts.
Sterlet crispants at stage 45 after in situ hybridisation (ISH) for transcription factor genes expressed by developing hair cells. Black arrowheads indicate examples of neuromasts; white arrowheads indicate examples of ampullary organs. (A, B) In a control Tyr crispant, Pou4f3 expression is detected in both neuromasts and ampullary organs. (C–D1) In an Atoh1 crispant, Pou4f3 expression is absent from both neuromasts and ampullary organs, except for a few isolated organs in the postorbital region. Post-ISH Sox2 immunostaining (C1, D1) shows that neuromast supporting cells are still present. Most ampullary organs are not visible as Sox2 expression in ampullary organs is significantly weaker than in neuromasts (Figure 1A,B) and often not detectable after post-ISH immunostaining. (E, F) In a control Tyr crispant, Gfi1 expression is detected in both neuromasts and ampullary organs. (G–H1) In an Atoh1 crispant, Gfi1 expression is absent from both neuromasts and ampullary organs, except for a few isolated organs in the supra- and infraorbital region. Post-ISH Sox2 immunostaining (G1, H1) shows that neuromast supporting cells are still present. (Most ampullary organs are not visible due to weaker Sox2 immunostaining.) Abbreviations: b, barbel; di, dorsal infraorbital ampullary organ field; e, eye; n, naris; vi, ventral infraorbital ampullary organ field. Scale bars: 200 μm.
Figure 5 with 1 supplement
Neuromast lines in Foxg1 crispants are disrupted by putative ampullary organs.
Sterlet crispants at stage 45 after in situ hybridisation (ISH) for the hair cell and electroreceptor marker Cacna1d. Black arrowheads indicate examples of neuromasts; white arrowheads indicate examples of ampullary organs. (A, B) Lateral view of a control Tyr crispant. Cacna1d expression shows the normal distribution of hair cells and electroreceptors. Note that ampullary organs have significantly more Cacna1d-expressing receptor cells than neuromasts. (C, D) Ventral view of a second control Tyr crispant. Cacna1d expression reveals the infraorbital neuromast line on both sides of the ventral rostrum, flanked by the dorsal infraorbital (di) and ventral infraorbital (vi) ampullary organ fields. (E, F) Lateral view of a Foxg1 crispant. Cacna1d expression reveals that distinct neuromast lines are missing and the corresponding space is filled by putative ectopic ampullary organs, based on the large, ampullary organ-like clusters of Cacna1d-expressing cells. The dorsal and ventral infraorbital ampullary organ fields seem to have fused across the missing neuromast line (compare with A, B). (G, H) Ventral view of a second Foxg1 crispant. Cacna1d expression reveals an apparent fusion of the dorsal infraorbital (di) and ventral infraorbital (vi) ampullary organ fields across the missing infraorbital neuromast lines on both sides (compare with C, D). (I–L) In a third Foxg1 crispant, Cacna1d expression on the left side (I, J) shows that distinct supraorbital and infraorbital neuromast lines are still present. However, some organs within the supraorbital line and most organs within the infraorbital line have large clusters of Cacna1d-expressing cells, suggesting they are ectopic ampullary organs (green arrowheads in panel J show examples). On the right side (K, L; image flipped horizontally for ease of comparison), this phenotype is not seen. Abbreviations: b, barbel; di, dorsal infraorbital ampullary organ field; di/vi, fused dorsal infraorbital and ventral infraorbital ampullary organ fields; e, eye; m, mouth; n, naris; vi, ventral infraorbital ampullary organ field. Scale bars: 200 μm.
Figure 5—figure supplement 1
Examples of successful disruption of sterlet Foxg1 by CRISPR/Cas9-mediated mutagenesis in G0-injected embryos.
(A) Schematic showing the exon structure (coding exons only) of the sterlet Foxg1 gene relative to conserved domains and the target sites of Foxg1 sgRNAs (Table 1). (B–D) Sterlet crispants at stage 45 after in situ hybridisation for the hair cell and electroreceptor marker Cacna1d. In comparison to the Tyr control crispant (B), the two Foxg1 crispants (C, D: both targeted with Foxg1 sgRNAs 1 and 2; see panel A and Table 1) have larger clusters of Cacna1d-expressing cells present within neuromast lines than expected for neuromasts, suggesting ectopic ampullary organs (green arrowheads indicate examples). In crispant #001 (D), the infraorbital neuromast line is missing and the ampullary organ fields have fused across it (compare with B and C). (Note: the image in panel C is also shown in Figure 5I; a ventral view of the crispant in panel D is shown in Figure 5G.) (E–I) Outputs from Synthego’s ‘Inference of CRISPR Edits’ (ICE) tool (Conant et al., 2022) applied to Sanger sequence data for the targeted region of genomic DNA extracted from the trunk/tail of each of the Foxg1 crispants shown in panel C and panel D. ‘Indel %’ (E) shows the percentage of insertions and/or deletions among the inferred sequences in the CRISPR-edited population. ‘Knockout-Score’ (E) indicates the proportion of indels that introduce a frameshift or are at least 21 bp long. Discordance plots (F, G) show the level of discordance between the edited sample Sanger trace file (green) and the control sample trace file (orange). Vertical dotted lines indicate the expected cut sites for the sgRNAs. The increase in discordance near the expected cut site indicates a successful CRISPR edit. Nucleotide sequences inferred from the Sanger trace files and their relative contributions to the edited mosaic population are shown in panel H and panel I. The expected cut sites are represented by vertical dotted lines. The wild-type sequence (0) is marked by an orange ‘+’ symbol in panel H, but is absent in panel I because 100% of the sequence was edited in this crispant. Abbreviations: e, eye; n, naris. Scale bar: 200 μm.
Figure 6
Neuromast lines in Foxg1 crispants are disrupted by ectopic ampullary organs and missing neuromasts.
Sterlet crispants at stage 45 after in situ hybridisation (ISH) for the electroreceptor-specific marker Kcnab3. White arrowheads indicate examples of ampullary organs. (A–D) A control Tyr crispant (A) and three Foxg1 crispants (B–D) after post-ISH Sox2 immunostaining. Black asterisk indicates the spiracular opening (first pharyngeal cleft). (E–L) Higher-power views of individual neuromast lines (outlined with dashed lines) from the Tyr control (E, G ,I ,K) and Foxg1 crispants (F, H, J, L) after post-ISH Sox2 immunostaining (locations indicated by boxes on panels A–D). Comparing the Tyr control and Foxg1 crispants shows ectopic ampullary organs (green arrowheads) and gaps (where neuromasts are missing) disrupting the supraorbital line (E, F), infraorbital line (G, H), and otic line (I, J), and ectopic ampullary organs disrupting the preopercular line (K, L). (E1–L1) The same areas shown before Sox2 immunostaining. Electroreceptor-specific Kcnab3 expression shows the distribution of ampullary organs only. (M, N) Ventral view of the same control Tyr crispant as in panel A, before Sox2 immunostaining. Kcnab3 expression shows the distribution of ampullary organ fields. Note the lack of staining where the infraorbital neuromast lines run on either side of the ventral rostrum, flanked by the dorsal infraorbital (di) and ventral infraorbital (vi) ampullary organ fields (compare with Cacna1d expression in Figure 2C,D). (O, P) Ventral view of a fourth Foxg1 crispant. On the left side, ectopic Kcnab3-expressing electroreceptors fill the space where the left infraorbital neuromast line would normally run, such that the dorsal and ventral infraorbital ampullary organ fields seem to have fused (compare with M, N). (Q–T) Schematic representation of cranial lateral line organs in a stage 45 control Tyr crispant (lateral view, Q; ventral view, S) versus a Foxg1 crispant in which the pre-otic neuromast lines are disrupted by ectopic ampullary organs or, as shown for the otic line, gaps where neuromasts are missing (lateral view, R; ventral view, T). Abbreviations: app, anterior preopercular ampullary organ field; b, barbel; di, dorsal infraorbital ampullary organ field; di/vi, fused dorsal infraorbital and ventral infraorbital ampullary organ fields; dot, dorsal otic ampullary organ field; ds, dorsal supraorbital ampullary organ field; e, eye; io, infraorbital neuromast line; m, mouth; n, naris; o, otic capsule; ol, otic neuromast line; pop, preopercular neuromast line; ppp, posterior preopercular ampullary organ field; so, supraorbital neuromast line; st, supratemporal ampullary organ field; vi, ventral infraorbital ampullary organ field; vs, ventral supraorbital ampullary organ field. Scale bars: 200 μm.
Figure 7 with 1 supplement
Ectopic ampullary organs in Foxg1 crispants express ampullary organ-specific transcription factor genes Mafa and Neurod4.
Sterlet crispants at stage 45 after in situ hybridisation (ISH) for ampullary organ-restricted transcription factor genes. Black arrowheads indicate examples of neuromasts; white arrowheads indicate examples of ampullary organs. (A–D) In an uninjected sibling/half-sibling (eggs were fertilised in vitro with a mix of sperm from three different males), Mafa expression is restricted to ampullary organs (lateral view: A, B; ventral view: C, D). (E–J) A Foxg1 crispant. On the left side of the head (E, F), several Mafa-expressing ectopic ampullary organs are present in the space where the infraorbital neuromast line would normally run, such that the dorsal and ventral infraorbital ampullary organ fields seem to have fused (compare with A, B). Post-ISH Sox2 immunostaining (E1, F1) shows that neuromasts are still present both proximally and distally to the sites of ampullary organ field fusion. In ventral view (G, H), ectopic ampullary organs (green arrowheads) are seen bilaterally, within the spaces where the infraorbital neuromast lines run on either side of the ventral rostrum (compare with C, D). On the right side in lateral view (I, J; image flipped horizontally for ease of comparison), a single Mafa-expressing ectopic ampullary organ (green arrowhead) is also present in the space where the infraorbital neuromast line runs (compare with A, B). (K–N) In an uninjected sibling/half-sibling, Neurod4 expression is restricted to ampullary organs (lateral view: K, L; ventral view: M, N). (O–T) A Foxg1 crispant. On the left side of the head (O, P), Neurod4-expressing ectopic ampullary organs are present in the space where the infraorbital neuromast line would normally run, such that the dorsal and ventral infraorbital ampullary organ fields seem to have fused (compare with K, L). Post-ISH Sox2 immunostaining (O1, P1) suggests that neuromasts are absent from the site of infraorbital ampullary organ field fusion, although neuromasts can be seen in the preopercular and trunk lines (black arrowheads, compare with O, P). In ventral view (Q, R), ectopic Neurod4-expressing ampullary organs are seen where the right infraorbital neuromast line would normally run on the ventral rostrum (green arrowhead indicates an example), resulting in partial fusion of the dorsal and ventral infraorbital fields on this side (the left side is unaffected). On the right side in lateral view (S, T; image flipped horizontally for ease of comparison), ectopic ampullary organs are also present in the space where the infraorbital neuromast line runs (green arrowhead in panel T indicates an example), resulting in the apparent partial fusion of the dorsal and ventral infraorbital ampullary organ fields (compare with K, L). Abbreviations: b, barbel; di, dorsal infraorbital ampullary organ field; di/vi, fused dorsal infraorbital and ventral infraorbital ampullary organ fields; e, eye; m, mouth; n, naris; vi, ventral infraorbital ampullary organ field. Scale bars: 200 μm.
Figure 7—figure supplement 1
Foxg1 crispant phenotypes include ectopic ampullary organs within neuromast lines.
In situ hybridisation (ISH) in sterlet Foxg1 crispants at stage 45. Black arrowheads indicate examples of neuromasts; white arrowheads indicate examples of ampullary organs; green arrowheads indicate examples of ectopic ampullary organs that interrupt a neuromast line. (A–D) The same Foxg1 crispant shown in Figure 5I–L after ISH for the hair cell/electroreceptor marker Cacna1d and post-ISH immunostaining for the supporting cell marker Sox2. On the left side (A, B), putative ectopic ampullary organs disrupt the infraorbital neuromast line. In a skin mount from this region (B; location indicated by box in A), three ectopic ampullary organs are seen as large clusters of Cacna1d-positive cells associated with above-background Sox2 signal (black dots), which also labels the Cacna1d-negative periphery of the organs. The left and middle ectopic organs are irregularly shaped; the middle and right ectopic organs are separated by skin lacking Sox2 signal. Compare with the unaffected right side of the same crispant in panel C (image flipped horizontally for ease of comparison) and in a skin mount from the equivalent region (D; location indicated by boxed region in C), showing two neuromasts in the infraorbital line and two ampullary organs in the dorsal infraorbital field. The two ampullary organs are associated with some Sox2 signal (though less obviously than the neuromasts) and are separated by skin lacking above-background Sox2 signal. (E–G) A Foxg1 crispant after ISH for the electroreceptor-specific marker Mafa. Following post-ISH Sox2 immunostaining (E, F), which was unusually strong in this crispant, a higher-power view (F) of the boxed region in panel E shows that the infraorbital neuromast line can be identified by Sox2 expression at the periphery of each neuromast in an oval-shaped pattern and in interneuromast cells (thin lines of Sox expression between the neuromasts). The neuromast line shows mild disruption (E, F), with ectopic ampullary organs identified by Mafa expression (compare F with F1, which shows the same region before Sox2 immunostaining). (The black asterisk indicates the spiracular opening.) A skin mount from this region (G; location indicated by boxes in F and F1) reveals stronger above-background Sox2 signal in one of the ectopic ampullary organs (top) compared to other ampullary organs (white arrowheads), but weaker than in a neuromast (black arrowhead). (H–J) The same Foxg1 crispant shown in Figure 7E–J, after ISH for Mafa followed by Sox2 immunostaining. (The black asterisk in H indicates the spiracular opening.) The infraorbital neuromast line is severely disrupted (H–I1), with apparent fusion of the dorsal and ventral infraorbital fields (di/vi; compare with mildly disrupted line in panel F). Only two neuromasts seem to be present (black arrowheads), as revealed by Sox2 signal (I) in the absence of Mafa signal (compare I with I1, showing the same region before Sox2 immunostaining). In a skin mount from this region (J; location indicated by boxes in I and I1), the ectopic ampullary organs show stronger Sox2 staining compared to other ampullary organs, but weaker than in a neuromast. Abbreviations: di, dorsal infraorbital ampullary organ field; di/vi, fused dorsal infraorbital and ventral infraorbital ampullary organ fields; e, eye; n, naris; vi, ventral infraorbital ampullary organ field. Scale bars: A, C, E–F1, H–I1, 200 μm; B, D, G, J, 50 μm.
Figure 8
Foxg1 crispant phenotypes include the presence of ectopic electroreceptors within individual neuromasts.
Sterlet Foxg1 crispants at stage 45 after in situ hybridisation (ISH) for electroreceptor-specific markers. All images show a ventral view of the right side of the rostrum (compare with schematic in Figure 6S,T) except panel G (lateral view). Black arrowheads indicate examples of neuromasts; white arrowheads indicate examples of ampullary organs; green arrowheads indicate ectopic electroreceptors. (A–B1) Two Foxg1 crispants in which a small patch of electroreceptor-specific Kcnab3 expression is seen in the apparent path of the right infraorbital neuromast line on the ventral rostrum (compare with the large clusters of electroreceptors in the ampullary organs on either side, in the ventral infraorbital and dorsal infraorbital fields). Post-ISH Sox2 immunostaining (B, B1) reveals that the neuromast line remains uninterrupted, suggesting that the ectopic electroreceptors formed within neuromasts. (C–F) A third Foxg1 crispant after ISH for Kcnab3. In wholemount (C), a tiny patch of electroreceptor-specific Kcnab3 expression is visible in the apparent path of the right infraorbital neuromast line on the ventral rostrum (green arrowhead in boxed region labelled F). The other two green arrowheads indicate the positions of even smaller patches of Kcnab3 expression, too faint to be visible in wholemount images. Skin mounts from this region, imaged after post-ISH Sox2 immunostaining (D–F; locations shown in boxed regions on panel C), show that all of the ectopic Kcnab3-positive electroreceptors are located within Sox2-positive neuromasts in an uninterrupted neuromast line. (G–J) The same phenotype can be observed in a fourth Foxg1 crispant after ISH for Kcnab3 (G, H) and a fifth Foxg1 crispant after ISH for the electroreceptor-specific marker Mafa (I,J). Abbreviations: b, barbel; di, dorsal infraorbital ampullary organ field; vi, ventral infraorbital ampullary organ field. Scale bars: A–C, G, I, 200 μm; D–F, H, J, 50 μm.
Figure 9
Differential disruption of individual neuromast lines in Foxg1 crispants.
(A) In situ hybridisation for the hair cell/electroreceptor marker Cacna1d at stage 45 identifies neuromasts and ampullary organs. (B) Schematic of a stage 45 sterlet larval head to illustrate the position and embryonic origin of cranial neuromast lines (shown as individual neuromasts) and ampullary organ fields (represented by coloured patches). The colour-coding indicates their lateral line placode (LLp) of origin, following Gibbs and Northcutt, 2004: blue, anterodorsal LLp (light blue, supraorbital; dark blue, infraorbital); orange, anteroventral LLp (preopercular); green, otic LLp (otic); pink, supratemporal LLp (supratemporal); light grey, middle LLp (middle). The black asterisk indicates the spiracular opening (first pharyngeal cleft). (C–E) Bar charts summarising different aspects of neuromast line disruption in Foxg1 crispants, scored separately on left and right sides of the head for the supraorbital, infraorbital, otic, and preopercular neuromast lines. (The post-otic neuromast lines—supratemporal, middle, and posterior—were not scored.) Source data and a summary table are provided in Supplementary file 3. (C) Bar chart showing the percentage of all phenotypic Foxg1 crispant sides (n=74) in which each neuromast line was disrupted. The otic line was the most commonly disrupted; the preopercular line was the least often disrupted. (D) Severity of phenotype. The bar chart shows the percentage of each disrupted neuromast line for which the phenotype was scored as severe (more than two-thirds of the line affected), moderate (between two-thirds and one-third of the line affected), or mild (less than one-third of the line affected). The preopercular line always had a mild phenotype; the other neuromast lines showed varying phenotypic severity. (E) Bar chart showing the percentage of each disrupted neuromast line with the following phenotypes: any ectopic ampullary organs (AOs); electroreceptors (ER) inside neuromasts (NMs); any neuromast (NM) gaps; ectopic ampullary organs plus neuromast gaps; ectopic ampullary organs alone; neuromast gaps alone. The otic and preopercular lines had almost opposite phenotypes: the otic line was always disrupted by gaps and only sometimes by ectopic ampullary organs as well (note the small size of the associated dorsal otic ampullary organ field in panel A), whereas the preopercular line was almost always disrupted by ectopic ampullary organs and only sometimes by gaps. The supraorbital and infraorbital lines were usually disrupted by ectopic ampullary organs (note the large size of the associated ampullary organ fields in panel A) but often also by gaps. Abbreviations for neuromast lines: io, infraorbital; m, middle; ol, otic; pop, preopercular; so, supraorbital; st, supratemporal. Abbreviations for anatomical landmarks: b, barbel; e, eye; m, mouth; n, naris; ot, otic vesicle; s, spiracle (first pharyngeal cleft). Scale bar: 200 μm.
Tables
Table 1
sgRNAs used in this study.
List of the genes targeted for CRISPR/Cas9-mediated mutagenesis, together with the target sequences and combinations of sgRNAs reported in this study. Tyr sgRNAs 7 and 8 (marked with an asterisk) were designed and published by Stundl et al., 2022 as their tyr sgRNA 3 and tyr sgRNA 4, respectively.
| Target gene | sgRNA | Target sequence | PAM | Combinations used |
|---|---|---|---|---|
| Tyr | 1 | GGTGCCAAGGCAAAAACGCT | GGG | 1+2, 1+2+3+4 |
| 2 | GATATCCCTCCATACATTAT | TGG | 1+2, 1+2+3+4 | |
| 3 | GATGTTTCTAAACATTGGGG | TGG | 1+2+3+4 | |
| 4 | GCTATGAATTTATTTTTTTC | AGG | 1+2+3+4 | |
| 5 | GCAAGGTATACGAAAGTTGA | CGG | 5+6 | |
| 6 | GATTGCAAGTTCGGCTTCTT | TGG | 5+6 | |
| 7* | GGTTAGAGACTTTATGTAAC | GGG | 7+8 | |
| 8* | GGCTCCATGTCTCAAGTCCA | AGG | 7+8 | |
| Atoh1 | 1 | GACCTTGTAAAAGATCGGAA | AGG | 1+2 |
| 2 | GCTTGTCATTGTCAAATGAC | GGG | 1+2 | |
| Neurod4 | 1 | GGAGCGTTTCAAGGCCAGGC | GGG | 1, 1+2+3+4, 1+6 |
| 2 | GTGAGCGTTCTCGCATGCAC | GGG | 2, 1+2+3+4 | |
| 3 | GCCTGGCCCACAACTACATC | TGG | 1+2+3+4, 3+4+5+6 | |
| 4 | GAGGGGCCCCGAGAAGCTGC | AGG | 1+2+3+4, 3+4+5+6 | |
| 5 | GTCTCCCCAGCCCTCCCTAC | GGG | 5, 3+4+5+6 | |
| 6 | GACAACCACTCCCCGGATTG | CGG | 1+6, 3+4+5+6 | |
| 7 | GACCCTGCGCAGGCTCTCCA | GGG | 7+9, 7+8+9 | |
| 8 | GCAGCTGGGTCCCCTGCTGA | CGG | 7+8+9 | |
| 9 | GGGGCCGTGTGCTCAGGGAT | GGG | 7+9, 7+8+9 | |
| Foxg1 | 1 | GAAACATCTTTTGCCCAACC | CGG | 1+2 |
| 2 | TCTTCCGAGCAAGGTAACTC | GGG | 1+2 | |
| 3 | TGATGCTGAAGGACGACTTG | GGG | 3+4 | |
| 4 | CTGGCTCGTCCTCGGGCCGG | TGG | 3+4 |
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Acipenser ruthenus) | Atoh1 | NCBI_Gene (RRID:SCR_002473) | GeneID:117420670 | |
| Gene (A. ruthenus) | Cacna1d | NCBI_Gene (RRID:SCR_002473) | GeneID:117413950 | |
| Gene (A. ruthenus) | Foxg1 | NCBI_Gene (RRID:SCR_002473) | GeneID:117418845 | |
| Gene (A. ruthenus) | Gfi1 | NCBI_Gene (RRID:SCR_002473) | GeneID:117408280 | |
| Gene (A. ruthenus) | Kcnab3 | NCBI_Gene (RRID:SCR_002473) | GeneID:117404443 | |
| Gene (A. ruthenus) | Mafa | NCBI_Gene (RRID:SCR_002473) | GeneID:117399627 | |
| Gene (A. ruthenus) | Neurod1 | NCBI_Gene (RRID:SCR_002473) | GeneID:117426329 | |
| Gene (A. ruthenus) | Neurod2 | NCBI_Gene (RRID:SCR_002473) | GeneID:117433279 | |
| Gene (A. ruthenus) | Neurod4 | NCBI_Gene (RRID:SCR_002473) | GeneID:131720860 | |
| Gene (A. ruthenus) | Neurod6 | NCBI_Gene (RRID:SCR_002473) | GeneID:117435768 | |
| Gene (A. ruthenus) | Pou4f3 | NCBI_Gene (RRID:SCR_002473) | GeneID:117968545 | |
| Biological sample (A. ruthenus) | Fertilised sterlet sturgeon eggs and embryos/yolk-sac larvae (A. ruthenus) | Research Institute of Fish Culture and Hydrobiology, Faculty of Fisheries and Protection of Waters, University of South Bohemia in České Budějovice Vodňany, Czech Republic | ||
| Antibody | Sox2 antibody (rabbit monoclonal) | Abcam | Cat.#:ab92494; RRID:AB_10585428 | (1:200) |
| Antibody | horseradish peroxidase-conjugated goat anti-rabbit IgG (H+L) | Jackson ImmunoResearch | Cat.#:111-035-003; RRID:AB_2313567 | (1:300) |
| Antibody | sheep anti-digoxigenin Fab fragments, AP-conjugated | Roche | Cat.#:11093274910; RRID:AB_514497 | (1:2000) |
| Antibody | sheep anti-fluorescein Fab fragments, fluorescein conjugated | Roche | Cat.#:11426338910; RRID:AB_514504 | (1:1000) |
| Recombinant DNA reagent | pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (plasmid) | Addgene (Cong et al., 2013) | RRID:Addgene_42335 | Used to synthesize DNA templates containing the single guide (sg)RNA scaffold |
| Sequence-based reagent | Atoh1 riboprobe forward primer (F) | Minařík et al., 2024 | PCR primers | AGCTCGCAGGAGGAGATGCACA |
| Sequence-based reagent | Atoh1 riboprobe reverse primer (R) | Minařík et al., 2024 | PCR primers | TGGTGTGGTTCTGGAGTTTGAGT |
| Sequence-based reagent | Cacna1d riboprobe F | Minařík et al., 2024 | PCR primers | TACCAGGAGCTCATGTGCAG |
| Sequence-based reagent | Cacna1d riboprobe R | Minařík et al., 2024 | PCR primers | CAATGCCAACCTCAACAATG |
| Sequence-based reagent | Foxg1 riboprobe F | Minařík et al., 2024 | PCR primers | TCAGCTCCTGAGGTCCAACT |
| Sequence-based reagent | Foxg1 riboprobe R | Minařík et al., 2024 | PCR primers | CAGGCTCAGGTTGTGTCTGA |
| Sequence-based reagent | Gfi1 riboprobe F | Minařík et al., 2024 | PCR primers | TGAGACGGCTGACTTCTCCT |
| Sequence-based reagent | Gfi1 riboprobe R | Minařík et al., 2024 | PCR primers | GGCTGTGTGTGATCAGGTTG |
| Sequence-based reagent | Kcnab3 riboprobe F | Minařík et al., 2024 | PCR primers | GGTAAATTCAGCGTGGAGGA |
| Sequence-based reagent | Kcnab3 riboprobe R | Minařík et al., 2024 | PCR primers | ACCTTCGATGATGTGCTTCC |
| Sequence-based reagent | Neurod4 riboprobe F | This paper | PCR primers | GAGAGAGCCCCAAAGAGACGAG |
| Sequence-based reagent | Neurod4 riboprobe R | This paper | PCR primers | CTGCTTGAGCGAGAAGTTGACG |
| Sequence-based reagent | Pou4f3 riboprobe F | Minařík et al., 2024 | PCR primers | GAGTTTGCCTTCCAAATCCA |
| Sequence-based reagent | Pou4f3 riboprobe R | Minařík et al., 2024 | PCR primers | TTGTTGTGGGACAAGGTCAA |
| Sequence-based reagent | M13 F | https://www.genewiz.com/en-GB/Public/Resources/Free-Universal-Primers | PCR primers | GTAAAACGACGGCCAG |
| Sequence-based reagent | M13 R with SP6 promoter sequence | https://www.genewiz.com/en-GB/Public/Resources/Free-Universal-Primers | PCR primers | ATTTAGGTGACACTATAGCAGGAAACAGCTATGAC |
| Sequence-based reagent | Mafa synthetic gene fragment | Minařík et al., 2024 | GenBank:OR327047 | Ordered from Twist Biosciences with PCR primer adaptors attached (M13 F and M13 R with SP6 promoter sequence). See Materials and Methods. |
| Sequence-based reagent | Neurod1 synthetic gene fragment | This paper | GenBank:OQ808944 | Ordered from Twist Biosciences with PCR primer adaptors attached (M13 F and M13 R with SP6 promoter sequence). See Materials and Methods. |
| Sequence-based reagent | Neurod2 synthetic gene fragment | This paper | GenBank:OQ808945 | Ordered from Twist Biosciences with PCR primer adaptors attached (M13 F and M13 R with SP6 promoter sequence). See Materials and Methods. |
| Sequence-based reagent | Neurod4 synthetic gene fragment | This paper | GenBank:OQ808946 | Ordered from Twist Biosciences with PCR primer adaptors attached (M13 F and M13 R with SP6 promoter sequence). See Materials and Methods. |
| Sequence-based reagent | Neurod6 synthetic gene fragment | This paper | GenBank:OQ808947 | Ordered from Twist Biosciences with PCR primer adaptors attached (M13 F and M13 R with SP6 promoter sequence). See Materials and Methods. |
| Sequence-based reagent | sgRNA scaffold R | Pers. comm., Dr Ahmed Elewa, Karolinska Institutet, Stockholm, Sweden | PCR primers | AAAAAAGCACCGACTCGGTGCC |
| Sequence-based reagent | Atoh1 sgRNA F1 | This paper | PCR primers | GATCACTAATACGACTCACTATAGACCTTGTAAAAGATCGGAAGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Atoh1 sgRNA F2 | This paper | PCR primers | GATCACTAATACGACTCACTATAGCTTGTCATTGTCAAATGACGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Foxg1 sgRNA F1 | This paper | PCR primers | GATCACTAATACGACTCACTATAGAAACATCTTTTGCCCAACCGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Foxg1 sgRNA F2 | This paper | PCR primers | GATCACTAATACGACTCACTATATCTTCCGAGCAAGGTAACTCGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Foxg1 sgRNA F3 | This paper | PCR primers | GATCACTAATACGACTCACTATATGATGCTGAAGGACGACTTGGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Foxg1 sgRNA F4 | This paper | PCR primers | GATCACTAATACGACTCACTATACTGGCTCGTCCTCGGGCCGGGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Neurod4 sgRNA F1 | This paper | PCR primers | GATCACTAATACGACTCACTATAGGAGCGTTTCAAGGCCAGGCGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Neurod4 sgRNA F2 | This paper | PCR primers | GATCACTAATACGACTCACTATAGTGAGCGTTCTCGCATGCACGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Neurod4 sgRNA F3 | This paper | PCR primers | GATCACTAATACGACTCACTATAGCCTGGCCCACAACTACATCGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Neurod4 sgRNA F4 | This paper | PCR primers | GATCACTAATACGACTCACTATAGAGGGGCCCCGAGAAGCTGCGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Neurod4 sgRNA F5 | This paper | PCR primers | GATCACTAATACGACTCACTATAGTCTCCCCAGCCCTCCCTACGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Neurod4 sgRNA F6 | This paper | PCR primers | GATCACTAATACGACTCACTATAGACAACCACTCCCCGGATTGGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Neurod4 sgRNA F7 | This paper | PCR primers | GATCACTAATACGACTCACTATAGACCCTGCGCAGGCTCTCCAGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Neurod4 sgRNA F8 | This paper | PCR primers | GATCACTAATACGACTCACTATAGCAGCTGGGTCCCCTGCTGAGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Neurod4 sgRNA F9 | This paper | PCR primers | GATCACTAATACGACTCACTATAGGGGCCGTGTGCTCAGGGATGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Tyr sgRNA F1 | This paper | PCR primers | GATCACTAATACGACTCACTATAGGTGCCAAGGCAAAAACGCTGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Tyr sgRNA F2 | This paper | PCR primers | GATCACTAATACGACTCACTATAGATATCC CTCCATACATTATGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Tyr sgRNA F3 | This paper | PCR primers | GATCACTAATACGACTCACTATAGATGTTTCTAAACATTGGGGGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Tyr sgRNA F4 | This paper | PCR primers | GATCACTAATACGACTCACTATAGCTATGAATTTATTTTTTTCGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Tyr sgRNA F5 | This paper | PCR primers | GATCACTAATACGACTCACTATAGCAAGGTATACGAAAGTTGAGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Tyr sgRNA F6 | This paper | PCR primers | GATCACTAATACGACTCACTATAGATTGCAAGTTCGGCTTCTTGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Tyr sgRNA F7 | Stundl et al., 2022 | PCR primers | GATCACTAATACGACTCACTATAGGTTAGAG ACTTTATGTAACGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Tyr sgRNA F8 | Stundl et al., 2022 | PCR primers | GATCACTAATACGACTCACTATAGGCTCCATGTCTCAAGTCCAGTTTTAGAGCTAGAAAT |
| Sequence-based reagent | Atoh1 genotyping F | This paper | PCR primers | GACACAGACAACAGCGAGGA |
| Sequence-based reagent | Atoh1 genotyping R | This paper | PCR primers | ACGGGAACTGCGTTGTATTC |
| Sequence-based reagent | Atoh1 genotyping R1/R2 | This paper | PCR primers | CTGCTTGAGCGAGAAGTTGACG |
| Sequence-based reagent | Foxg1 genotyping F | This paper | PCR primers | GATTGAGGTCCAACTGTGCTGC |
| Sequence-based reagent | Foxg1 genotyping R | This paper | PCR primers | GTCTGATGGAGTTTTGCCAGCC |
| Sequence-based reagent | Neurod4 genotyping F1 | This paper | PCR primers | ATGTACGAGGAGGAGGAAGAGGAAG |
| Sequence-based reagent | Neurod4 genotyping F2 | This paper | PCR primers | GAGAGAGCCCCAAAGAGACGAG |
| Sequence-based reagent | Neurod4 genotyping R3 | This paper | PCR primers | AAGACCCAGAAGCTGTCCAA |
| Sequence-based reagent | Neurod4 genotyping F4 | This paper | PCR primers | CTCCTGCTTGAGCGAGAAGT |
| Sequence-based reagent | Tyr genotyping F | This paper | PCR primers | GCGTCTCTCCAGTCCCAATA |
| Sequence-based reagent | Tyr genotyping R | This paper | PCR primers | AGAGAGAAGTGGCCCTTGGT |
| Peptide, recombinant protein | Cas9 protein with NLS | PNA Bio | Cat.#:CP01-200 | |
| Peptide, recombinant protein | Q5 High-Fidelity DNA Polymerase | New England Biolabs | Cat.#:M0491S | |
| Commercial assay or kit | Superscript III First Strand Synthesis kit | Invitrogen | Cat.#:18080051 | |
| Commercial assay or kit | Qiagen PCR cloning kit | Qiagen | Cat.#:231124 | |
| Commercial assay or kit | MinElute Gel Extraction Kit | Qiagen | Cat.#:28604 | |
| Commercial assay or kit | HS Taq Mix Red | PCR Biosystems | Cat.#:PB10.23–02 | |
| Commercial assay or kit | Monarch PCR & DNA Cleanup Kit | New England Biolabs | Cat.#:T1030 | |
| Commercial assay or kit | HiScribe T7 High Yield RNA Synthesis Kit | New England Biolabs | Cat.#:E2040S | |
| Commercial assay or kit | Monarch RNA Cleanup Kit | New England Biolabs | Cat.#:T2040 | |
| Commercial assay or kit | EnzMet kit | Nanoprobes | Cat.#:6010 | |
| Commercial assay or kit | Rapid Extract Lysis Kit | PCR Biosystems | Cat.#:PB15.11–08 | |
| Commercial assay or kit | Digoxigenin RNA Labelling Mix | Roche | Cat.#:11277073910 | |
| Commercial assay or kit | Fluorescein RNA Labelling Mix | Roche | Cat.#:11685619910 | |
| chemical compound, drug | NBT/BCIP | Roche | Cat.#:11681451001 | (1:50) |
| Chemical compound, drug | SIGMAFAST Fast Red tablets | Sigma | Cat.#:F4648-50SET | |
| Software, algorithm | NCBI BLAST | National Institutes of Health (NIH) | RRID:SCR_004870 | |
| Software, algorithm | NCBI ORF Finder | National Institutes of Health (NIH) | RRID:SCR_016643 | |
| Software, algorithm | Benchling | Benchling | RRID:SCR_013955 | |
| Software, algorithm | CRISPR Guide RNA Design Tool | Benchling | RRID:SCR_013955 | |
| Software, algorithm | Inference of CRISPR Edits (ICE) | Synthego | RRID:SCR_024508 | |
| Software, algorithm | Ocular | Teledyne Photometrics | RRID:SCR_024490 | |
| Software, algorithm | QCapture Pro 6.0 | QImaging | RRID:SCR_014432 | |
| Software, algorithm | QCapture Pro 7.0 | QImaging | RRID:SCR_014432 | |
| Software, algorithm | Helicon Focus | Helicon Soft | RRID:SCR_014462 | |
| Software, algorithm | Adobe Photoshop | Adobe | RRID:SCR_014199 | |
| Other | Ophthalmic scalpel | FEATHER Safety Razor Co. Ltd. | Cat.#:P-715 |
Additional files
-
Supplementary file 1
Breakdown by sgRNA mix of CRISPR/Cas9 experiments.
For each sgRNA mix targeting tyrosinase, Atoh1, Neurod4, or Foxg1, the table shows the number of independent batches, markers used for analysis, percentage with phenotypes, and genotyping information including the genotyping primer sequences. The table also shows total numbers and percentage scores across each of the targeted genes. Most of the Tyr crispant data are shared between this study and Campbell et al., 2025. Tyr sgRNAs 7 and 8 were designed and published by Stundl et al., 2022 as their tyr sgRNA 3 and tyr sgRNA 4, respectively.
- https://cdn.elifesciences.org/articles/96285/elife-96285-supp1-v2.xlsx
-
Supplementary file 2
Breakdown by individual crispant of Atoh1 crispant phenotypes.
For each of 64 Atoh1 crispants, the table shows the batch number, riboprobe used, and the laterality and severity of any phenotype as scored in lateral view on left and right sides independently, where ‘severe’ means more than two-thirds of cranial hair cells/electroreceptors were absent; ‘moderate’ means between one-third and two-thirds of cranial hair cells/electroreceptors were absent; ‘mild’ means less than one-third of cranial hair cells/electroreceptors were absent. The table also shows total numbers and percentage scores across all crispants. Crispants are ordered by riboprobe used, and within this by the presence or absence of a phenotype (with non-phenotypic crispants in blue font).
- https://cdn.elifesciences.org/articles/96285/elife-96285-supp2-v2.xlsx
-
Supplementary file 3
Breakdown by individual crispant of Foxg1 crispant phenotypes.
For each of 87 Foxg1 crispants, the table shows the sgRNA mix used, batch number, riboprobe used, type of phenotype, if any (neuromast lines disrupted by ectopic ampullary organs, electroreceptors inside neuromasts, and/or neuromast gaps), and the laterality and severity of the phenotype as scored in lateral and ventral view for each of the pre-otic neuromast lines (supraorbital, infraorbital, otic and preopercular neuromast lines) on the left and right sides of the head. The phenotype was classed as ‘severe’ when more than two-thirds of the neuromast line was affected; ‘moderate’ when between one-third and two-thirds of the line was affected; and ‘mild’ when less than one-third of the line was affected. Crispants are ordered by sgRNA mix, then by riboprobe used, and within this by the presence or absence of a phenotype (with non-phenotypic crispants in blue font). The table also shows summary percentage data across crispants and individual neuromast lines.
- https://cdn.elifesciences.org/articles/96285/elife-96285-supp3-v2.xlsx
-
Supplementary file 4
Riboprobe information.
For each riboprobe used for in situ hybridisation for Neurod family genes, the table shows the primer sequences used for cloning the cDNA template, the GenBank accession number of the top-matched ohnolog and the nucleotide range targeted by the riboprobe. The table also shows the chromosomal location, riboprobe percentage identity and genome annotation of both the top-matched ohnolog and the second ohnolog. Equivalent information is given for a previously published paddlefish (Polyodon spathula) Cacna1d riboprobe (Modrell et al., 2017a) used to analyse two Atoh1 sterlet crispants.
- https://cdn.elifesciences.org/articles/96285/elife-96285-supp4-v2.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/96285/elife-96285-mdarchecklist1-v2.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Atoh1 is required for the formation of lateral line electroreceptors and hair cells, whereas FoxG1 represses an electrosensory fate
eLife 14:e96285.
https://doi.org/10.7554/eLife.96285
