Motor neurons are dispensable for the assembly of a sensorimotor circuit for gaze stabilization
- Department of Otolaryngology, Neuroscience & Physiology, and the Neuroscience Institute, NYU Grossman School of Medicine, United States
- Center for Neural Science, New York University, United States
Figures
Figure 1 with 2 supplements
phox2a loss-of-function mutants fail to develop nIII/nIV motor neurons and vertical eye rotation behavior.
Associated with Figure 1—figure supplement 2. (A) Schematic of vestibulo-ocular reflex circuitry and the genetic loss-of-function approach used to perturb motor-derived signals. (B) Fluorescent in …
Figure 1—figure supplement 1
Extraocular motor neuron fate is perturbed in phox2a mutants.
(A) Fluorescent in situ hybridization images of nIII/nIV motor neurons, labeled by Tg(isl1:GFP), in wildtype larvae at 2 dpf. Panels from left to right show: (1) isl1+ motor neurons, (2) mRNA for vac…
Figure 1—figure supplement 2
phox2a specifies nIII motor neuron fate in a dose- and birthdate-dependent manner.
(A) Images of nIII/nIV motor neurons, labeled in Tg(isl1:GFP), in wildtype siblings (left) and phox2a heterozygotes (middle) at 5 dpf. Wildtype image same as in Figure 1E. One hemisphere shown. …
Figure 2
Motor neurons are dispensable for proper connectivity between utricular sensory afferents and projection neurons.
Associated with Table 1. (A) Schematic of pitch vestibulo-ocular reflex circuitry. Dashed lines outline projection neurons as calcium imaging target. Nose-down/eyes-up channel represented with blue; …
Figure 3
Motor neurons are dispensable for proper connectivity between semicircular canal sensory afferents and projection neurons.
Associated with Table 1. (A) Schematic of impulse tilt experiments. Yellow dashed lines outline projection neurons as calcium imaging target. Impulse-responsive neurons (ventrally-localized) shown …
Figure 4
Projection neurons are anatomically and molecularly poised to assemble with motor neuron partners in phox2a mutants.
(A) Schematic of retrograde photofill experiments. Projection neuron axons expressing the photolabile protein Kaede are targeted at the midbrain-hindbrain boundary with ultraviolet light. Converted …
Figure 5 with 5 supplements
Motor neurons are dispensable for normal transcriptional profiles of projection neurons.
Associated with Figure 5—figure supplement 1, Figure 5—figure supplement 4, Table 3. (A) Schematic of sequencing approach. Central projection neurons (Tg(–6.7Tru.Hcrtr2:GAL4-VP16);Tg(UAS:E1b-Kaede)) …
Figure 5—figure supplement 1
Flow cytometry gating strategy to sort fluorescently-labeled neurons for bulk RNA sequencing.
(A) Sequential gates used to sort fluorescent neurons labeled with Tg(–6.7Tru.Hcrtr2:GAL4-VP16);Tg(UAS-E1b:Kaede);Tg(isl1:GFP). Gate A excluded presumptive debris (small cells). Gate B isolated …
Figure 5—figure supplement 2
Molecular identification of projection neurons using a reference single-cell RNA sequencing atlas.
(A) UMAP visualization of a single-cell RNA sequencing atlas of n=1,468 neurons labeled in Tg(–6.7Tru.Hcrtr2:GAL4-VP16);Tg(UAS-E1b:Kaede), generated with 10 x Genomics (Materials and methods). Each …
Figure 5—figure supplement 3
Visualization of transcripts in siblings and phox2a null mutants with fluorescent in situ hybridization is (1) consistent across larvae and (2) scales with predicted detection in projection neurons.
(A-A’) Fluorescent in situ hybridization against itga9 for three sibling (A) or phox2a null mutant (A’) larvae (72 hpf), imaged with identical conditions. Left column shows RNA (green); right …
Figure 5—figure supplement 4
Differential gene expression in an unfiltered bulk sequencing dataset of siblings and phox2a mutants.
(A) Volcano plot showing differentially expressed genes across an unfiltered bulk RNA sequencing dataset. Dashed lines represent significance cutoffs: horizontal line, p adjusted>0.05; vertical …
Figure 5—figure supplement 5
phox2a expression in the medial vestibular nucleus may underscore differential gene expression phenotypes in bulk data.
(A) Fluorescent in situ hybridization against phox2a in a 5 dpf larvae (axial view). Top panel shows phox2a RNA (green); bottom panel, merge with neurons visualized with Tg(isl1:GFP);Tg(–6.7Tru.Hcrtr…
Tables
Table 1
Statistical comparisons of tilt responses across genotypes.
WT (sampled) refers to an n=125 neuron subset, sampled with replacement from a reference dataset of wildtype projection neurons. Data shown is mean/standard deviation unless otherwise noted. p val …
| WT (all) | WT (sampled) | phox2a+/+ | phox2a+/- | phox2a-/- | p val | |
|---|---|---|---|---|---|---|
| Tonic tilt stimuli | ||||||
| n (neurons/fish) | 255/10 | 125 /x | 76/5 | 109/6 | 297/16 | |
| % observed (nose-up/nose-down/untuned) | 50/44/7 | 37/54/9 | 40/54/7 | 56/37/7 | 44/50/6 | |
| ΔF/F, nose-up | 1.28 ± 1.23 | 1.27 ± 1.19 | 1.09 ± 1.03 | 1.12 ± 0.90 | 1.02 ± 0.82 | 0.26 |
| ΔF/F, nose-down | 2.01±1.66 | 1.99 ± 1.69 | 1.38 ± 0.91 | 1.98 ± 1.61 | 2.07±1.48 | 0.16 |
| directional tuning strength, nose-up | 0.84 ± 0.28 | 0.83 ± 0.30 | 0.87 ± 0.26 | 0.81 ± 0.28 | 0.81 ± 0.29 | 0.70 |
| directional tuning strength, nose-down | 0.72 ± 0.30 | 0.72 ± 0.31 | 0.73 ± 0.31 | 0.77 ± 0.30 | 0.68 ± 0.29 | 0.54 |
| Impulse stimuli | ||||||
| n (neurons/fish) | 255/10 | 125 /x | 76/5 | 109/6 | 297/16 | |
| % observed (responsive/unresponsive) | 58/42 | 57/43 | 57/43 | 60/39 | 70/30 | |
| ΔF/F | 0.41 ± 0.46 | 0.33 ± 0.28 | 0.29 ± 0.29 | 0.22 ± 0.16 | 0.32 ± 0.28 | 1.0E-05 |
| directional tuning strength | 0.08 ± 0.36 | 0.10 ± 0.38 | 0.003 ± 0.41 | 0.07 ± 0.48 | 0.07 ± 0.41 | 0.64 |
| Multiple comparisons | genotype | p val | Cohen’s d | |||
| ΔF/F to impulses | WT to sampled | p=0.13 | 0.21 | |||
| WT to +/+ | p=0.04 | 0.27 | ||||
| WT to +/- | p=3.8E-06 | 0.48 | ||||
| WT to -/- | p=0.006 | 0.24 | ||||
| +/+to +/- | p=0.47 | 0.34 | ||||
| +/+to -/- | p=0.89 | 0.11 | ||||
| +/-to -/- | p=0.02 | 0.49 |
Table 2
Statistical comparisons of projection neuron topography across genotypes.
WT (sampled) refers to an n=125 neuron subset, sampled with replacement from a reference dataset of wildtype projection neurons. Data shown is the median/standard deviation distance from the …
| WT (all) | WT (sampled) | phox2a+/+ | phox2a+/- | phox2a-/- | p val | |
|---|---|---|---|---|---|---|
| Tonic tilt stimuli | ||||||
| nose-down | ||||||
| n (cells/fish) | 111/10 | 51 /x | 41/5 | 40/6 | 147/16 | |
| dorsoventral | 20.0 ± 8.4 | 25.0 ± 8.4 | 15.0 ± 9.0 | 25.0 ± 8.7 | 20.0 ± 9.1 | 0.03 |
| mediolateral | 17.4 ± 6.0 | 17.6 ± 6.5 | 19.3 ± 6.6 | 15.3 ± 5.6 | 16.8 ± 6.6 | 0.15 |
| rostrocaudal | 16.8 ± 9.6 | 16.5 ± 9.6 | 19.5 ± 9.6 | 16.1 ± 10.4 | 18.2 ± 9.6 | 0.49 |
| global organization | 0.09 | |||||
| nose-up | ||||||
| n (cells/fish) | 111/10 | 51 /x | 41/5 | 40/6 | 147/16 | |
| dorsoventral | 30.0 ± 10.3 | 25.0 ± 10.8 | 27.5 ± 10.9 | 25.0 ± 10.4 | 30.0 ± 10.5 | 0.67 |
| mediolateral | 14.9 ± 7.1 | 15.1 ± 5.9 | 16.7 ± 7.0 | 18.6 ± 9.8 | 13.2 ± 7.2 | 9.6E-06 |
| rostrocaudal | 16.1 ± 9.8 | 16.7 ± 10.4 | 12.5 ± 10.7 | 14.8 ± 10.4 | 14.8 ± 10.7 | 0.51 |
| global organization | 2.7E-07 | |||||
| Multiple comparisons | genotype | p val | Cohen’s d | |||
| dorsoventral, nose-down | WT to sampled | 0.86 | 0.17 | |||
| WT to +/+ | 0.54 | 0.29 | ||||
| WT to +/- | 0.96 | 0.13 | ||||
| WT to -/- | 0.08 | 0.34 | ||||
| +/+to +/- | 0.35 | 0.41 | ||||
| +/+to -/- | 0.99 | 0.05 | ||||
| +/-to -/- | 0.07 | 0.45 | ||||
| mediolateral, nose-up | WT to sampled | 0.91 | 0.03 | |||
| WT to +/+ | 0.57 | 0.35 | ||||
| WT to +/- | 0.006 | 0.57 | ||||
| WT to -/- | 0.69 | 0.20 | ||||
| +/+to +/- | 0.74 | 0.23 | ||||
| +/+to -/- | 0.09 | 0.55 | ||||
| +/-to -/- | 5.4E-06 | 0.74 | ||||
| Impulse stimuli | ||||||
| n (responsive) | 148/10 | 138 /n | 43/5 | 55/5 | 214/16 | |
| dorsoventral | 20.0 ± 9.8 | 20.0 ± 10.1 | 20.0 ± 10.7 | 20.0 ± 10.9 | 20.0 ± 10.3 | 0.57 |
| mediolateral | 19.0 ± 5.9 | 16.1 ± 6.8 | 16.7 ± 8.6 | 20.4 ± 7.2 | 19.8 ± 5.8 | 0.003 |
| rostrocaudal | 21.9 ± 9.9 | 17.3 ± 9.8 | 15.4 ± 9.1 | 13.0 ± 9.9 | 22.0 ± 9.5 | 2.9E-05 |
| global organization | 1.2E-0.9 | |||||
| Multiple comparisons | genotype | p val | Cohen’s d | |||
| mediolateral, responsive | WT to sampled | 0.99 | 0.002 | |||
| WT to +/+ | 0.32 | 0.37 | ||||
| WT to +/- | 9.82 | 0.17 | ||||
| WT to -/- | 0.33 | 0.23 | ||||
| +/+to +/- | 0.91 | 0.14 | ||||
| +/+to -/- | 0.007 | 0.55 | ||||
| +/-to -/- | 0.05 | 0.37 | ||||
| rostrocaudal, responsive | WT to sampled | 0.98 | 0.37 | |||
| WT to +/+ | 0.12 | 0.29 | ||||
| WT to +/- | 0.001 | 0.53 | ||||
| WT to -/- | 0.07 | 0.10 | ||||
| +/+to +/- | 0.90 | 0.72 | ||||
| +/+to -/- | 0.95 | 0.33 | ||||
| +/-to -/- | 0.23 | 0.21 |
Table 3
Differentially expressed genes in projection neurons.
Star indicates a gene was evaluated using fluorescent in situ hybridization. # symbol indicates a gene was also differentially expressed in adjacent phox2a-expressing medial vestibular neurons (see F…
| Gene | % of projection neurons with expression | Log2 fold change | p adjusted |
|---|---|---|---|
| Upregulated | |||
| * # itga9 | 1.9 | 23.0 | 3.9E-06 |
| si:dkey-54n8.2 | 1.3 | 9.6 | 0.007 |
| myof | 1.3 | –8.3 | 0.010 |
| gbe1a | 1.9 | 7.0 | 0.01 |
| # dysf | 1.9 | 6.9 | 0.016 |
| * # twf1b | 2.5 | 5.9 | 0.024 |
| cers3a | 2.5 | 9.2 | 0.025 |
| asip2b | 1.3 | 8.7 | 0.032 |
| # pole | 1.3 | 7.3 | 0.041 |
| abtb2a | 3.1 | 4.7 | 0.041 |
| * # p4hb | 6.3 | 5.1 | 0.044 |
| postnb | 3.8 | 10.1 | 0.044 |
| fhdc3 | 2.5 | 4.5 | 0.044 |
| Downregulated | |||
| msmo1 | 1.3 | –8.3 | 8.4E-06 |
| *rxfp2a | 4.4 | –8.5 | 1.1E-05 |
| si:ch73-204p21.2 | 1.3 | –9.9 | 2.2E-04 |
| tsta3 | 0.0 | –6.6 | 6.8E-04 |
| * # satb1a | 8.2 | –3.0 | 0.001 |
| # polrmt | 1.9 | –8.7 | 0.002 |
| # znf975 | 1.3 | –5.0 | 0.003 |
| # phldb1a | 3.1 | –5.8 | 0.004 |
| asns | 2.5 | –7.8 | 0.032 |
| nr1i2 | 1.9 | –5.5 | 0.039 |
| Control | |||
| evx2 | 36.4 | 0.46 | 0.99 |
| myt1la | 80.5 | 2.6 | 0.44 |
Table 4
Top 50 expressed genes in an unfiltered bulk RNA sequencing dataset of phox2a siblings.
‘% of unfiltered 10 x neurons’ refers to gene detection in a single-cell atlas of neurons labeled in Tg(–6.7Tru.Hcrtr2:GAL4-VP16);Tg(UAS-E1b:Kaede) (n=1,468 neurons). ‘% of projection neurons’ …
| Gene | % of unfiltered 10 x neurons with expression | % of projection neurons |
|---|---|---|
| ints5 | 23.2 | 15.1 |
| stmn1b | 78.6 | 78.6 |
| sox4a | 6.5 | 3.1 |
| basp1 | 61.4 | 62.9 |
| hmgb3a | 68.2 | 69.8 |
| ptmaa | 84.5 | 77.4 |
| gapdhs | 28.9 | 30.2 |
| pnrc2 | 81.3 | 78.6 |
| snap25a | 65.7 | 78.0 |
| gpm6ab | 81.1 | 78.6 |
| calm3b | 0.0 | 0.0 |
| marcksl1b | 88.8 | 86.2 |
| tuba1c | 59.9 | 54.7 |
| cd81a | 43.3 | 49.7 |
| meis1b | 87.9 | 87.4 |
| rtn1a | 73.4 | 74.8 |
| elavl3 | 87.1 | 82.4 |
| hmgb1b | 57.2 | 49.7 |
| ptmab | 80.7 | 73.6 |
| zc4h2 | 56.9 | 58.5 |
| meis2b | 57.1 | 49.7 |
| slc25a5 | 51.4 | 55.3 |
| mab21l2 | 62.7 | 68.6 |
| h3f3c | 69.1 | 61.6 |
| rtn1b | 36.4 | 33.3 |
| elavl4 | 78.7 | 67.3 |
| gng3 | 37.2 | 42.8 |
| pik3r3b | 77.4 | 83.6 |
| tubb5 | 25.3 | 25.2 |
| histh1l | 61.0 | 62.9 |
| serinc1 | 51.9 | 59.1 |
| ckbb | 23.5 | 30.8 |
| az1a | 43.5 | 49.7 |
| az1b | 36.9 | 38.4 |
| actb1 | 23.6 | 28.3 |
| ywhaba | 36.2 | 40.9 |
| ywhag2 | 36.2 | 50.9 |
| si:ch211-222l21.1 | 73.8 | 63.5 |
| si:dkey-276j7.1 | 45.8 | 56.0 |
| aldocb | 19.3 | 17.6 |
| actb2 | 27.0 | 30.8 |
| tmem59l | 39.8 | 56.6 |
| calm2b | 37.9 | 47.2 |
| hmgn6 | 73.6 | 65.4 |
| h2afx1 | 59.6 | 53.5 |
| cd99l2 | 32.4 | 36.5 |
| cirbpb | 77.8 | 73.6 |
| ppdpfb | 74.5 | 65.4 |
| stxbp1a | 52.3 | 66.0 |
| Control | ||
| evx2 | 33.8 | 36.4 |
Table 5
Top 50 differentially expressed genes in an unfiltered bulk RNA sequencing dataset of phox2a siblings and null mutants.
One star indicates a gene was retained in a filtered subset of projection neurons; %, evaluated using fluorescent in situ hybridization. ‘% of unfiltered 10 x neurons’ refers to gene detection in an …
| Gene | % of unfiltered 10 x neurons with expression | Putative origin | Log2 fold change | p adjusted |
|---|---|---|---|---|
| Upregulated | ||||
| macc1 | 0.1 | r4-6 | 24.0 | 3.2E-06 |
| CR559941.1 | 0.0 | 23.7 | 3.4E-06 | |
| si:dkey-65b12.6 | 0.0 | 23.5 | 3.4E-06 | |
| si:ch73-106n3.2 | 0.1 | 23.5 | 3.4E-06 | |
| mcm10 | 0.1 | MNs | 23.4 | 3.4E-06 |
| si:ch211-244o22.2 | 0.5 | r4-6 | 23.4 | 3.4E-06 |
| dre-mir-10a | 0.0 | 23.3 | 3.5E-06 | |
| itga4 | 0.3 | r5-6 (inhibitory) | 23.2 | 3.5E-06 |
| si:dkeyp-87d8.8 | 0.0 | 23.2 | 3.6E-06 | |
| arsj | 0.5 | MNs | 23.0 | 3.9E-06 |
| tlr1 | 0.0 | 23.0 | 3.9E-06 | |
| * % itga9 | 2.3 | r4-7 | 23.0 | 3.9E-06 |
| tofb | 0.5 | r4-6 | 9.1 | 1.4E-05 |
| myo7ba | 0.4 | r4-7 | 9.8 | 1.0E-04 |
| zfand1 | 0.1 | MNs | 9.0 | 1.5E-04 |
| % slc22a7a | 0.7 | r4-7 | 10.2 | 1.5E-04 |
| agrp | 0.0 | 13.4 | 4.1E-04 | |
| si:dkey-46i9.6 | 0.1 | r5-7 | 7.7 | 6.8E-04 |
| muc2.2 | 0.0 | 9.4 | 6.9E-04 | |
| cd37 | 0.0 | 9.1 | 9.8E-04 | |
| musk | 0.3 | r4-6 | 9.4 | 1.2E-03 |
| mcamb | 0.2 | r5-7 | 8.3 | 2.7E-03 |
| ppp1r42 | 0.5 | r5-6 (inhibitory) | 7.9 | 3.1E-03 |
| CR677513.1 | 0.0 | 9.9 | 3.5E-03 | |
| Downregulated | ||||
| * % satb1a | 7.9 | r4-7 (inc inhib), MNs | –8.6 | 1.0E-06 |
| *znf975 | 0.7 | r4-6 | –8.3 | 1.5E-06 |
| phldb1a | 0.6 | r5-7 (inc inhib) | –9.2 | 1.5E-06 |
| TSTA3 | 0.0 | –9.7 | 3.4E-06 | |
| si:dkey-24p1.6 | 0.0 | –8.3 | 8.4E-06 | |
| si:dkey-77f5.14 | 0.2 | r5-7 | –8.5 | 1.1E-05 |
| tha1 | 0.1 | MVN | –10.3 | 2.1E-05 |
| serpinh2 | 0.5 | r4-6 | –9.0 | 3.7E-05 |
| ghrh | 0.3 | r4-7 | –9.5 | 6.9E-05 |
| asah1b | 0.8 | r4-7 | –7.8 | 9.9E-05 |
| msmo1 | 0.9 | r5-7, inc inhib | –8.9 | 1.1E-04 |
| tagln2 | 0.3 | glia | –8.4 | 2.2E-04 |
| zgc:174863 | 0.1 | MNs | –9.9 | 2.2E-04 |
| * % rxfp2a | 3.2 | r4-7, inc inhib | –6.6 | 6.8E-04 |
| bmp4 | 0.7 | r4-7 | –6.8 | 6.8E-04 |
| cfl1l | 0.1 | r4-6 | –8.4 | 6.8E-04 |
| * polrmt | 4.2 | r4-7, inc inhib | –8.8 | 6.9E-04 |
| anxa2a | 0.6 | r4-7 | –3.0 | 1.3E-03 |
| galr1a | 0.3 | MVN | –9.1 | 1.4E-03 |
| selenow2b | 0.1 | –8.0 | 1.8E-03 | |
| % bckdhbl | 1.4 | r4-7, glia, MNs | –8.7 | 2.1E-03 |
| boka | 0.5 | r5-7 | –8.6 | 2.9E-03 |
| cyldb | 0.2 | r4-7 | –7.9 | 3.0E-03 |
| pon2 | 0.6 | r4-7, glia, MNs | –5.0 | 3.1E-03 |
| si:ch73-204p21.2 | 0.3 | r5-7, inc inhib | –8.2 | 3.5E-03 |
| and2 | 0.1 | r4-6 | –5.8 | 3.7E-03 |
| Control | ||||
| evx2 | 33.8 | r4-7 | 0.46 | 0.99 |
Table 6
Differentially expressed genes in phox2a-expressing medial vestibular neurons.
Star indicates a gene was evaluated in projection neurons using fluorescent in situ hybridization. # indicates a gene was significantly differentially expressed in projection neurons. ‘% of medial …
| Gene | % of medial vestibular neurons | % of projection neurons | Log2 fold change | p adjusted |
|---|---|---|---|---|
| Upregulated | ||||
| itga4 | 2.2 | 0.6 | 23.2 | 3.5E-06 |
| * # itga9 | 6.7 | 1.9 | 23.0 | 3.9E-06 |
| musk | 2.2 | 0.6 | 9.4 | 0.001 |
| # dysf | 6.7 | 1.9 | 6.9 | 0.016 |
| * # twf1b | 8.9 | 1.9 | 5.9 | 0.024 |
| gabrr2a | 2.2 | 2.5 | 6.8 | 0.040 |
| # pole | 2.2 | 0.0 | 7.3 | 0.041 |
| * # p4hb | 15.6 | 1.3 | 5.1 | 0.044 |
| col27a1b | 2.2 | 0.6 | 8.0 | 0.044 |
| Downregulated | ||||
| asah1b | 2.2 | 0.0 | –8.3 | 1.5E-06 |
| boka | 2.2 | 0.0 | –9.2 | 1.5E-06 |
| * # satb1a | 6.7 | 8.2 | –3.0 | 0.001 |
| # polrmt | 4.4 | 1.9 | –8.7 | 0.002 |
| # znf975 | 2.2 | 1.3 | –5.0 | 0.003 |
| # phldb1a | 2.2 | 3.1 | –5.8 | 0.004 |
| fosl1a | 2.2 | 0.0 | –5.4 | 0.016 |
| pitpnaa | 2.2 | 0.0 | –8.8 | 0.036 |
| sgpp1 | 2.2 | 0.6 | –7.1 | 0.038 |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Chemical compound, drug | Tween | Thermo Fisher Scientific | BP337-100 | |
| Chemical compound, drug | 32% paraformaldehyde | Electron Microscopy Sciences | 15714 | |
| Chemical compound, drug | Proteinase K | Thermo Fisher Scientific | 25530049 | |
| Peptide, recombinant protein | Papain | Worthington Biochemical | LK003178 | |
| Chemical compound, drug | Hanks Buffered Salt Solution (HBSS) | Thermo Fisher Scientific | 14170112 | |
| Chemical compound, drug | Earl’s Buffered Salt Solution (EBSS) | Thermo Fisher Scientific | 24010043 | |
| Peptide, recombinant protein | DNAse | Worthington Biochemical | LK003172 | |
| Peptide, recombinant protein | DAPI | Invitrogen | D1306 | |
| Chemical compound, drug | L15 Medium | Thermo Fisher Scientific | 11415064 | |
| Chemical compound, drug | Fetal bovine serum, qualified, triple-filtered | Thermo Fisher Scientific | A3160501 | |
| Peptide, recombinant protein | Collagenase Type 1 A | Sigma Aldrich | C9891-500MG | |
| Chemical compound, drug | Low melting point agarose | Thermo Fisher Scientific | 16520 | |
| Chemical compound, drug | Ethyl-3-aminobenzoic acid ethyl ester (MESAB) | Sigma Aldrich | E10521 | |
| Chemical compound, drug | Pancuronium bromide | Sigma Aldrich | P1918 | |
| Commercial assay, kit | in situ hybridization chain reaction v3.0 (HCR) | Molecular Instruments | N/A | |
| Commercial assay, kit | RNAqueous Micro Total RNA Isolation Kit | Thermo Fisher Scientific | AM1931 | |
| Commercial assay, kit | MEGAshortscript T7 Transcription Kit | Thermo Fisher Scientific | AM1354 | |
| Commercial assay, kit | QiaQUICK PCR Purification Kit | Qiagen | 28104 | |
| Commercial assay, kit | EnGen Spy Cas9 NLS | New England Biolabs | M0646T | |
| Strain, strain background (Danio rerio) | Tg(–6.7Tru.Hcrtr2:GAL4-VP16) | Lacoste et al., 2015; Schoppik et al., 2017 | ZFIN: ZDB-TGCONSTRCT-151028–8 | |
| Strain, strain background (Danio rerio) | Tg(UAS-E1b:Kaede) | Scott et al., 2007 | ZFIN: ZDB-TGCONSTRCT-070314–1 | |
| Strain, strain background (Danio rerio) | Tg(isl1:GFP) | Higashijima et al., 2000 | ZFIN: ZDB-ALT-030919–2 | |
| Strain, strain background (Danio rerio) | Tg(UAS:GCaMP6s) | Chen et al., 2013 | ZFIN: ZDB-TGCONSTRCT-140811–3 | |
| Strain, strain background (Danio rerio) | phox2ad22 | This study | N/A | |
| Strain, strain background (Danio rerio) | phox2ad19 | This study | N/A | |
| Strain, strain background (Danio rerio) | phox2ai2 | This study | N/A | |
| Sequence-based reagent (primers) | phox2a forward primer | Sigma Aldrich | N/A | CAGCCAGAGCAACGGCTTCC |
| Sequence-based reagent (primers) | phox2a reverse primer | Sigma Aldrich | N/A | AAGCCGACAACAGTGTGTGTGTAA |
| Sequence-based reagent (primers) | phox2a guide 1 | Sigma Aldrich | N/A | CTCGCCACCGCCAGCTGCAC |
| Sequence-based reagent (primers) | phox2a guide 2 | Sigma Aldrich | N/A | CTCCGGCTTCAGCTCCGGCC |
| Sequence-based reagent (oligonucleotides) | HCR probes | Integrated DNA Technologies | N/A | |
| Software, algorithm | Fiji/ImageJ | Schindelin et al., 2012 | RRID: SCR_02285 | |
| Software, algorithm | Adobe Illustrator (2021) | Adobe | RRID: SCR_010279 | |
| Software, algorithm | Matlab 2020b | Mathworks | RRID: SCR_001622 | |
| Software, algorithm | Seurat v4 | Hao et al., 2021 | https://satijalab.org/seurat | |
| Software, algorithm | CRISPR Guide RNA Design Tool | Benchling | https://benchling.com/crispr | |
| Other | 20 micron cell strainer | pluriSelect | 431002060 | Method details (Neuron harvesting) |
| Other | SH800z 100 micron sorting chip | Sony | LE-C3210 | Method details (Flow cytometry) |
