Sex peptide targets distinct higher order processing neurons in the brain to induce the female post-mating response
- School of Biosciences, College of Life and Environmental Sciences, University of Birmingham, United Kingdom
- Division of Molecular and Cellular Function, School of Biological Sciences, University of Manchester, United Kingdom
Figures
Figure 1 with 1 supplement
The main post-mating responses (PMRs) in females can be separated.
(A, B) Schematic depiction of head and trunk expression in Drosophila elav FRTstopFRT GAL4; otdflp (A) and in tshGAL4 (B) visualised by UAS GFP (green). (C, D) Receptivity (C) and oviposition (D) of wild type control virgin (red) and mated (orange) females, and virgin females expressing UAS mSP (green) pan-neuronally with nsybGAL4 or in head and trunk patterns shown as means with standard error from three repeats for receptivity (21 females per repeat) by counting the number of females mating within a 1-hour period or for oviposition by counting the eggs laid within 18 hours from 30 females. Statistically significant differences from ANOVA post hoc comparison are indicated by different letters (p<0.0001). (E–H) Representative adult female genital tract showing tshGAL4 UAS H2BYFP (green) and elavLexA LexAop NLStomato (red) nuclear expression. The magnification (F–H) shows sensory genital tract neurons. Scale bars shown in (E) and (H) are 100 μm and 20 μm, respectively.
-
Figure 1—source data 1
Quantitative results used to generate graphs in Figure 1C and D.
- https://cdn.elifesciences.org/articles/98283/elife-98283-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Analysis of head and trunk expression lines.
(A–F) Expression of UAS CD8 GFP driven elav FRTstopFRT GAL4 restricted with otdflp to the head in the brain and ventral nerve cord (VNC). (G–L) Expression of tshGAL4 UAS H2B YFP with neurons labelled with tomato from elavLexA AopNLStomato in the brain and VNC. Scale bars shown in (I) and (L) are 50 μm and 100 μm, respectively.
Figure 2 with 2 supplements
Distinct regulatory regions in SPR, fru, and dsx genes induce post-mating responses (PMRs) from mSP expression.
(A–C) Schematic representation of SPR, fru, and dsx chromosomal regions depicting coding and non-coding exons as black or white boxes, respectively, and splicing patterns in solid lines. Vertical lines below the gene model depict enhancer GAL4 lines with names and those in red showed PMRs by expression of mSP. (D, E) Receptivity (D) and oviposition (E) of wild type control virgin (red) and mated (orange) females, and virgin females expressing UAS mSP (green) under the control of GAL4 pan-neuronally in nsyb or in SPR8, SPR12, fru11, fru12, and dsx24 patterns shown as means with standard error from three repeats for receptivity (21 females per repeat) by counting the number of females mating within a 1-hour period or for oviposition by counting the eggs laid within 18 hours from 30 females. Statistically significant differences from ANOVA post hoc comparison are indicated by different letters (p≤0.0001). (F–O) Representative adult female brains (F–J) and ventral nerve cords (VNC, K–O) expressing UAS CD8GFP under the control of SPR8, SPR12, fru11, fru12, and dsx24 GAL4. Scale bars shown in (J) and (O) are 50 µm and 100 µm, respectively.
-
Figure 2—source data 1
Quantitative results used to generate graphs in Figure 2D and E.
- https://cdn.elifesciences.org/articles/98283/elife-98283-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Expression analysis of PMR-inducing GAL4 in the genital tract.
(A–E) Representative adult female genital tracts expressing UAS CD8GFP under the control of SPR8, SPR12, fru11, fru12, and dsx24 GAL4, and LexAop NLStomato under the control of elavLexA. Arrows indicate genital tract sensory neurons. The inset shows expression of GFP in the genital tract sensory neurons. Scale bars shown in (A) and insets are 100 µm and 20 µm, respectively.
Figure 2—figure supplement 2
Expression analysis of non-PMR-inducing fru9GAL4 in the genital tract.
(A) Representative adult female genital tract expressing UAS CD8GFP under the control of fru9 GAL4. Arrows indicate genital tract sensory neurons. The inset shows expression of GFP in the genital tract sensory neurons. Scale bars shown in (A) and insets are 100 µm and 20 µm, respectively.
Figure 3
Expression of mSP in SPSN and genital tract expressing SPR lines does not support a major role for genital tract neurons in inducing the sex peptide response.
(A, B) Receptivity (A) and oviposition (B) of wild type control virgin (red) and mated (orange) females, and virgin females expressing UAS mSP (green) under the control of SPSN 1 and SPSN2, and SPR3 and SPR9 GAL4 lines shown as means with standard error from three repeats for receptivity (21 females per repeat) by counting the number of females mating within a 1-hour period or for oviposition by counting the eggs laid within 18 hours from 30 females. Statistically significant differences from ANOVA post hoc comparison are indicated by different letters (p<0.0001). (C–J) Representative genital tracts labelled with UAS CD8 GFP and genital tract neurons labelled with UAS H2BYFP and elavLexA AopNLStomato. (K–R) Adult female brains (K–N) and ventral nerve cords (VNC. O–R) expressing UAS CD8GFP. Scale bars shown in (F, J, N, R) are 100 µm, 20 µm, 50 µm and 100 µm, respectively.
-
Figure 3—source data 1
Quantitative results used to generate graphs in Figure 3A and B.
- https://cdn.elifesciences.org/articles/98283/elife-98283-fig3-data1-v1.xlsx
Figure 4
Expression of membrane-tethered sex peptide (mSP) in secondary ascending abdominal ganglion neurons induces post-mating responses (PMRs).
(A, B) Receptivity (A) and oviposition (B) of wild type control virgin (red) and mated (orange) females, and virgin females expressing UAS mSP (green) under the control of GAL4 pan-neuronally in nsyb or in FD1, FD2, FD3, FD4, FD5, and FD6, or with SAG split-Gal4 patterns shown as means with standard error from three repeats for receptivity (21 females per repeat) by counting the number of females mating within a 1-hour period or for oviposition by counting the eggs laid within 18 hours from 30 females. Statistically significant differences from ANOVA post hoc comparison are indicated by different letters (p<0.0001).
-
Figure 4—source data 1
Quantitative results used to generate graphs in Figure 4A and B.
- https://cdn.elifesciences.org/articles/98283/elife-98283-fig4-data1-v1.xlsx
Figure 5 with 1 supplement
Distinct circuits from the intersection of SPR, fru, dsx, and FD6 patterns in the brain and ventral nerve cord (VNC) induce post-mating responses (PMRs) from membrane-tethered sex peptide (mSP) expression.
(A) Schematic showing the intersectional gene expression approach: GAL4 activation (AD, orange) and DNA binding domains (DBD, blue) are expressed in different, but overlapping patterns. Leucine zipper dimerisation reconstitutes a functional split-GAL4 in the intersection (pink) to express UAS reporters. (B, C) Receptivity (B) and oviposition (C) of wild type control virgin (red) and mated (orange) females, and virgin females expressing UAS mSP (green) under the control of split-GAL4 intersecting SPR8 ∩ fru11/12, SPR8 ∩ dsx, SPR8 ∩ FD6, fru11/12 ∩ dsx, and fru11/12 ∩ FD6 patterns shown as means with standard error from three repeats for receptivity (21 females per repeat) by counting the number of females mating within a 1-hour period or for oviposition by counting the eggs laid within 18 hours from 30 females. Statistically significant differences from ANOVA post hoc comparison are indicated by different letters (p<0.0001). (D–M) Representative adult female brains and VNC expressing UAS CD8GFP under the control of SPR8 ∩ fru11/12, SPR8 ∩ dsx, SPR8 ∩ FD6, fru11/12 ∩ dsx, and fru11/12 ∩ FD6. Scale bars shown in (H) and (M) are 50 µm and 100 µm, respectively.
-
Figure 5—source data 1
Quantitative results used to generate graphs in Figure 5B and C.
- https://cdn.elifesciences.org/articles/98283/elife-98283-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Expression analysis of split-GAL4 in the genital tract.
(A–E) Representative adult female genital tracts expressing UAS CD8GFP under the control of SPR8 ∩ fru11/12, SPR8 ∩ dsx, SPR8 ∩ FD6, fru11/12 ∩ dsx, and fru11/12 ∩ FD6 split-GAL4 intersectional patterns. The scale bar shown in (E) is 100 µm.
Figure 6
Distinct neuronal circuitries from the intersection of SPR, fru, and dsx sense sex peptide (SP) after mating to induce post-mating responses (PMRs).
(A, B) Receptivity (A) and oviposition (B) of wild type control virgin (red) and mated (orange) females, and virgin females expressing UAS mSP (green) under the control of split-Gal4 intersecting SPR8 ∩ dsx, fru11/12 ∩ dsx, and SPR8 ∩ fru11/12 patterns in SPR/Df mutant females or SPR RNAi knock-down shown as means with standard error from three repeats for receptivity (21 females per repeat) by counting the number of females mating within a 1-hour period or for oviposition by counting the eggs laid within 18 hours from 30 females. Statistically significant differences from ANOVA post hoc comparison are indicated by different letters (p<0.0001 except p=0.002 and p=0.006 for c and d in A, and P=0.004 for c in B).
-
Figure 6—source data 1
Quantitative results used to generate graphs in Figure 6A and B.
- https://cdn.elifesciences.org/articles/98283/elife-98283-fig6-data1-v1.xlsx
Figure 7
Distinct neuronal circuitries in the brain sense SP to induce post-mating responses (PMRs).
(A, B) Schematic depiction of UAS GFP (green) expression in the head of Drosophila (A) combining split-GAL4 intersectional expression (AD-GAL4 and GAL4-DBD) with brain-expressed otdflp mediated recombination of UAS FRTGFPstopFRTmSP (B). (C, D) Receptivity (C) and oviposition (D) of wild type control virgin (red) and mated (orange) females, and virgin females expressing UAS FRTGFPstopFRTmSP (grey), UAS FRTGFPstopFRTTrpA1 (purple) and UAS FRTGFPstopFRTTNT (pink) under the control of split-GAL4 intersecting SPR8 ∩ dsx, fru11/12 ∩ dsx and SPR8 ∩ fru11/12 patterns with brain-specific FRT-mediated recombination by otdflp shown as means with standard error from three repeats for receptivity (21 females per repeat) by counting the number of females mating within a 1-hour period or for oviposition by counting the eggs laid within 18 hours from 30 females. Statistically significant differences from ANOVA post hoc comparison are indicated by different letters (p<0.0001 except p<0.0004 for c in C, p<0.007 for c in D).
-
Figure 7—source data 1
Quantitative results used to generate graphs in Figure 7C and D.
- https://cdn.elifesciences.org/articles/98283/elife-98283-fig7-data1-v1.xlsx
Figure 8 with 1 supplement
Expression of membrane-tethered sex peptide (mSP) in SPSN VT058873 AD intersected with SPR8 DBD, fru11/12 DBD, and dsx DBD induces post-mating responses (PMRs) and SPSN VT058873 AD intersected with SPR8 DBD and dsx DBD sense sex peptide (SP) in the brain.
(A, B) Receptivity (A) and oviposition (B) of wild type control virgin (red) and mated (orange) females, and virgin females expressing UAS mSP (green) under the control of VT058873 ∩ SPR8, VT058873 ∩ fru11/12, and VT058873 ∩ dsx shown as means with standard error from three repeats for receptivity (21 females per repeat) by counting the number of females mating within a 1-hour period or for oviposition by counting the eggs laid within 18 hours from 30 females. Statistically significant differences from ANOVA post hoc comparison are indicated by different letters (p<0.0001). (C–H) Adult female brains (C–E) and ventral nerve cords (VNC, F–H) expressing UAS CD8GFP. Scale bars shown in (E, H, K, N) are 50 µm, 100 µm, 100 µm and 20 µm, respectively. (I–N) Representative genital tracts labelled with UAS CD8 GFP and genital tract neurons labelled with UAS H2BYFP and elavLexA AopNLStomato. (O, P) Receptivity (O) and oviposition (P) of wild type control virgin (red) and mated (orange) females, and virgin females expressing UAS FRTGFPstopFRTmSP (grey) and UAS FRTGFPstopFRTTrpA1 (purple) under the control of split-GAL4 intersecting VT058873 ∩ SPR8, VT058873 ∩ fru11/12, and VT058873 ∩ dsx patterns with brain-specific FRT-mediated recombination by otdflp shown as means with standard error from three repeats for receptivity (21 females per repeat) by counting the number of females mating within a 1-hour period or for oviposition by counting the eggs laid within 18 hours from 30 females. Statistically significant differences from ANOVA post hoc comparison are indicated by different letters (p<0.0001).
-
Figure 8—source data 1
Quantitative results used to generate graphs in Figure 8A, B, O, and P.
- https://cdn.elifesciences.org/articles/98283/elife-98283-fig8-data1-v1.xlsx
Figure 8—figure supplement 1
Expression analysis of split-GAL4 in the genital tract.
(A–C) Visualisation of single-cell expression for CG31637 intersected with SPR, fru, and dsx. (D–F) Visualisation of single-cell expression for ocelliless intersected with SPR, fru, and dsx. (G–I) Visualisation of single-cell expression for Gyc76c intersected with SPR, fru, and dsx.
Figure 9
ppk is not part of the SPR8, SPR12, and fru11/12 post-mating response (PMR)-inducing neuronal circuitry.
(A, B) Receptivity (A) and oviposition (B) of wild type control virgin (red) and mated (orange) females, and virgin females expressing UAS mSP (green) under the control of GAL4 in ppk or in nSyb ∩ ppk, SPR8 ∩ ppk, SPR12 ∩ ppk, and fru11/12 ∩ ppk patterns shown as means with standard error from three repeats for receptivity (21 females per repeat) by counting the number of females mating within a 1-hour period or for oviposition by counting the eggs laid within 18 hours from 30 females. Statistically significant differences from ANOVA post hoc comparison are indicated by different letters (p<0.0001). (C–R) Representative adult female brains, ventral nerve cords (VNC) and genital tracts expressing UAS CD8GFP under the control of UAS by nSyb ∩ ppk, SPR8 ∩ ppk, SPR12 ∩ ppk, and fru11/12 ∩ ppk. Scale bars shown in (F, J, N, R) are 50 µm, 100 µm, 100 µm and 20 µm, respectively. (S–V) Receptivity (S, T) and oviposition (U, V) of wild type control virgin (red) and mated (orange) females, and virgin females expressing either UAS TNT (azure) or UAS NaChBac (brown) to inhibit or activate neurons in SPR8 ∩ ppk, SPR12 ∩ ppk, and fru11/12 ∩ ppk patterns shown as means with standard error from three repeats for receptivity (21 females per repeat) by counting the number of females mating within a 1-hour period or for oviposition by counting the eggs laid within 18 hours from 30 females. Statistically significant differences from ANOVA post hoc comparison are indicated by different letters (p<0.001 for b, and p<0.01 for c in L and N).
-
Figure 9—source data 1
Quantitative results used to generate graphs in Figure 9A and B.
- https://cdn.elifesciences.org/articles/98283/elife-98283-fig9-data1-v1.xlsx
Figure 10
Expression of membrane-tethered sex peptide (mSP) in female reproductive behaviour regulating neuron split-GAL4 lines.
(A, B) Receptivity (A) and oviposition (B) of wild type control virgin (red) and mated (orange) females, and virgin females expressing UAS mSP (green) under the control of pC1-SS1, oviDN-SS1 and 2, oviEN-SS1 and 2, oviIN-SS1 and 2, and vpoDN-SS1 shown as means with standard error from three repeats for receptivity (21 females per repeat) by counting the number of females mating within a 1-hour period or for oviposition by counting the eggs laid within 18 hours from 30 females. Statistically significant differences from ANOVA post hoc comparison are indicated by different letters (p<0.0001). (C–J) Representative genital tract neurons labelled with UAS H2BYFP and elavLexA AopNLStomato. The scale bar shown in (J) is 20 µm.
-
Figure 10—source data 1
Quantitative results used to generate graphs in Figure 10A and B.
- https://cdn.elifesciences.org/articles/98283/elife-98283-fig10-data1-v1.xlsx
Figure 11
Post-mating responses (PMRs) after neuronal inhibition, ablation, or activation of distinct circuits from intersection of SPR, fru, dsx, and FD6 patterns in the brain and ventral nerve cord (VNC).
(A–F) Receptivity (A, C, E) and oviposition (B, D, F) of wild type control virgin (red) and mated (orange) females, and virgin females expressing either UAS TNT (azure, A, B) or UAS reaper hid to inhibit or ablate neurons (yellow, C, D), respectively, or UAS NaChBac (brown, E, F) to activate neurons in SPR8 ∩ fru11/12, SPR8 ∩ dsx, SPR8 ∩ FD6, fru11/12 ∩ dsx, and fru11/12 ∩ FD6 split-Gal4 patterns shown as means with standard error from three repeats for receptivity (21 females per repeat) by counting the number of females mating within a 1-hour period or for oviposition by counting the eggs laid within 18 hours from 30 females. Statistically significant differences from ANOVA post hoc comparison are indicated by letters (p≤0.0095 in A, B, p<0.0001 in C, D except p=0.016 for c in D, p<0.0001 in E and p<0.0002 in F).
-
Figure 11—source data 1
Quantitative results used to generate graphs in Figure 11A–F.
- https://cdn.elifesciences.org/articles/98283/elife-98283-fig11-data1-v1.xlsx
Figure 12 with 1 supplement
retro- and trans-Tango identification of pre- and post-synaptic neurons of SP target neurons reveals higher order neuronal input canalised into shared output circuitries.
(A–O) Representative adult female brains expressing QUAST tomato3xHA retro-Tango (left, A–E), UAS myrGFP (middle, F–J) and QUAST tomato3xHA trans-Tango (right, K–O) in SPR8 ∩ dsx, fru11/12 ∩ dsx, SPR8 ∩ fru11/12, SPR8 ∩ FD6, and fru11/12 ∩ FD6 split-GAL4s. The presynaptic (A–E, left), split-GAL4 (F–J, middle) and postsynaptic (K–O, right) neuronal circuitries are shown in an inverted grey background. Arrows (magenta) indicate neurons and their corresponding projections in different regions in the female brain. The scale bar shown in (O) is 50 μm. (P) Model for the SP induced post-mating response. SP interferes with interpretation of sensory cues, for example, vision, hearing, smell, taste, and touch at distinct sites in the brain indicated by higher order projections revealed by intersectional expression in the following patterns: SPR8 ∩ dsx (blue), fru11/12 ∩ dsx (black), SPR8 ∩ fru11/12 (yellow), SPR8 ∩ FD6 (pink), and fru11/12 ∩ FD6 (olive). and VNC (fru11/12 ∩ dsx) during higher order neuronal processing.
Figure 12—figure supplement 1
trans-Tango identifies post-synaptic proceeding neurons of sex peptide (SP) targets in the ventral nerve cord (VNC), but not the genital tract.
(A–AD) Representative adult female VNCs (A–O) and genital tracts (P–AD) expressing UAS myrGFP; QUAST tomato3xHA trans-Tango in SPR8 ∩ fru11/12, SPR8 ∩ dsx, SPR8 ∩ FD6, fru11/12 ∩ dsx, and fru11/12 ∩ FD6 split-GAL4s. The pre-synaptic (A–E and P–T) and postsynaptic (F–J and U–Y) neuronal circuitries are shown in an inverted grey background and the merge is shown in colour. In the merged picture (K–O and Z–AD), the pre-synaptic and post-synaptic neuronal circuitry is shown in green and magenta, respectively. Scale bars shown in (O) and (AD) are 100 μm.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Drosophila melanogaster) | Wild-type: Canton S | This study | RRID:BDSC_64349 | Wild-type strain |
| Genetic reagent (D. melanogaster) | w*; UASmSP (3rd, 61C) | Nakayama et al., 1997 | Gift from T. Aigaki | |
| Genetic reagent (D. melanogaster) | dsx-GAL4 inserted into the endogenous dsx gene (84E5-84E6) | Rideout et al., 2010 | Gift from S. Goodwin | |
| Genetic reagent (D. melanogaster) | fru-GAL4 inserted into the endogenous fru gene (91A6-91B3) | Dickson lab | RRID:BDSC_66870 | |
| Genetic reagent (D. melanogaster) | nSyb GAL4 (3rd) | Rezával et al., 2012 | Gift from S. Goodwin | |
| Genetic reagent (D. melanogaster) | ppk-GAL4/CyO | Bloomington Stock Centre | RRID:BDSC_49021 | |
| Genetic reagent (D. melanogaster) | tshGAL4-1/CyO | Bloomington Stock Centre | RRID:BDSC_3040 | |
| Genetic reagent (D. melanogaster) | elav FRTstopFRT GAL4 | Zaharieva et al., 2015 | ||
| Genetic reagent (D. melanogaster) | otdflp | Asahina et al., 2014 | Gift from D. Anderson | |
| Genetic reagent (D. melanogaster) | UASmCD8GFP (X) | Bloomington Stock Centre | RRID:BDSC_5136 | |
| Genetic reagent (D. melanogaster) | UASmCD8GFP (2nd) | Bloomington Stock Centre | RRID:BDSC_5137 | |
| Genetic reagent (D. melanogaster) | UAS-H2B::YFP (2nd) | Li et al., 2020 | Gift from A. Hidalgo | |
| Genetic reagent (D. melanogaster) | elavLexA (2nd) | Bloomington Stock Centre | RRID:BDSC_52676 | |
| Genetic reagent (D. melanogaster) | LexAop NLStomato (2nd) | Bloomington Stock Centre | RRID:BDSC_66690 | |
| Genetic reagent (D. melanogaster) | UAS TNT (2nd) | Sweeney et al., 1995 | Gift from J.J. Hodge | |
| Genetic reagent (D. melanogaster) | UAS TrpA1 (3rd) | Bloomington Stock Centre | RRID:BDSC_26264 | |
| Genetic reagent (D. melanogaster) | UASFlybow 1.1 (myrGFP, 2nd) | Bloomington Stock Centre | RRID:BDSC_35537 | |
| Genetic reagent (D. melanogaster) | UAS-NaCh::BacGFP (3rd) | Bloomington Stock Centre | RRID:BDSC_9467 | |
| Genetic reagent (D. melanogaster) | UAS Reaper/FM7;UAS Hid/CyO | Bloomington Stock Centre | RRID:BDSC_5823 | |
| Genetic reagent (D. melanogaster) | UAS FRTstopFRT GFP/CyO | Dickson lab | RRID:BDSC_30125 | |
| Genetic reagent (D. melanogaster) | UAS FRTstopFRT TNT/CyO | Dickson lab | RRID:BDSC_30125 | |
| Genetic reagent (D. melanogaster) | UAS FRTstopFRT TrpA1/CyO | Dickson lab | RRID:BDSC_30125 | |
| Genetic reagent (D. melanogaster) | UAS FRTstopFRT mSP (3rd) | This study | Soller Lab | UAS mSP line with a stop cassette |
| Genetic reagent (D. melanogaster) | UAS dicer2; UAS SPR RNAi (X, 3rd) | Yapici et al., 2008 | Gift from B. Dickson lab | |
| Genetic reagent (D. melanogaster) | SPR | Bloomington Stock Centre | RRID:BDSC_7708 | |
| Genetic reagent (D. melanogaster) | Df(1)JC70/FM7c | Bloomington Stock Centre | RRID:BDSC_944 | |
| Genetic reagent (D. melanogaster) | nSyb p65-GAL4.AD (attP40) | Riabinina et al., 2019 | Gift from O. Riabinina | |
| Genetic reagent (D. melanogaster) | SPR8 AD: VT057286-p65.AD (attP40) | Bloomington Stock Centre | RRID:BDSC_71392 | |
| Genetic reagent (D. melanogaster) | Fru11/12 AD: VT043695-p65.AD (attP40) | Bloomington Stock Centre | RRID:BDSC_72065 | |
| Genetic reagent (D. melanogaster) | dsx DBD | Rideout et al., 2010 | Gift from S. Goodwin | |
| Genetic reagent (D. melanogaster) | dsx24 DBD: R42G02-GAL4.DBD (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | SPR8 DBD: VT057286-Gal4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_71425 | |
| Genetic reagent (D. melanogaster) | fru11/12 DBD: VT043695-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_72788 | |
| Genetic reagent (D. melanogaster) | FD6 DBD: VT003280-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_75877 | |
| Genetic reagent (D. melanogaster) | ppk DBD: ppk-GAL4.DBD (VK00027, 89E11) | Seidner et al., 2015 | Gift from W. J. Joiner | |
| Genetic reagent (D. melanogaster) | SPR12 AD: VT057292-p65.AD (attP40) | Bloomington Stock Centre | RRID:BDSC_72924 | |
| Genetic reagent (D. melanogaster) | UAS-myrGFP QUAS-mtdTomato-3xHA; trans-Tango | Bloomington Stock Centre | RRID:BDSC_95317 | |
| Genetic reagent (D. melanogaster) | QUAS-mtdTomato-3xHA; retro-Tango | Sorkaç et al., 2023 | RRID:BDSC_99661 | Gift from G. Barnea |
| Genetic reagent (D. melanogaster) | fru1 GAL4: R23C03-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_49021 | |
| Genetic reagent (D. melanogaster) | fru2 GAL4, R22H11-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_48043 | |
| Genetic reagent (D. melanogaster) | fru3 GAL4, R21H09-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_49867 | |
| Genetic reagent (D. melanogaster) | fru4 GAL4, R23C12-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_49026 | |
| Genetic reagent (D. melanogaster) | fru5 GAL4, R22F06-GAL4 (attP2) | Korea Drosophila Resource Center | KDRC 11848 | |
| Genetic reagent (D. melanogaster) | fru6 GAL4, R23D03GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | fru7 GAL4, R22B09-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | fru8 GAL4, R23B12-GAL4 (attP2) | Korea Drosophila Resource Centre | KDRC 11849 | |
| Genetic reagent (D. melanogaster) | fru9 GAL4, R22A02-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_49868 | |
| Genetic reagent (D. melanogaster) | fru10 GAL4, R22C05-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_49301 | |
| Genetic reagent (D. melanogaster) | fru11 GAL4, R22C11-lexA (attP40) | Bloomington Stock Centre | RRID:BDSC_52604 | |
| Genetic reagent (D. melanogaster) | fru12 GAL4, R22A11-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_48966 | |
| Genetic reagent (D. melanogaster) | fru13 GAL4, R23A06-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_49009 | |
| Genetic reagent (D. melanogaster) | fru14 GAL4, R22C03-GAL4 (attP2) | Korea Drosophila Resource Centre | RRID:KDRC_11868 | |
| Genetic reagent (D. melanogaster) | fru15 GAL4, R23B04-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_49016 | |
| Genetic reagent (D. melanogaster) | fru16 GAL4, R22C07-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_48975 | |
| Genetic reagent (D. melanogaster) | fru17 GAL4, R23C08-GAL4 (attP2) | Korea Drosophila Resource Centre | KDRC 11835 | |
| Genetic reagent (D. melanogaster) | fru18 GAL4, R23C07GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | fru19 GAL4, R22B10-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_48969 | |
| Genetic reagent (D. melanogaster) | fru20 GAL4, R22E10-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_49302 | |
| Genetic reagent (D. melanogaster) | fru21 GAL4, R22D11-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_48982 | |
| Genetic reagent (D. melanogaster) | fru22 GAL4, R22H07-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_490003 | |
| Genetic reagent (D. melanogaster) | fru23 GAL4, R21H02-GAL4 (attP2) | Korea Drosophila Resource Centre | KDRC 11847 | |
| Genetic reagent (D. melanogaster) | fru24 GAL4, R23B11-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_49019 | |
| Genetic reagent (D. melanogaster) | fru25 GAL4: VT043674-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | fru26 GAL4, VT043675-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | fru27 GAL4, VT043676-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx1 GAL4, R39E06-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_50051 | |
| Genetic reagent (D. melanogaster) | dsx2 GAL4, R40A05-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_48138 | |
| Genetic reagent (D. melanogaster) | dsx3 GAL4, R40F03-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_47355 | |
| Genetic reagent (D. melanogaster) | dsx4 GAL4, R40F04-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx5 GAL4, R41A01-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx6 GAL4, R41D01GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx7 GAL4, R41F06-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_47584 | |
| genetic reagent (D. melanogaster) | dsx8 GAL4, R42C06-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_50150 | |
| Genetic reagent (D. melanogaster) | dsx9 GAL4, R42D02-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_41250 | |
| Genetic reagent (D. melanogaster) | dsx10 GAL4, R42D04-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_47588 | |
| Genetic reagent (D. melanogaster) | dsx11 GAL4, VT038171-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx12 GAL4, VT038169-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx13 GAL4, VT038167-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx14 GAL4, VT038166-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx15 GAL4, VT038161-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx16 GAL4, VT038159-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx17 GAL4, VT038157-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx18 GAL4, VT038155-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx19 GAL4, VT038151-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx20 GAL4, VT038149-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| genetic reagent (D. melanogaster) | dsx21 GAL4, P{VT038148-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx22 GAL4, P{VT038147-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| genetic reagent (D. melanogaster) | dsx23 GAL4, R22H07-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx24 GAL4, R21H02-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | dsx25 GAL4, R21B01-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | SPR1 GAL4, R78F09-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | SPR2 GAL4, R78F11-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | SPR3 GAL4, R78E11-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | SPR4 GAL4, R78E12-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_40002 | |
| Genetic reagent (D. melanogaster) | SPR5 GAL4, R78G09-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_40015 | |
| Genetic reagent (D. melanogaster) | SPR6 GAL4, R78G08-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | SPR7 GAL4, R78F07-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_47409 | |
| genetic reagent (D. melanogaster) | SPR8 GAL4, R78F10-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_40007 | |
| Genetic reagent (D. melanogaster) | SPR9 GAL4, R78G02-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_40010 | |
| Genetic reagent (D. melanogaster) | SPR10 GAL4, R78G07-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | SPR11 GAL4, R78G04-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_40012 | |
| Genetic reagent (D. melanogaster) | SPR12 GAL4, R78F05-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | SPR13 GAL4, R78G05-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_41308 | |
| Genetic reagent (D. melanogaster) | SPR14 GAL4, R78G06-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | SPR15 GAL4, R78G03-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_40011 | |
| Genetic reagent (D. melanogaster) | SPR16 GAL4, R78F06-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | SPR17 GAL4, R78F12-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | SPR18 GAL4, R78F03-GAL4 | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | SPR19 GAL4, R78F01-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_40003 | |
| Genetic reagent (D. melanogaster) | SPR20 GAL4, R78G01-GAL4 (attP2) | Bloomington Stock Centre | RRID:BDSC_40009 | |
| Genetic reagent (D. melanogaster) | SPR21 GAL4, R78F02-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | SPR22 GAL4, R78F08-GAL4 (attP2) | Bloomington Stock Centre | N/A | |
| Genetic reagent (D. melanogaster) | FD1 GAL4, VT050405-GAL4 (attP2) | Vienna Drosophila Stock Centre | VDSC | |
| Genetic reagent (D. melanogaster) | FD2 GAL4, VT007068-GAL4 (attP2) | Vienna Drosophila Stock Centre | VDSC | |
| Genetic reagent (D. melanogaster) | FD3 GAL4, VT045154-GAL4 (attP2), | Vienna Drosophila Stock Centre | VDSC | |
| Genetic reagent (D. melanogaster) | FD4 GAL4, VT000454-GAL4 (attP2) | Vienna Drosophila Stock Centre | VDSC | |
| Genetic reagent (D. melanogaster) | FD5 GAL4, VT050247-GAL4 (attP2) | Vienna Drosophila Stock Centre | VDSC | |
| Genetic reagent (D. melanogaster) | FD6 GAL4, VT003280-GAL4 (attP2) | Vienna Drosophila Stock Centre | VDSC | |
| Genetic reagent (D. melanogaster) | SPR8 GAL4, R78F10-GAL4 (attP2); | Bloomington Stock Centre | RRID:BDSC_40007 | |
| Genetic reagent (D. melanogaster) | SPR8 AD [VT057286-p65.AD (attP40)]; fru11/12 DBD [VT043695-GAL4.DBD (attP2)] | This study | Soller Lab | Split gal4 combination of SPR8-AD and fru11/12-DBD |
| Genetic reagent (D. melanogaster) | Fru11/12 AD [VT043695-p65.AD (attP40)]; FD6 DBD [VT003280-GAL4.DBD (attP2)] | This study | Soller Lab | Split gal4 combination of fru11/12-AD and FD6-DBD |
| Genetic reagent (D. melanogaster) | SPR8 AD [VT057286-p65.AD (attP40)]; FD6 DBD [VT003280-GAL4.DBD (attP2)] | This study | Soller Lab | Split gal4 combination of SPR8-AD and FD6-DBD |
| Genetic reagent (D. melanogaster) | SPR8 AD [VT057286-p65.AD (attP40)]; dsx DBD (attP2) | This study | Soller Lab | Split gal4 combination of SPR8-AD and dsx-DBD |
| Genetic reagent (D. melanogaster) | Fru11/12 AD [VT043695-p65.AD (attP40)]; dsx DBD (attP2) | This study | Soller Lab | Split gal4 combination of fru11/12-AD and dsx-DBD |
| Genetic reagent (D. melanogaster) | VT058873-GAL4.AD (attP40); SPR8 DBD [VT057286-GAL4.DBD(attP2)] | This study | Soller Lab | Split gal4 combination of SPSN-AD and SPR8-DBD |
| Genetic reagent (D. melanogaster) | VT058873-GAL4.AD (attP40); Fru11/12 DBD [VT043696-GAL4.DBD(attP2)] | This study | Soller Lab | Split gal4 combination of SPSN-AD and fru11/12-DBD |
| Genetic reagent (D. melanogaster) | VT058873-GAL4.AD (attP40); dsx DBD (attp2) | This study | Soller Lab | Split gal4 combination of SPSN-AD and dsx-DBD |
| Genetic reagent (D. melanogaster) | nSyb p65-GAL4.AD (attp40); ppk DBD: ppk-GAL4.DBD [VK00027, 89E11] | This study | Soller Lab | Split gal4 combination of nSYB-AD and ppk-DBD |
| Genetic reagent (D. melanogaster) | SAG1, VT050405-GAL4.AD (attP40); VT007068-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_66875 | Split gal4 combination of SAG1-AD and SPSN-DBD |
| Genetic reagent (D. melanogaster) | pC1-SS1, VT2002064-GAL4.AD (attP40); VT008469-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_86830 | |
| Genetic reagent (D. melanogaster) | oviDN-SS1, VT050660-GAL4.AD (attP40); VT028160-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_86832 | |
| Genetic reagent (D. melanogaster) | oviDN-SS2, VT026873-GAL4.AD (attP40); VT040574-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_86831 | |
| Genetic reagent (D. melanogaster) | oviEN-SS1, VT043086-GAL4.AD (attP40); VT034612-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_86839 | |
| Genetic reagent (D. melanogaster) | oviEN-SS2, VT034612-GAL4.AD (attP40); VT050229-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_86833 | |
| Genetic reagent (D. melanogaster) | oviIN-SS1, R68A10-GAL4.AD (attP40); VT010054-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_86837 | |
| Genetic reagent (D. melanogaster) | oviIN-SS2, VT026347-GAL4.AD (attP40); VT026035-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_86838 | |
| Genetic reagent (D. melanogaster) | vpoDN-SS1, R31D07-GAL4.AD (attP40); R52F12-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_86868 | |
| Genetic reagent (D. melanogaster) | SPSN1, VT058873-GAL4.AD (attP40); VT003280-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_86834 | |
| Genetic reagent (D. melanogaster) | SPSN2, VT058873-GAL4.AD (attP40); VT033490-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_86870 | |
| Genetic reagent (D. melanogaster) | SAG1, VT050405-GAL4.AD (attP40); VT007068-GAL4.DBD (attP2) | Bloomington Stock Centre | RRID:BDSC_66875 | |
| Strain, strain background (Escherichia coli) | DH5α | New England Biolabs | RRID:AB_10015282 | For recombinant DNA cloning: |
| Antibody | Anti-HA (rat monoclonal antibody, clone 3F10) | Roche | RRID:AB_390919 | 1:20 |
| Antibody | Anti-GFP (rabbit Polyclonal Antibody) | Molecular Probes | RRID:AB_221570 | 1:100 |
| Antibody | Goat anti-rabbit Alexa Fluor 488 (goat polyclonal antibody) | Molecular Probes | RRID:AB_143165 | 1:250 |
| Antibody | Goat anti-rabbit Alexa Fluor 546 (goat polyclonal antibody) | Molecular Probes | RRID:AB_2534077 | 1:250 |
| Antibody | Goat anti-rabbit Alexa Fluor 647 (goat polyclonal antibody) | Molecular Probes | RRID:AB_2535813 | 1:250 |
| Antibody | Goat anti-rat Alexa Fluor 647 (goat polyclonal antibody) | Molecular Probes | RRID:AB_141778 | 1:250 |
| Sequence-based reagent | pUAST-GGTmSP FRTGFPstopFRT gBlock (FRT underlined) | IDT | Soller Lab | GAATTGGGAATTCGTTAACAGATCTGCGATCG CGGCCCGGGGATCTTGAAGTTCCTATTCCGAAG TTCCTATTCTCTAGAAAGTATAGGAACTTCAGAGCGCTTTTGAAGCTAGCTAAAGAGCCTGCTAAAGCAAAAAAGAAGTCACCATGGTGTCGAGCGCAAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGA GGGCGAGGGCGATGCCACCTACGGCAAGCTG ACCCTGAAGTTCATCTGCACCACCGGCAAGCT GCCCGTGCCCTGGCCCACCCTCGTGACCACC CTGACCTACGGCGTGCAGTGCTTCAGCCGCTA CCCCGACCACATGAAGCAGCACGACTTCTTCA AGTCCGCCATGCCCGAAGGCTACGTCCAGGAG CGCACCATCTTCTTCAAGGACGACGGCAACTA CAAGACCCGCGCCGAGGTGAAGTTCGAGGGC GACACCCTGGTGAACCGCATCGAGCTGAAGGG CATCGACTTCAAGGAGGACGGCAACATCCTGG GGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTACTCAGATCTTTGCAAGCTTGTAGAGTTTCCCATTTAATAATTCATATTATCTCGAATCTAGTCAATTACGGCTTTCCTCAAATAGAAAAATAAAAAAAATGAAAAAATGCACTTGCCATTTAAACTTAGACGCGATAACGAATTCCGGGGATCTTGAAGT TCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAA CTTCAGAGCGCTTTTGAAGCTGCGGCCGCGGCTCG ACGGTATCGATAAGCTTG |
| Software, algorithm | GraphPad Prism | GraphPad Prism | RRID:SCR_002798 | Software |
| Software, algorithm | Fiji | Fiji | RRID:SCR_002285 | Software |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Sex peptide targets distinct higher order processing neurons in the brain to induce the female post-mating response
eLife 13:RP98283.
https://doi.org/10.7554/eLife.98283.3
