Proteomic landscape of tunneling nanotubes reveals CD9 and CD81 tetraspanins as key regulators
- Membrane Traffic and Pathogenesis Unit, Department of Cell Biology and Infection, CNRS 18 UMR 3691, Institut Pasteur, Université Paris Cité, France
- Sorbonne Université, ED394 - Physiologie, Physiopathologie et Thérapeutique, France
- Proteomics Platform, Mass Spectrometry for Biology Unit, CNRS USR 2000, Institut Pasteur, France
- Centre d’Immunologie et des Maladies Infectieuses, Inserm, CNRS, Sorbonne Université, CIMI-Paris, France
- Ultrastructural BioImaging Core Facility (UBI), C2RT, Institut Pasteur, Université Paris Cité, France
Figures
Figure 1 with 1 supplement
Validation of the purification procedures.
(A) Workflow for tunneling nanotube (TNT) vs. extracellular vesicles and particle (EVP) purification. EVPs were purified from cell culture supernatant, and TNTs from the remaining attached cell …
-
Figure 1—source data 1
Uncropped and labeled western blots (WBs) for Figure 1F.
- https://cdn.elifesciences.org/articles/99172/elife-99172-fig1-data1-v1.zip
-
Figure 1—source data 2
Raw unedited western blots (WBs) for Figure 1F.
- https://cdn.elifesciences.org/articles/99172/elife-99172-fig1-data2-v1.zip
Figure 1—figure supplement 1
Characterization of tunneling nanotubes (TNTs) in U2OS cells.
(A) Representative immunofluorescence of TNTs in U2OS cells, expressing actin (stained with phalloidin, red in the two first lanes) without or with tubulin (green, lanes 1 and 2). …
-
Figure 1—figure supplement 1—source data 1
Uncropped and labeled western blots (WBs) for Figure 1—figure supplement 1F.
- https://cdn.elifesciences.org/articles/99172/elife-99172-fig1-figsupp1-data1-v1.zip
-
Figure 1—figure supplement 1—source data 2
Raw unedited western blots (WBs) for Figure 1—figure supplement 1F.
- https://cdn.elifesciences.org/articles/99172/elife-99172-fig1-figsupp1-data2-v1.zip
Figure 2 with 1 supplement
Analysis of the TNTome.
(A) Proteomap of the 1177 proteins of the TNTome, sorted in four quartiles depending on their mean iBAQ. Protein accession and mean iBAQ were used to create ProteoMap, analyzed according to Gene …
Figure 2—figure supplement 1
Comparison of TNTome with Integrin adhesome and other cell proteins.
(A) Venn diagram showing common and exclusive proteins between Integrin adhesion complexes (blue circle) and tunneling nanotubes (TNTs) (yellow circle). The percentages refer to total proteins. (B) …
-
Figure 2—figure supplement 1—source data 1
Uncropped and labeled western blots (WBs) for Figure 2—figure supplement 1G.
- https://cdn.elifesciences.org/articles/99172/elife-99172-fig2-figsupp1-data1-v1.zip
-
Figure 2—figure supplement 1—source data 2
Raw unedited western blots (WBs) for Figure 2—figure supplement 1G.
- https://cdn.elifesciences.org/articles/99172/elife-99172-fig2-figsupp1-data2-v1.zip
-
Figure 2—figure supplement 1—source data 3
Uncropped and labeled western blots (WBs) for Figure 2—figure supplement 1H.
- https://cdn.elifesciences.org/articles/99172/elife-99172-fig2-figsupp1-data3-v1.zip
-
Figure 2—figure supplement 1—source data 4
Raw unedited western blots (WBs) for Figure 2—figure supplement 1H.
- https://cdn.elifesciences.org/articles/99172/elife-99172-fig2-figsupp1-data4-v1.zip
Figure 3 with 4 supplements
Expression of CD9/CD81 in tunneling nanotubes (TNTs) and effects of their overexpression or invalidation.
(A) Immunofluorescence of CD9 (green) and CD81 (red) in SH-SY5Y cells. Cells were also stained with phalloidin (magenta) and DAPI (blue) to visualize actin and nuclei. This representative image …
Figure 3—figure supplement 1
Characterization of cells knock-out (KO) and overexpression (OE) for CD9 or CD81.
(A) Representative western blot (WB) of the tetraspanin KO experiments blotted with CD9 (top left blot) or CD81 (top right blot) and GAPDH-specific antibodies sequentially. Lines of the top left …
-
Figure 3—figure supplement 1—source data 1
Uncropped and labeled western blots (WBs) for Figure 3—figure supplement 1A.
- https://cdn.elifesciences.org/articles/99172/elife-99172-fig3-figsupp1-data1-v1.zip
-
Figure 3—figure supplement 1—source data 2
Raw unedited western blots (WBs) for Figure 3—figure supplement 1A.
- https://cdn.elifesciences.org/articles/99172/elife-99172-fig3-figsupp1-data2-v1.zip
-
Figure 3—figure supplement 1—source data 3
Uncropped and labeled western blots (WBs) for Figure 3—figure supplement 1C.
- https://cdn.elifesciences.org/articles/99172/elife-99172-fig3-figsupp1-data3-v1.zip
-
Figure 3—figure supplement 1—source data 4
Raw unedited western blots (WBs) for Figure 3—figure supplement 1C.
- https://cdn.elifesciences.org/articles/99172/elife-99172-fig3-figsupp1-data4-v1.zip
Figure 3—figure supplement 2
Gate strategy and representative results of all the cocultures.
Schematics of the cocultures are on top of each panel. Gates strategies are framed in blue: wild-type (WT) unstained cells, GFP cells, and DiD + cells were gated to select cells and exclude cellular …
Figure 3—figure supplement 3
Measurement of transfer by secretion in all the coculture experiments.
Schematics of all experiments are shown on the left. (A) Secretion control in the coculture between tetraspanin knock-out (KO) cells used as donors loaded with DiD to stain the vesicles and …
Figure 3—figure supplement 4
Coculture of DiD-treated wild-type (WT), CD9KD or CD81KD donor cells with GFP-expressing cells as acceptor, and analysis of transfer by microscopy.
(A) Representative confocal micrograph of the cocultures between KD control cells (CTR), or the KD of CD9 (CD9 KD). Human siRNA for CD9 (sequence: GAGCATCTTCGAGCAAGAA) or non-targeting siRNA (CTR …
Figure 4
CD9 and CD81 act successively in the formation of tunneling nanotubes (TNTs).
(A) Representative images of wild-type (WT), CD9 OE, CD9 OE + CD81 KO, CD81 OE, and CD81 OE + CD9 knock-out (KO) cells, stained with wheat germ agglutinin (WGA)-488 (green) and DAPI (blue). Yellow …
Figure 5 with 1 supplement
CD9 and CD46 antibody treatment in wild-type (WT) and CD81 knock-out (KO) cells.
(A) Representative confocal images of Actin chromo body-GFP expressing WT cells, treated for 3 hr with either anti-CD9 antibody coupled to Alexa Fluor 568 (upper row), or with anti-CD46 antibody …
Figure 5—figure supplement 1
CD9 vs. CTR antibody treatment in wild-type (WT) and CD81 knock-out (KO) cells.
(A) Immunofluorescence of CD9 (green) and CD81 (red) in SH-SY5Y WT cells treated with control antibodies (CTR AB) or with antibodies anti-CD9 (CD9 AB) for 2 hr followed by PFA fixation and …
Figure 6 with 6 supplements
Stabilization of tunneling nanotubes (TNTs) by CD9 AB.
(A) Representative snapshots of a TNT over time from Figure 6—video 1, corresponding to non-treated wild-type (WT) SH-SY5Y cells (WT NT). In A-F, green panels correspond to the signal of actin …
Figure 6—video 1
Representative video of the stability measurement of tunneling nanotubes (TNTs) in wild-type (WT) SH-SY5Y cells non-treated with any antibody.
The persistence of pre-established TNTs was evaluated using time-lapse microscopy. Cells were expressing actin-chromobody (AC)-GFP to mark the actin (in green) and therefore to enable visualization …
Figure 6—video 2
Representative time-lapse microscopy video of tunneling nanotubes (TNTs) in SH-SY5Y WT cells as in Figure 6—video 1, except that cells were treated with 10 µg/mL of CD9-Alexa 568 antibody.
Time 0 of the video is 1 hr after the addition of the antibody. The interval between frames is 23 s, max projection of the eight upper slices (step size 0.4 µm) is shown. The scale bar represents 10 …
Figure 6—video 3
Representative time-lapse microscopy video of tunneling nanotubes (TNTs) in SH-SY5Y wild-type (WT) cells treated with 10 µg/mL of CD46 antibody, as in Figure 6—video 2.
Time 0 of the video is 1 hr after the addition of the antibody, the interval between frames is 33 s, max projection of the 16 upper slices (step size 0.4 µm) is shown. The scale bar represents 10 …
Figure 6—video 4
Representative time-lapse microscopy video of tunneling nanotubes (TNTs) in SH-SY5Y CD81 KO cells non-treated with any antibody, as in Figure 6—video 1.
The interval between frames is 8 s, max projection of the 11 upper slices (step size 0.4 µm) is shown. The scale bar represents 10 µm. See also Figure 6D.
Figure 6—video 5
Representative time-lapse microscopy video of tunneling nanotubes (TNTs) in SH-SY5Y CD81 KO cells treated with 10 µg/mL of CD9 antibody, as in Figure 6—video 2.
Time 0 of the video is 2 hr after the addition of the antibody. The interval between frames is 17.8 s, max projection of the 15 upper slices (step size 0.4 µm) is shown. The scale bar represents 10 …
Figure 6—video 6
Representative time-lapse microscopy video of tunneling nanotubes (TNTs) in SH-SY5Y CD81 KO cells treated with 10 µg/mL of CD46 antibody.
Time 0 of the video is 2 hr after the addition of the antibody. The interval between frames is 18.8 s, max projection of the 16 upper slices (step size 0.4 µm) is shown. The scale bar represents 10 …
Figure 7 with 3 supplements
Completion of tunneling nanotubes (TNTs) by CD81.
(A) DiD vesicles in TNTs from wild-type (WT) or CD81 KO cells. Actin chromobody-expressing SH-SY5Y cells, either WT or CD81 KO, were challenged with DiD for 30 min and fixed to preserve TNTs after 8 …
Figure 7—video 1
Time-lapse microscopy video of DiD-labeled vesicles (purple) passing from one cell to another through a tunneling nanotube (TNT) in SH-SY5Y WT cells expressing actin chromobody-GFP (green).
Contrary to Figure 6—videos 1–6, cells were cultured in the absence of phenol red for Figure 7—videos 1–3. The interval between frames is 30 s, max projection of the nine upper slices (step size 0.2 …
Figure 7—video 2
Time-lapse microscopy video of DiD-labeled vesicles (purple, white arrowhead) entering from one cell into a tunneling nanotube (TNT), and next trapped into the TNT (yellow arrowhead) or at the junction of TNT with cell (white arrowhead) in SH-SY5Y CD81 KO cells expressing actin chromobody-GFP (green).
The interval between frames is 15 s, max projection of the 10 upper slices (step size 0.2 µm) is shown. The scale bar represents 15 µm. See also Figure 7A.
Figure 7—video 3
Time-lapse microscopy video of DiD-labeled vesicles (purple) in SH-SY5Y CD81 knock-out (KO) cells expressing actin chromobody-GFP (green) culture.
The white arrowhead indicates the point beyond which the vesicles cannot go in the tunneling nanotube (TNT). The yellow arrowhead points to a vesicle moving to the middle of the TNT, unable to go …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | U2OS | ATCC | HTB-96 | From osteosarcoma |
| Cell line (H. sapiens) | SH-SY5Y | gift from Simona Paladino (Department of Molecular Medicine and Medical Biotechnology, University of Naples Federico II, Naples, Italy) | From neuroblastoma | |
| Cell line (H. sapiens) | HEK 293T | Used for lentiviral production | ||
| Transfected construct (H. sapiens) | H2B-GFP | Addgene | #11680 | Human histone H2B (H2BC11 Human) |
| Transfected construct (Alpaca) | AC-GFP | Chromotek | pAC-TagGFP | mammalian expression vector encoding the cytoskeleton marker Actin-VHH fused to green fluorescent protein TagGFP2 |
| Transfected construct (H. sapiens) | GFP-CD9 | This paper: The TRIP∆3-EF1α-CD9 plasmid was constructed by inserting the human CD9cDNA sequence in the TRIP∆3-EF1α vector (A generous gift from Anne Dubart-Kupperschmitt); Sirven et al., 2001 | Lentiviral vector backbone | |
| Transfected construct (HIV-1) | pCMVR8,74 | Addgene | #22036 | From Trono lab, 2nd generation lentiviral packaging plasmid. |
| Transfected construct (VSV) | pMDG2 | Addgene | #12259 | From Trono lab, VSV-G envelope expressing plasmid |
| Transfected construct (H. sapiens) | lentiCRISPRv2 targeting human CD9 | CD9 target: GAATCGGAGCCATAGTCCAA | lentiCRISPRv2: Addgene #52961 | Lentiviral vector |
| Transfected construct (H. sapiens) | lentiCRISPRv2 targeting human CD81 | CD81 target: AGGAATCCCAGTGCCTGCTG | lentiCRISPRv2: Addgene #52961 | Lentiviral vector |
| Antibody | Mouse monoclonal anti-CD9 IgG1 TS9 | Le Naour et al., 2006 | TS9 Diaclone: #857.750.000 | IF (1:1000), WB (1:1000) |
| Antibody | Mouse monoclonal anti-CD46 | Lozahic et al., 2000 | Live (1/100) | |
| Antibody | Secondary goat polyclonal antibodies- Alexa fluor | In vitrogen (Thermo Fisher Scientific) | Various references | IF (1/1000) |
| Antibody | Mouse monoclonal anti-CD81 IgG2a | Charrin et al., 2001 | Diaclone: # 857.780.000 | IF (1:1000), WB (1:1000) |
| Antibody | Mouse monoclonal anti ITGB1 IgG1 | Le Naour et al., 2006 | IF (1:500) | |
| Antibody | Mouse monoclonal anti-CD151 IgG1 | Charrin et al., 2001 | Merck Millipore # MABT59 | IF (1:500) |
| Antibody | Mouse monoclonal anti-vinculin | Sigma | #V9264 | IF (1/1000) |
| Antibody | Rabbit polyclonal anti-paxillin | Santa-Cruz | #Sc-5574 | IF (1/1000) |
| Antibody | Purified Mouse monoclonal anti-GM130 IgG1 | BD transduction laboratories | BD 610823 | IF (1/1000) WB (1/1000) |
| Antibody | Mouse monoclonal anti-CD63 IgG1 | Charrin et al., 2001 | TS63 | WB (1/1000) |
| Antibody | Mouse monoclonal anti-ADAM10 11G2 | Arduise et al., 2008 | Diaclone: #857.800.000 | WB (1/1000) |
| Antibody | Rabbit polyclonal anti-alpha GAPDH | Sigma | #G9545 | WB (1/1000) |
| Antibody | Mouse monoclonal anti-actin, clone C4 | MP Biomedicals | SKU: 0869100-CF | WB (1/1000) |
| Antibody | Mouse monoclonal anti-alpha tubulin | Sigma | #T9026 | WB (1/2000) |
| Antibody | Rabbit polyclonal anti-ITGB1, ITGB4, ITGA4 | Cell Signaling | #4749 | WB (1/1000) |
| Antibody | Rabbit monoclonal anti-EGFR | Cell Signaling | #4267 | WB (1/1000) |
| Antibody | Rabbit polyclonal anti-Cx43 /GJA1 | Sigma | #C6219 | WB (1/3000) |
| Antibody | Mouse monoclonal anti-ANXA2 | Proteintech | #66035 | WB (1/2000) |
| Antibody | Mouse monoclonal anti-Alix, clone 3A9 | Biorad | #MCA2493 | WB (1/1000) |
| Antibody | Rabbit polyclonal anti-calnexin | Enzo | #SPA-860 | (WB 1/1000) |
| Sequence-based reagent | siRNA: non-targeting control | Origene | #SR30004 | |
| Sequence-based reagent | small double stranded RNA oligonucleotides targeting human CD9 | Silvie et al., 2006 | GAG CAT CTT CGA GCA AGA A- | |
| Sequence-based reagent | small double stranded RNA oligonucleotides targeting human CD81 | Silvie et al., 2006 | CAC GTC GCC TTC AAC TGT A- | |
| Commercial assay or kit | Lipofectamine RNAiMAX | Invitrogen | Transfection of siRNAs | |
| Commercial assay or kit | Lipofectamine 2000 | Invitrogen | Transfection of plasmids in SH-SY5Y cells | |
| Commercial assay or kit | Fugene HD | Promega | #E2311 | Transfection of plasmids in HEK293T and U2OS cells |
| Commercial assay or kit | Lenti-X Concentrator | TakaraBio | #631232 | |
| Commercial assay or kit | VivaSpin 20 | Cytiva | #28932360 | MWCO 10 kD |
| Software, algorithm | ProteoMap | https://www.proteomaps.net/; Liebermeister et al., 2014 | ||
| Software, algorithm | DAVID | https://david.ncifcrf.gov/; Sherman et al., 2022 | ||
| Software, algorithm | STRING | https://string-db.org/; Szklarczyk et al., 2021 | RRID:SCR_005223 | |
| Software, algorithm | Cytoscape | https://cytoscape.org/ | RRID:SCR_003032 | |
| Software, algorithm | ICY | https://icy.bioimageanalysis.org/ | RRID:SCR_010587 | |
| Software, algorithm | PHOTOSHOP v23.5.5 | Adobe Systems | RRID:SCR_014199 | EVP diameter quantification |
| Software, algorithm | R package imp4p | https://rdrr.io/cran/imp4p/man/imp4p-package.html; Giai Gianetto, 2021 | ||
| Other | DAPI stain | Invitrogen | D1306 | (1 µg/mL) |
| Other | WGA, Alexa Fluor-conjugated | Invitrogen | (1/400) |
Additional files
-
Supplementary file 1
The full TNTome (1177 proteins), from 12 independent samples, proteins were conserved when present in more than 9 replicates, ranked in four quartiles (from higher to lower mean iBAQ) represented in different colors (orange Q1, green Q2, pink Q3, blue Q4).
iBAQ of each sample is indicated for each protein. GO terms are indicated in the last columns.
- https://cdn.elifesciences.org/articles/99172/elife-99172-supp1-v1.xlsx
-
Supplementary file 2
Cytoskeleton-associated proteins of the TNTome.
Proteins identified by GO term analysis (cellular components), except those associated to proteasome, RNA and mitochondria, are ranked according to their quartile assignment (orange Q1, green Q2, pink Q3, blue Q4).
- https://cdn.elifesciences.org/articles/99172/elife-99172-supp2-v1.xlsx
-
Supplementary file 3
Membrane-related proteins identified by GO term analysis (cellular components).
Mitochondrial and other organelles membrane proteins have been discarded from GO analysis. Tab 1 lists all membrane and membrane-associated proteins, tab 2 only the integral membrane proteins, ranked according to their quartile assignment (orange Q1, green Q2, pink Q3, blue Q4) and from more abundant to less abundant. Integrins, Ephrin receptors, Cadherins, and tetraspanin-related proteins are highlighted, respectively in orange, red, dark green and yellow as indicated in tab2.
- https://cdn.elifesciences.org/articles/99172/elife-99172-supp3-v1.xlsx
-
Supplementary file 4
Comparison of TNTome and Integrin adhesion complexes shows the common elements in integrin adhesion complexes (2240 proteins according to Horton et al., 2015) and in TNTome: 765 proteins listed in alphabetical order of the gene name (yellow background).
On the right (blue background) are the 413 elements included exclusively in TNTome. Tab2 shows the 26 common elements in consensus adhesome (Horton et al., 2015) and TNTome.
- https://cdn.elifesciences.org/articles/99172/elife-99172-supp4-v1.xlsx
-
Supplementary file 5
TNT-only proteins.
Tab 1 (total) shows the 174 proteins present in TNT preparations and absent from extracellular vesicles and particles (EVPs). Tab2 (constitutive) shows the 89 tunneling nanotube (TNT)-only proteins without proteins described as mitochondrial, nuclear, ER or RNA-related. In yellow background are cytoskeleton-related proteins (20%).
- https://cdn.elifesciences.org/articles/99172/elife-99172-supp5-v1.xlsx
-
Supplementary file 6
Overlapping proteins between tunneling nanotubes (TNTs) and extracellular vesicles and particles (EVPs).
Tab1 (TOT TNT >EVP) shows the proteins more abundant in TNTs compared to EVPs, cleaned of nuclear, mitochondrial or RNA-related described proteins in tab2 (TNT >EVP). In yellow background are cytoskeleton-related proteins (29%). Tab7 shows the proteins present in EVPs and not in TNTs (except for the 10 proteins in grey background that were in the full TNTome).
- https://cdn.elifesciences.org/articles/99172/elife-99172-supp6-v1.xlsx
-
Supplementary file 7
Common proteins between TNTome and protrusions from hCAD cells described in Gousset et al., 2019.
The 190 proteins present in two samples of hCAD (mouse CAD cells treated with H2O2) were converted to their human ortholog, next compared to the 1177 proteins of Supplementary file 1.
- https://cdn.elifesciences.org/articles/99172/elife-99172-supp7-v1.xlsx
-
Supplementary file 8
Excel spreadsheet containing, in separate sheets, the underlying numerical data and statistical analysis for Figure panels 1C, 1E, 3C, 3E, 3F, 3G, 4B, 4C, 5B, 5C, 5E, 5F, 6G, 7A, 7C, S1D, S1E, S1G, S1H, S3C, S5B, S5D, S5F, S6B, S6C, S6E, S6F, S7A, S7B.
- https://cdn.elifesciences.org/articles/99172/elife-99172-supp8-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/99172/elife-99172-mdarchecklist1-v1.docx
