Introduction

Polyamines are flexible aliphatic cations that are found in virtually all organisms. E. coli contains putrescine (1,4-diaminobutane) and lesser amounts of spermidine (N-(3-aminopropyl)-1,4-diaminobutane), and cadaverine (1,5-diaminopentane) (1, 2). Both the pathways and enzymes of polyamine synthesis are redundant (Figure 1). Strains that lack eight of these genes do not contain detectable polyamines, grow slowly aerobically, and do not grow anaerobically (3). Polyamines interact with nucleic acids and phospholipids, can affect chromosome and ribosome structure, ribosome-mRNA interactions, and protein and nucleic acid elongation rates (4). Polyamines modulate, but are not required for, protein synthesis (5) and expression of hundreds of genes (6). A major mechanism of polyamine-dependent regulation is translational control of genes for 18 major transcription regulators: four of the seven σ factors – σ¹⁸ (FecI), σ²⁴ (RpoE), σ³⁸ (RpoS), and σ⁵⁴ (RpoN); three histone-like DNA-binding proteins (Fis, H-NS, and StpA); and CpxR, Cya, Cra, and UvrY (5, 6).

Figure 1

Polyamines control flagella-dependent surface motility of Proteus mirabilis and pili-dependent surface motility (PDSM) of E. coli: the latter has been reported to require the polyamine spermidine (7, 8). While reconstructing putrescine-deficient strains to characterize the basis for the anaerobic growth defect, we noticed that a mutant unable to synthesize spermidine moved normally, while mutants lacking enzymes of putrescine synthesis moved poorly. We characterized the role of polyamines on E. coli surface motility and pili synthesis by genetic analysis, ELISA assays, RT-qPCR, electron microscopy, and RNAseq. We showed that PDSM and pili synthesis required two independent pathways of putrescine synthesis, but did not require spermidine, and was modulated by putrescine transport and catabolism. Results from an RNAseq analysis are consistent with multiple mechanisms of putrescine-dependent control, and, unexpectedly, suggests a putrescine homeostatic network that rewires metabolism to maintain intracellular putrescine.

Results

W3110 surface motility requires pili

An assessment of surface motility for E. coli K-12 and eight derivatives showed five strains covered a plate in 12-18 hours, while four did not traverse a plate in 36 hours (9). The slow-moving strains generated genetically stable fast-moving variants which suggests that the former were ancestral. We chose our lab strain of W3110 for further study because (a) it exhibited the least variability in spreading diameter and generated fewer fast-moving variants, and (b) we had previously analyzed this strain for the energy requirements for surface motility (10). We refer to our slow-moving lab strain hereafter as W3110 but not all W3110 strains move similarly: the W3110 from the genetic stock center is a fast-moving variant (9).

Several results suggested that W3110 requires pili for surface motility. First, deletion of fimA, which codes for the major type 1 pili subunit, abolished the oscillatory pattern and reduced, but did not eliminate, surface motility, but deletion of fliC which encodes the major flagellum subunit did not affect surface motility (Figure 2A). Second, electron microscopy confirmed that W3110 isolated from surface motility plates possessed pili (Figure 2B). None of >500 cells expressed flagella. A mixed population of elongated (3-4 µm) and non-elongated (<2 µm) cells were visible, and pili were mostly associated with elongated cells. Finally, W3110 surface motility requires glucose (10) which should prevent flagella synthesis via inhibition of cyclic AMP synthesis (11). We confirmed that glucose suppressed swimming motility which implies suppression of flagella synthesis in W3110 during surface motility assays (Figure 2C). A W3110 derivative with deletions of both fliC and fimA still exhibited outward movement on a surface motility plate (Figure 2A), but electron microscopy showed the absence of appendages (Figure 2C). In summary, genetics, electron microscopy, and a glucose requirement show that W3110 surface motility requires pili.

Figure 2.

Results from W3110 sequencing found an IS1 insertion in fimE which could explain its greater movement that is less variable and greater genetic stability. The FimB and FimE recombinases are the major components of phase variation that determines the orientation of the promoter that initiates transcription of the fimAICDFGH operon which codes for the pili structural proteins. The FimB recombinase favors the productive ON orientation, while the more active FimE recombinase favors the unproductive OFF orientation (12–14). The insertion in fimE is the likely basis for the relative stability of W3110.

PDSM required two independent putrescine synthesis pathways

We examined PDSM requirements for polyamine anabolic pathways. A major putrescine biosynthetic pathway is ornithine decarboxylation either by the constitutive SpeC or the low-pH inducible SpeF. The ΔspeC and ΔspeF mutants moved as well as the parental strain, but a ΔspeC ΔspeF double mutant moved less well (Figure 3). SpeA (arginine decarboxylase) and SpeB (agmatinase) catalyze an alternate two-step putrescine synthetic pathway (Figure 1) (15): deletion of either gene reduced surface motility (Figure 3). The DspeA, DspeB, and DspeC DspeF strains grew as well as the parental strain (Supplemental Figure 1A) and had normal swimming motility (Supplemental Figure 1B). A ΔspeE mutant, which lacks the enzyme for spermidine synthesis, moved on a surface as well as the parental strain (Figure 3).

Figure 3.

Supplemental putrescine at 1 mM restored surface motility of a speB mutant (Figure 4A) and a speA mutant (not shown). Spermidine did not restore wild type movement and, also, caused an unusual pattern of movement in the parental strain (Figure 4A). These exogenous concentrations of putrescine and spermidine had no effect on growth rates in liquid motility medium (not shown). In summary, PDSM required the simultaneous presence of two independent pathways of putrescine synthesis but did not require spermidine.

Figure 4:

Loss of putrescine transport systems affected surface motility

E. coli has several polyamine transport systems and one has been reported to require for surface motility (16, 17). Mutants lacking the PlaP and PotF putrescine transporters had 50% and 40% reduced surface motility, respectively, and lost the concentric ring pattern (Figure 5A). Loss of the PotE and PuuP transporters affected neither the movement diameter (Figure 5B) nor concentric ring formation (Figure 5A). We note that potF and plaP are more highly expressed than potE and puuP (85, 64, 17, and 6 counts per million transcripts, respectively) for W3110 grown in liquid motility medium (18). We conclude that extracellular putrescine and its transport contribute to PDSM.

Figure 5:

Putrescine catabolism affected surface motility

Because putrescine catabolism modulates intracellular putrescine concentrations (19, 20), we examined PDSM in putrescine catabolic mutants. The major putrescine catabolic pathway is initiated with putrescine glutamylation (Figure 6A, right column), and a second pathway initiates with putrescine deamination (Figure 6A, left column) (20). Deletion of either puuA or patA which code for the first enzymes of their respective pathways did not affect surface motility (Figure 6B). A double mutant moved less well which was unexpected because the proposed higher intracellular putrescine should have stimulated PDSM. Consistent with the stimulatory effect of putrescine, loss of puuR which codes for the repressor of PuuA-initiated pathway genes (20), impaired PDSM (Figure 6B). One possible explanation to reconcile these seemingly contradictory results is that an optimal polyamine concentration stimulates PDSM, and a high concentration is inhibitory. The next section describes experiments to test this possibility.

Figure 6:

High putrescine reduced expression of pili genes

High putrescine inhibits translation of some mRNAs, and high spermidine, a product of putrescine metabolism, inhibits growth (21, 22). If the phenotype of the ΔpatA ΔpuuA double mutant results from spermidine toxicity, then loss of spermidine synthase (SpeE) should reverse the phenotype. This prediction was not met which argues against spermidine toxicity (Figure 6C). For the speB mutant, 1 mM putrescine stimulated PDSM, and 4 mM putrescine was slightly inhibitory (Figure 7A and B). The concentric ring pattern was observed with 1 mM, but not 4 mM putrescine. RT-qPCR to test transcriptional regulation of pili expression by putrescine showed optimal fimA transcription at 1 mM putrescine in the speB mutant (Figure 7C). Indirect enzyme linked immunosorbent assays (ELISAs) against FimA suggested that the level of FimA in the speB mutant at 1 mM putrescine was higher than with 4 mM putrescine, but the difference was not statistically significant (Figure 7D). Variation of supplemental putrescine did not affect FimA in the parental strain (Figure 7C and 7D). Transmission electron microscopy (TEM) showed that pili expression was highest for the speB mutant at 1 mM putrescine (Figure 8), moderate at 0.1- and 4-mM putrescine, and undetectable without putrescine. The cells grown with 4 mM putrescine were shorter and thinner, which suggests stress, possibly mimicking osmotic stress. From these results and those in the previous section, we conclude that pili expression required an optimal putrescine concentration.

Figure 7:

Figure 8:

RNAseq analysis identifies fim operon expression and energy metabolism as targets of putrescine control

RNAseq analysis was used to further confirm or determine whether putrescine affected (a) transcription of the fim operon that codes for the pili structural genes, (b) fim operon promoter orientation, i.e. phase variation, or (c) energy metabolism: surface motility of W3110 has been shown to require glucose metabolism and oxidative phosphorylation (10).

RNAseq analysis

We grew parental W3110 and its ΔspeB derivative with and without 1 mM putrescine. R² values of pairwise comparisons showed that the transcriptome of the speB mutant grown without putrescine differed from the other transcriptomes which were similar (Table 1 and Supplemental Figure 2). A multidimensional scaling plot and a plot of the 100 most variable genes visualize these comparisons (Figure 9A and B). When compared to the parental strain, the speB mutant grown without putrescine had 310 downregulated genes and 159 upregulated genes with at least four-fold differential expression and FDR < 0.05. Transcripts for the putrescine-induced puuAP and puuDRCBE operons, which specify genes of the major putrescine catabolic pathway, were reduced from 1.6- to 14-fold fold (FDR ≤ 0.02) in the speB mutant (Supplemental Table 1). Because higher intracellular putrescine results in higher catabolic gene expression, these results imply lower intracellular putrescine in the ΔspeB mutant.

Figure 9:

Table 1.

Transcription of the fim operon is reduced in the ΔspeB mutant

Deletion of speB reduced transcripts for genes of the fimA operon (Figure 10A). Numerous transcription factors activate the fim operon (23, 24), and, of these, loss of speB reduced hns transcripts, increased fis, lrp, and qseB transcripts, but had no effect on ihfA and ihfB (Figure 10B). Loss of hns, ihfA, and lrp impaired PDSM (Figure 10C and D), which confirms the requirement for their products for pili synthesis in our strain background.

Figure 10:

Putrescine does not control fim operon phase variation in W3110. The phase ON-favoring

FimB and phase OFF-favoring FimE recombinases control the orientation of the fim operon promoter. Our version of W3110 has an insertion in fimE which means that FimB is the major factor that controls phase variation. Loss of speB reduced transcripts from fimB which could account for loss of motility. Using specific primers, PCR analysis showed that loss of speB, loss of hns, or the presence of putrescine did not alter the ratio of ON to OFF (Supplemental Figure 3). This experiment determines the steady state phase ON to OFF ratio, which less FimB might not affect if FimB is in excess. In strains with FimE, the rate of phase ON orientation will be much slower and even small changes in FimB activity could conceivably affect the switch orientation. We conclude that putrescine does not control phase variation, at least in our strain of W3110.

Evidence for a putrescine homeostatic network

Altered transcript levels in the speB mutant suggest compensatory mechanisms for low putrescine (Supplemental Table 1 for transcript differences for all genes, Table 2 for selected genes, and Figure 11 for a diagrammatic representation of transcript differences). The speB mutant had more transcripts from (a) genes of arginine and ornithine carboxylase, (b) all genes of ornithine and arginine synthesis from glutamate, and (c) genes for three separate putrescine transport systems; and fewer transcripts from the sap operon which codes for a putrescine exporter (25) and rpmH and rpsT, whose products inhibit ornithine and arginine decarboxylase (26). The net effect of these changes should be to increase intracellular putrescine (solid arrows in Figure 11). In other words, these changes are compensatory for low putrescine. In addition to these changes, the speB mutant had 60-fold and 7-fold more transcripts for mgtA and phoBR which code for the major magnesium transporter and the regulators of phosphate assimilation, respectively. These changes may also be compensatory and are discussed below.

Figure 11:

Table 2.

Putrescine affects energy metabolism which could account for loss of motility

Loss of speB affected transcripts for genes of the major energy metabolism pathways (Table 2): fewer transcripts for genes coding for all citric acid cycle enzymes, NADH dehydrogenase I (the entire nuo operon), cytochrome oxidase (the cyo operon), and several genes of menaquinone (the menFDHBCE operon), ubiquinone, and heme synthesis. The speB mutant also had fewer transcripts for all genes of iron acquisition, which is consistent with diminished oxidative energy generation. A speB mutant had fewer transcripts for ptsH (Hpr of the phosphotransferase system of carbohydrate transport), ptsG (enzyme IIBC component of glucose transport), gltA (citrate synthase), sdhA (a succinate dehydrogenase subunit), and sucC (a succinyl-CoA synthetase subunit), and their loss has been shown to either impair or eliminate W3110 surface motility (10). The cumulative effect of these differences could account for the motility defect in the speB mutant.

Discussion

Several aspects of polyamine metabolism affect PDSM in E. coli. Strains with loss of one or two polyamine synthesis genes ― speA and speB single mutants and a speC speF double mutant ― resulted in PDSM defects. This observation is remarkable because nine enzymes and several pathways are involved in polyamine synthesis. Our putrescine synthesis mutants had no growth defect which is not unexpected since deletions of eight biosynthetic genes were required to show a strong phenotype: impaired aerobic growth and elimination of anaerobic growth (3). Strains with defects in the two most active putrescine transport systems had altered PDSM. The specific defects suggest the involvement of extracellular putrescine and arginine in intracellular putrescine homeostasis. The PDSM defect of putrescine transport mutants not only implicates extracellular putrescine but also suggests secretion of putrescine which is not added to the medium. The PDSM defect of speA and speB mutants implicates extracellular arginine because SpeA is mostly periplasmic (27). Defective putrescine catabolism also affected PDSM. The role of both putrescine synthesis and degradation suggests rapid adjustments to fluctuating putrescine concentrations and environmental conditions: putrescine catabolism is a core response to several stresses (19).

Results from an RNAseq analysis showed that transcription of the fim operon was reduced in the speB mutant. Of the known transcription factors that control the fim operon, only the gene for H-NS had fewer transcripts. In contrast, transcripts for other relevant transcription factor genes were elevated in the speB mutant. Our results are consistent with H-NS mediating putrescine-dependent control, but we cannot exclude a general regulatory dysfunction mediated by altered nucleoprotein complexes at the fim operon promoter. The elevated transcripts for some transcription factors may be inhibitory.

The transcriptomic results showed that the speB mutant had more transcripts for genes whose products will maintain intracellular putrescine, which suggests compensatory mechanisms for low intracellular putrescine (Figure 11). The speB mutant also had more transcripts for magnesium and phosphate transport genes. The elevated transcripts for magnesium transport genes could compensate for low putrescine to the extent that magnesium can directly replace putrescine, e.g., binding to nucleotides and RNA (28). Two recent studies observe an inverse correlation between intracellular magnesium and polyamines in Salmonella and proposed that either magnesium or the polyamines maintained an overall divalent cation homeostasis (29, 30). The rationale for an increase in anionic phosphate assimilation is less clear, although the major phosphate permease transports metal-phosphates, including magnesium-phosphate (31), which could help to compensate for low putrescine. Regardless of the rationale, the substantial changes in gene expression due to low putrescine suggest multiple compensatory mechanisms.

A major observation of the RNAseq analysis is that loss of speB lowered transcripts for many genes of energy metabolism and all genes of iron acquisition. This gene expression pattern suggests that low putrescine diverts metabolism away from energy generation and toward putrescine synthesis, i.e., a prioritization of putrescine synthesis over aerobic energy metabolism. Oxidative energy metabolism and putrescine synthesis compete for α-ketoglutarate and the metabolic diversion could also be a potential compensatory mechanism for low putrescine. Another way of looking at this relationship is that intracellular putrescine positively correlates with oxidative energy metabolism. Deletion of ptsH, ptsG, gltA, sdhA, and sucC have been shown to impair W3110 PDSM which suggests that a major, possibly the primary, effect of low putrescine is reduced energy generation.

In contrast to our results, a thorough and well-designed study showed that E. coli PDSM requires spermidine instead of putrescine (8). The differences between the studies were strain backgrounds, media (glucose-LB vs glucose-tryptone), and incubation temperature (33⁰ vs 37⁰). We found PDSM results for 37⁰ incubations were highly variable and resulted in numerous fast-moving variants. Since growth at the higher temperature is faster, and faster growth is associated with higher putrescine (32), we propose that growth at 37⁰ results in an inhibitory putrescine concentration. In this case, spermidine would be stimulatory because of its known inhibition of the putrescine biosynthetic enzymes SpeA and SpeC (33, 34) and subsequent reduction of intracellular putrescine to an optimal concentration. Regardless of the explanation, strains differences are not unexpected because of decades of strain passage for the strains employed with resulting laboratory evolution that can affect any of the numerous factors that control the intracellular putrescine concentration.

The transcript changes observed in our study were different from those in the only other systematic study of putrescine’s effect on E. coli gene expression (6). Both studies had almost identical experimental designs: 1.0- or 1.14-mM putrescine was added to a speB or speB speC mutant, respectively. Differences in strains, growth media (minimal media vs tryptone-containing media), and growth temperature (33⁰ vs 37⁰) could account for the discrepancy in results. The most crucial difference could be the growth media: Igarashi and colleagues grew bacteria in a minimal medium, while we grew bacteria in an amino acid-containing medium that was required for surface motility. We propose that the slower growth in minimal medium, possibly correlated with higher guanosine tetraphosphate which is associated with slower growth, counters and obscures many growth-stimulatory putrescine effects. In contrast, the growth stimulation from the amino acids in our medium would not counter putrescine effects and would essentially allow detection of effects caused solely by changes in putrescine concentrations. Regardless of the explanation, common results can be interpreted as core responses to putrescine limitation. Both studies observed that low putrescine increased transcripts for genes of arginine synthesis and magnesium transport, and reduced transcripts for the sdhCDAB-sucABCD operon which codes for three TCA cycle enzymes. The link between putrescine and arginine synthesis is probably mediated by the ArgR repressor because argR transcripts are 2.5-fold lower (FDR = 0.0004) in the speB mutant (Supplemental Table 1).

Several results implicate putrescine in E. coli virulence during urinary tract infections. First, pili-dependent binding to the urothelium is an essential step for uropathogenic E. coli (35). Second, putrescine is present in urine from infected, but not healthy, individuals (36, 37). Third, urinary putrescine can result from uropathogenic E. coli growth in urine (37) and urothelial pathophysiology (38). Putrescine’s possible role in virulence is seemingly contradicted by the observation that a speB mutant outcompetes the parental CFT073 in the bladder of mice, i.e., less putrescine synthesis enhanced virulence (39). A majority of uropathogenic E. coli are associated with phylogenetic group B2―including CFT073, whereas most E. coli lab strains, such as W3110, are group A. Group B2 strains lack genes for the major putrescine catabolic pathway and have significantly higher transcripts for genes coding for SpeA and SpeB (18). Both observations suggest that the cytoplasmic putrescine concentration is higher in group B2 strains. We propose that the putrescine concentration in group B2 strains is normally in the inhibitory range for pili synthesis, and that loss of SpeB reduces putrescine to a level that stimulates pili synthesis. Regardless of the explanation, putrescine control of pili synthesis and other processes in uropathogenic E. coli are worth examination.

Experimental Procedures

Strains

All strains used for growth rate determinations and motility assays were derivatives of E. coli K-12 strain W3110 and are listed in Table 3. Great variations exist in standard lab strains, including W3110, from different labs. We initially tested nine strains derived from E. coli K-12, mostly from the Coli Genetic Stock Center (9), and chose our lab strain because of relative genetic stability and more quantitatively reproducible results. Our strain originated from the lab of Jon Beckwith in the 1960s via the lab of Boris Magasanik where it had been stored in a room temperature stab until the mid-1980s, at which time it was revived and frozen at −80⁰ C. To construct the mutant strains, the altered allele was obtained from the Keio collection in which the gene of interest had been deleted and replaced with an antibiotic resistance gene (40). The marked deletion allele was transferred into W3110 by P1 transduction (41). The antibiotic gene was removed as described which generated an in-frame deletion (42).

Table 3.

Media and Growth Conditions

For P1 transductions and plasmid transformation experiments, cells were grown in standard LB liquid medium (1% tryptone, 1% NaCl and 0.5% yeast extract, pH 7.0) at 37°C. Antibiotics were used for selection at concentrations of 25 µg/mL (both chloramphenicol and kanamycin). For growth analysis, bacteria were grown in liquid motility medium (0.5% glucose, 1% tryptone, and 0.25% NaCl) which we refer to as GT medium. Starter cultures (typically 6–12 h incubation) were grown in GT medium, harvested by centrifugation, washed twice with phosphate buffered saline and re-suspended in GT medium before inoculation. The cells were then grown at 37° C in aerobic conditions (shaking at 240 rpm) and the turbidity was measured every thirty minutes. Cell growth was measured in Klett units using a Scienceware Klett colorimeter with a KS-54 filter. 100 Klett units represent an OD₆₀₀ value of about 0.7.

Surface motility assay

For a standard surface motility assay, single colonies from fresh plates (streaked out from frozen stocks a day before) were inoculated in GT medium for six hours at 37° C in aerobic conditions (shaking at 240 rpm). 30 ml of autoclaved GT medium with 0.45% agar (Eiken, Tokyo, Japan) was poured into sterile polystyrene petri-dish (100 mm X 15 mm) and allowed to solidify at room temperature for approximately six hours. Then, 1 µL of the pre-motility growth medium was inoculated at the center of the agar plate and incubated at 33° C for 36 hrs. Each experiment was performed in triplicate and pictures were taken after 36 hours. Surface motility was extremely sensitive to humidity. Opening the incubator before 36 hours resulted in movement cessation. The surface motility assay was performed at 33⁰ C because results from incubations at 37⁰ C were highly variable and the cultures more frequently generated genetically stable fast-moving variants.

Swim assay

The media and culturing for swimming motility is identical to that for surface motility, except that the plates contained 0.25% agar and were solidified at room temperature for about one hour before inoculation. Then, 1 µL of the culture was stabbed in the center of this swim agar plate and incubated at 33° C for 20 hours. Each experiment was performed in triplicate.

Transmission electron microscopy

Cells from surface motility plates were collected and fixed with 2.5% glutaraldehyde. Bacteria were absorbed onto Foamvar carbon-coated copper grids for 1 min. Grids were washed with distilled water and stained with 1% phosphotungstic acid for 30 s. Washed and stained grids were dried at 37⁰C for 10 minutes. Samples were viewed on a JEOL 1200 EX transmission electron microscope at University of Texas Southwestern Medical Center (Figure 2) and University of Texas at Dallas (Figure 8).

ELISA analysis

Cells were grown overnight in 5 mL GT media followed by a 2-hour growth in GT media with 0.0, 0.1, 1.0, or 4.0 mM putrescine. Cells were then lysed using a 24-gauge needle. The cell lysate was diluted to a concentration of 1 mg/mL protein (based on A280) in pH 9.6 coating buffer (3 g Na₂CO₃, 6 g NaHCO₃, 1000 mL distilled water) and then coated onto the walls of a 96-well plate by incubating overnight at 4°C. The wells were rinsed 3 times with PBS and further blocked using coating buffer with 1% bovine albumin overnight at 4°C. The following day, wells were rinsed 3 times with PBS, and primary antibodies to FimA or RpoD were added following supplier directions. After a 2-hour room temperature incubation, secondary antibodies conjugated to HRP were added and incubated for a further two hours. HRP was activated using the TMB substrate kit (Thermo-34021) following the provided protocol. Expression was read on a BioTek plate reader based on the provided kit protocol. Data was blanked to wells only treated with bovine albumin then normalized to RpoD. Data was generated from technical and biological triplicates.

DNA isolation and genome assembly and annotation for W3110

DNA was isolated based on previous established protocols (43). Short reads were sequenced at the SeqCenter (Pittsburgh, Pennsylvania) using Illumina tagmentation-based and PCR-based DNA prep and custom IDT indices targeting inserts of 280 bp without further fragmentation or size selection steps. The Illumina NovaSeq X Plus sequencer was ran producing 2X151 paired-end reads. Demultiplexing, quality control, and adapter trimmer was performed with bcl-convert (v4.2.4). Total Illumina Reads (R1+R2): 4059078 with 553087045 bps >Q30.

Long reads were prepared using the PCR-free Oxford Nanopore Technologies ligation sequencing kit with the NEBNext companion module. No fragmentation or size selection was performed. Long read libraries were performed using R10.4.1 flow cell. The 400bps sequencing mode with a minimum read length of 200bp were selected. Gupply (v6.5.7) was used at the super-accurate basecalling, demultiplexing, and adapter removal. Total long reads: 53773 with 89.607 % of bps > Q20.

To generate the completed genome, porechop (v0.2.4) was used to trim residual adapter sequences from long reads. Flye (v2.9.2) was used to generate the de novo assembly under the nano-hq model. Reads longer than the estimated N₅₀ based on a genome size of 6Mbp initiated the assembly. Subsequent polishing using the short read data was performed using Pilon (v1.24) under default parameters. Long read contigs with an average short read coverage of 15X or less were removed from the assembly. The assembled contig was confirmed to be circular via circulator (v1.5.5). Annotation was performed using prokka (v 1.14.6). Finally, statistics were recorded using QUAST (v5.2.0). The final genome contained 1 contig of 4750347 bp with a sequencing depth of 123.92x. The N₅₀ was 4750347. This genome can be accessed via the accession number CP165600 or via the BioProject PRJNA1142534 via NCBI. The completed genome has an estimated average nucleotide identity of 99.9694 to the W3110 genome deposited to NCBI (genome assembly ASM1024v1).

RNA isolation and quality control

Cells were grown for 2 hours in 1 mL GT media. 60 µL were then added to 1 mL of fresh GT, with or without 1 mM putrescine, and grown for another two hours. After growth, the cells were centrifuged, and frozen at −80⁰C. The isolation and analysis protocol has been previously published (18). Cell pellets were thawed, resuspended in 0.7 mL of buffer RLT (Qiagen RNeasy kit), and mechanically lysed using a bead beater (FastPrep-24 Classic from MP Biomedical) set at the highest setting for three 45-s cycles with a 5-min rest period on ice between cycles. Cell lysates were used to isolate RNA using a Qiagen RNeasy mini kit. RNA was quantified, DNase treated, and re-quantified on a nanodrop. RNA that passed the first quality check was analyzed on RNA-IQ (Qubit). RNA with an IQ higher than 7.5 was used. RNA that passed both checks were run on an agarose gel to check for RNA integrity. RT-qPCR was used to ensure there was no DNA contamination. RNA libraries that passed all these quality checks were submitted to the genomics core facility at The University of Texas at Dallas for RNA sequencing. The core performed rRNA removal (RiboMinus Transcriptome Isolation Kit or RiboCop bacterial rRNA depletion—Lexogen), library preparation (Stranded Total RNA Prep—Illumina), and single-end Illumina sequencing.

Reverse transcription quantitative PCR

RNA was isolated as described above. One microgram of RNA was reverse transcribed using LunaScript RT Super Mix (NEB E3010) and another microgram was subjected to the same reaction as the reverse transcribed RNA, except without reverse transcriptase (negative control) following manufacturer instructions. The cDNA was then diluted to 10 ng/µL for qPCR. PCR reactions were composed of 10 ng cDNA, 8 µL of nuclease free water, 10 nM primers (rpoD: Forward: TCGTGTTGAAGCAGAAGAAGCG; Reverse: TCGTCATCGCCATCTTCTTCG) (fimA: Forward: ATGGTGGGACCGTTCACTTT; Reverse: GGCAACAGCGGCTTTAGATG), and PowerUp SYBR Green 2X master mix for qPCR (ThermoFisher A25777) in a 20 µL reaction. A Quantstudio 3 qPCR machine was used to generate critical threshold (Ct) values. The Ct values were then analyzed using the 2^-ΔΔC_T method (44) using rpoD as a library control.

RNAseq Analysis

Transcripts were aligned to the W3110 genome and CDS (CP165600) available on NCBI using CLC genomics workbench (Qiagen version 22.00) for RNA-seq analysis. The gene expression counts generated as this output were used to perform differentially expressed gene (DEG) analysis using EdgeR (version 3.38.4) to analyze read counts (45, 46). DEGs had an adjusted P-value less than 0.05.

Data availability

The raw RNA seq reads were deposited in GenBank: BioProject accession number PRJNA1126736. The genome was deposited in GenBank: BioProject accession number PRJNA1142534. The genome accession number is CP165600.

Acknowledgements

This work was funded through private donations. PEZ received endowment support from the Cain Foundation through the Felecia and John Cain Distinguished Chair in Women’s Health in honor of Philippe E. Zimmern, MD. The authors declare no potential conflicts of interests.

The authors (JH, SH, GV, and LR) would like to thank Prof. Kelli Palmer of The University of Texas at Dallas for the use of her space, supplies, and tissue homogenizer. JH would like to further thank Prof. Palmer for the use of her CLC genomics program. The authors would like to thank the Genome Center at The University of Texas at Dallas for the services to support our research. The authors would like to thank the Olympus Discovery Center/Imaging Core facility at UT Dallas for providing equipment and support (Figure 8), and the UT Southwestern Medical Center for electron microscopy (Figure 2).

Additional files

Supplemental figure 1. Growth and swimming of polyamine anabolic mutants.

Supplemental figure 2. Expression graphs comparing the logCPM of the transcriptomes of the average of the three replicates of W3110 with and without 1 mM putrescine and the speB mutant with and without 1 mM putrescine. A regression line was calculated and the correlation between each set of transcriptomes noted on the graph. Higher R² values indicate greater similarity between the transcriptomes.

Supplemental Figure 3. Phase variation in parental W3110, W3110 ΔspeB, W3110 Δhns, and MG1655

Supplemental Table 1. Differential gene expression analysis of W3110 and ΔspeB. J15 refers to the ΔspeB mutant. In the tab labeled “W3110_0_vs_J15_1_ Putrescine” W3110 was grown without putrescine, J15 was grown with 1.0 mM putrescine; positive fold change values refer to increases in J15 gene expression.