Abstract
Marsupials and placental mammals exhibit significant differences in reproductive and life history strategies. Marsupials are born highly underdeveloped after an extremely short period of gestation, leading to prioritization of the development of structures critical for post-birth survival in the pouch. Critically, they must undergo accelerated development of the oro-facial region compared to placentals. Previously we described the accelerated development of the oro-facial region in the carnivorous Australian marsupial, the fat-tailed dunnart Sminthopsis crassicaudata that has one of the shortest gestations of any mammal. By combining genome comparisons of the mouse and dunnart with functional data for the enhancer-associated chromatin modifications, H3K4me3 and H3K27ac, we investigated divergence of craniofacial regulatory landscapes between these species. This is the first description of genome-wide face regulatory elements in a marsupial, with 60,626 putative enhancers and 12,295 putative promoters described. We also generated craniofacial RNA-seq data for the dunnart to investigate expression dynamics of genes near predicted active regulatory elements. While genes involved in regulating facial development were largely conserved in mouse and dunnart, the regulatory landscape varied significantly. Additionally, a subset of dunnart-specific enhancers were associated with genes highly expressed only in dunnart relating to cranial neural crest proliferation, embryonic myogenesis and epidermis development. Comparative RNA-seq analyses of facial tissue revealed dunnart-specific expression of genes involved in the development of the mechanosensory system. Accelerated development of the dunnart sensory system likely relates to the sensory cues received by the nasal-oral region during the postnatal journey to the pouch. Together these data suggest that accelerated face development in the dunnart may be driven by dunnart-specific enhancer activity. Our study highlights the power of marsupial-placental comparative genomics for understanding the role of enhancers in driving temporal shifts in development.
Introduction
The vertebrate head is a highly complex region of the body that plays a key role in an organism’s ecology by centralizing numerous structures involved in diet, sensory perception and behavior1. Consequently, evolution has modified craniofacial development across lineages, producing a wide array of head morphologies concomitant with the diverse niches that vertebrates occupy. Craniofacial diversity among the major mammalian lineages in particular has long been of great interest, due to the striking differences in their developmental ontology.
Placental mammals are characterized by a long gestation with a high maternal investment during pregnancy with a considerable degree of both orofacial and neurocranial development occurring in the embryo in utero. As a result, the placental young experiences little functional constraint during early developmental stages. By contrast, marsupials have a short gestation and give birth to highly altricial young that must crawl to the teat, typically located within the maternal pouch, where they complete the remainder of their development ex utero. This unique reproductive method is thought to have imposed strong pressures on the evolution and development of the limbs and head. In particular, marsupials show accelerated development of the nasal cavity, tongue, oral bones and musculature relative to the development of the posterior end of the body2–5, and generally when compared to placental embryonic development2,3,6. Additionally,aspects of the peripheral nervous system appear to be accelerated in the face. We and others have observed large medial nasal swellings early in marsupial development that are innervated and proposed to be necessary for the sensory needs of newborn young in their journey to the pouch7–9. Comparative morphometric studies have provided a wealth of evidence that this stark difference in craniofacial development has imposed different regimes of constraint on marsupial and placental mammals2,3,5,6,10–12 with marsupials in particular showing significantly less interspecies variation in orofacial structures and nasal morphology than placental mammals12–14. In spite of these observations, the molecular mechanisms that underlie these differences in early craniofacial development between marsupial and placental remain poorly understood.
Cis-acting regulatory regions have been proposed to play a significant role in morphological divergence in the face, with a number of well-described enhancers that fine-tune face shape in mammals15. There is also some evidence of a role for regulatory regions in craniofacial heterochrony in marsupials. One recent study found a marsupial-specific region within a Sox9 enhancer that drives early and broad expression in pre-migratory neural crest cell domains contributing to early migration of cranial neural crest cells relative to the mouse16,17. However, no study has thus far attempted to compare the overall regulatory landscape between marsupials and placentals at developmentally comparable stages. Such surveys have the potential to provide functional insights into the loci controlling craniofacial heterochrony in mammals and consequently the causative evolutionary changes in the genome that have driven the divergent ontogenies of marsupials and placentals.
In recent years, the fat-tailed dunnart (Sminthopsis crassicaudata, hereafter referred to as the dunnart) has emerged as a tractable marsupial model species5,18. Dunnarts are born after 13.5 days of gestation and craniofacial heterochrony in line with what has been reported in other marsupials is readily observable2,3,5,6,10–12, making this species an excellent system for comparative studies with placental models. Being one of the most altricial marsupials, the dunnart provides an ideal model in which to study the regulatory landscape during craniofacial development in marsupials, as they rely entirely on the advanced chondrocranium with bony elements of the skeleton not present until approximately 24 hours after birth5. To investigate a potential role for regulatory elements in this heterochrony, we used ChIP-sequencing and RNA-sequencing on craniofacial tissue (fronto-nasal, mandibular and maxillary prominences) collected from new-born dunnart pouch young to perform a detailed characterization of chromatin marks during early craniofacial development and then to facilitate comparative analyses with the placental laboratory mouse. Our work provides valuable insights into genomic regions associated with regulatory elements regulating craniofacial development in marsupials and their potential role in craniofacial heterochrony.
Results
Defining craniofacial putative enhancer- and promoter regions in the dunnart
After validating the ability of our antibodies to enrich for dunnart chromatin marks (SupNote1), ChIP-seq libraries were sequenced to average depth of 57 million reads and mapped to a de novo assembly of the dunnart genome generated for this study (Methods for more details). Peak calling with MACS2 (q < 0.05) identified 80,989 regions reproducibly enriched for H3K4me3 and 121,281 regions reproducibly enriched for H3K27ac in dunnart facial prominence tissue. As this is the first epigenomic profiling for this species we performed extensive data quality control to ensure the robustness of the data. Similar to previous studies19–23, we found that H3K4me3 often (62% of all H3K4me3 peaks) co-occupied the genome with H3K27ac (Fig1A) while 50% of H3K27ac-enriched regions were only associated with this mark (Fig1A). Active enhancers are generally enriched for H3K27ac19,24 while sites of transcription initiation (active promoters) can be identified as being marked by both H3K27ac and H3K4me322,23.

Analysis workflow and quality control of H3K4me3 and H3K27ac peaks in the fat-tailed dunnart (Sminthopsis crassicaudata).
(A) Drawing of a D0 dunnart pouch young with dissected orofacial tissue shown in gray. Short-read alignment and peak calling workflow and numbers of reproducible peaks identified for H3K27ac (orange), H3K4me3 (blue) for craniofacial tissue. (B) Log10 distance to the nearest TSS for putative enhancer (orange) and promoters (blue). (C) Log10 of peak intensity and peak length are represented as boxplots and violin plots for putative enhancers (orange) and promoters (blue). Peak intensities correspond to average fold enrichment values over total input DNA across biological replicates. (D) Dunnart pouch young on the day of birth. Scale bar = 1mm. (E) Adult female dunnart carrying four young.
We initially defined promoters as those marked by only H3K4me3 or with >50% of reciprocal peak length for H3K27ac and H3K4me3 peaks, and enhancers as those marked only by H3K27ac, identifying 66,802 promoters and 60,626 enhancers. Enhancers were located on average 77 kb from TSS, while promoters were located on average 106 kb from the nearest TSS, despite there being a greater number of peaks located <1 kb from the TSS (1,008 enhancers versus 9,023 promoters; Fig1B). This was an unexpected finding as a large fraction (0.41) of promoters were located >3 kb from an annotated TSS (see SupNote2). H3K4me3 activity at enhancers is well-established25,26, however, compared to H3K4me3 activity at promoters, H3K4me3 levels at enhancers are low27.This is in line with our observations that H3K4me3 levels at enhancers are nearly 7 times lower than those observed at promoter regions (see SupNote2). Distance from TSS is frequently used to filter putative promoters from other elements. Therefore, we grouped peaks characterized as promoters based on their distance to the nearest TSS (see Methods), resulting in 12,295 high-confidence promoters for all of the following analyses (see SupNote3).
Candidate dunnart regulatory elements are associated with highly expressed genes involved in muscle, skin and bone development
Next, we asked what biological processes are associated with active regulatory regions in the dunnart face. To accomplish this, we linked peaks to genes in order to associate functional annotations of coding genes with the candidate regulatory elements that likely regulate their expression. To make use of resources available in model organisms such as GO databases, we converted all dunnart gene IDs to mouse orthologous genes for downstream applications. This reduced the dataset to 35,677 putative enhancers and 8,589 promoters near (within 1Mbp) genes with a one-to-one ortholog in mouse (SupTable1).
We found that gene annotations for both promoters and enhancers were enriched for 23% of the same GO terms, including cellular processes (protein localisation to plasma membrane, protein localisation to cell periphery, regulation of cell morphogenesis, positive regulation of cell migration) and development (axon development, camera-type eye development, muscle tissue development, striated muscle development). By contrast, 44% of GO terms were uniquely enriched amongst genes assigned to promoters and were related to mRNA processing, transcription, mRNA stability, cell cycle, and mRNA degradation (Fig2A, SupTable2) anduniquely enriched GO terms for genes assigned to candidate enhancers corresponded to processes indicative of early embryonic development (Fig2A, SupTable3).

Predicted functional enrichment for dunnart peaks.
(A) 304 significantly enriched GO terms clustered based on similarity of the terms. The function of the terms in each group are summarized by word clouds of the keywords. Rows marked by P were driven by genes linked to putative promoters, rows marked by E were driven by genes linked to putative enhancers. (B) Enriched TF motifs for transcription factor families (HOMER). PWM logos for preferred binding motifs of TFs are shown. The letter size indicates the probability of a TF binding given the nucleotide composition.
Terms related to facial skeleton development were enriched amongst genes assigned to putative dunnart enhancers, including bone cell development, muscle cell development, secondary palate development, roof of mouth development and mesenchyme development, consistent with dunnart craniofacial morphology5. Enhancers active near important palate genes28,29 such as SHH, SATB2, MEF2C, SNAI2 and IRF6 in the dunnart at birth may highlight potential regulatory mechanisms driving early palatal closure. In addition, terms related to development of the circulatory system, including regulation of vasculature development, circulatory system process and blood circulation were enriched amongst genes linked to predicted enhancer regions (for example, ACE, PDGFB, GATA4, GATA6, VEGFA). This is consistent with observations that show the oral region of newborn dunnarts is highly vascularised, with blood vessels visible through their translucent skin at birth5.
To gain further insight into dunnart gene regulation at this developmental stage, we scanned putative enhancers and promoters for 440 known Homer vertebrate motifs and tested for enriched TFs30. Enhancers were significantly enriched for 170 TFs relative to a background set of random GC- and length matched sequences (FDR-corrected, p < 0.01), including those with known roles in differentiation of cranial neural crest cells (TWIST, HOXA2), skeletal morphogenesis (DLX5, CREB5, HOXA2), bone development (ATF3, RUNX), cranial nerve development (ATOH1) and/or facial mesenchyme development (LHX2, FOXP1, MAFB; Fig2B, SupFig1). Consistent with the GO enrichment, TFBS in promoter sequences were dominated by transcriptional initiation regulatory sequences, with significant enrichment for 13 TFs (FDR-corrected, p < 0.01) including RFX3, RFX2, NRF, NRF1, GRY, ZBTB33, RONIN, JUND and GFX (Fig2B, SupFig1).
Next, we assessed predicted target gene expression by performing bulk RNA-seq in dunnart face tissue collected on the day of birth. There were 12,153 genes reproducibly expressed at a level > 1 TPM across three biological replicates, with the majority of genes expressed (67%; 8158/12153) associated with an active enhancer and/or promoter peak. Most enhancers (78% of all enhancers, SupTable4) or promoter (87% of all promoters, SupTable5) were linked to a reproducibly expressed gene in the dunnart (Fig3A) Additionally, the majority of reproducibly expressed genes near a regulatory peak (61%) were associated with both an enhancer and promoter region (Fig3B), highlighting the correspondence in active regulatory elements and expressed genes at this time point in the dunnart face. Genes with a medium-to-high expression level at this stage (>10 TPM) and associated with at least one putative enhancer and promoter were enriched for biological processes including “in utero embryonic development”, “skeletal system development”, “muscle tissue development”, “skin development”, “vasculature development” and “sensory organ development” (Fig3C, SupTable6). Enrichment for the term “in utero embryonic development” is indicative of the altricial nature of the dunnart neonate. In a previous study, we showed that in the dunnart ossification begins post-birth (day of birth young corresponding approximately to embryonic day (E) 12.5 in mouse) and that the dunnart neonate instead likely relies on the well-developed cranial muscles and an extremely large chondrocranium for structural head and feeding support during early pouch life5,31. Consistent with this, we observed high expression (>20 TPM) of the key head myogenesis genes32–34, MYOD1, MYF6, MEF2C, PAX3, MYL1 and MYOG, essential genes regulating chondrogenesis35,36, SOX9, COL2A1 and FGFR1 and genes that act upstream of osteoblast differentiation37,38, MSX1, MSX2, CEBPA/G, ALPL, DLX3, DLX5, FGFR1, FGFR2 (SupTable4 and SupTable5).

Genes linked to craniofacial enhancers and promoters in the dunnart are reproducibly expressed and involved in embryonic vasculature, muscle, skin and sensory system development.
(A) The majority of nearest genes assigned to candidate enhancers and promoters were reproducibly expressed in dunnart face tissue, and (B) reproducibly expressed genes in dunnart were associated with both a promoter and enhancer region. (C) Biological processes enriched for genes medium to highly expressed (>10TPM) and linked to both a promoter and enhancer region (FDR-corrected, p < 0.01).
Comparative analyses of regulatory elements in mouse and dunnart reveal conserved and dunnart-specific enhancers during craniofacial development
Previously, we defined the postnatal craniofacial development of the dunnart and characterized the developmental differences between dunnart and mouse5. Marsupials, including dunnarts, have accelerated development of the cranial bones, musculature and peripheral nerves when compared to placental mammals such as the mouse2–9. Having now characterized the chromatin landscape of the dunnart’s craniofacial region, we next sought to compare it to that of a placental mammal. From our morphological study of dunnart craniofacial bone development, we estimated that craniofacial development in the newborn dunnart is approximately equivalent to E12.5 in mouse5. However, we compared the dunnart to all available stages in the mouse to also provide insights into the regulation of additional craniofacial features (e.g. muscle, cranial nerves, sensory system, skin). To do this, we took advantage of publicly available craniofacial ChIP-seq data for H3K4me3 and H3K27ac generated by the mouse ENCODE consortium39–41 spanning multiple developmental time-points (E10.5-E15.5).
After applying consistent peak calling and filtering parameters to the dunnart ChIP-seq data we found ∼17K enhancers and ∼10K promoters per stage in the mouse (Fig4A, see SupNote4). The features of mouse predicted enhancer and promoters (percentage CpG, GC content, distance from TSS, peak length and peak intensity) were consistent with the observations in the dunnart (Fig4A, SupFig2B-E). After building dunnart-mm10 liftover chains (see Methods and SupNote5) we compared mouse and dunnart regulatory elements. The alignability (conserved sequence) for dunnart enhancers to the mouse genome was ∼13% for 100bp regions (Supplementary Table 22). Between 0.74-6.77% of enhancer regions out of all alignable enhancers were present in both mouse and dunnart (SupTable7B). In contrast, between 45-57% of alignable promoter regions were present in mouse and dunnart (SupTable7A). Although this is a small fraction of the total peaks (∼8% for promoters and ∼0.5% of enhancers (SupTable7), it suggests that, consistent with the literature19, promoter regions are more stable over large evolutionary distances and that shifts in developmental timing of craniofacial marsupial may be more likely to be driven by recently evolved enhancer regions in marsupials.

Analysis workflow and features of H3K4me3 and H3K27ac enhancers and promoters in dunnart and mouse.
(A) Alignment filtering and peak calling workflow and (B) number of reproducible predicted regulatory elements identified in the dunnart and mouse embryonic stages. Log10 of distance to the nearest TSS for putative (C) enhancers and (D) promoters.
To further contextualize the regulatory patterns in the dunnart compared to mouse, we retrieved mouse gene expression data from embryonic facial prominence tissue collected from E10.5 to E15.5 in the mouse ENCODE database39–41, and incorporated this into our comparative analyses. We considered only one-to-one orthologous genes in mouse and dunnart. Predicted dunnart enhancers with sequence conservation in mouse and matching peak activity at any of the five mouse embryonic stages (461 regions) were located near genes reproducibly expressed (>1 TPM, 89%) in both species (SupTable8). Genes in this group were enriched for core developmental and signaling processes; BMP signaling, cartilage development, ossification, skeletal development and chondrocyte differentiation (SupTable9). Taking the predicted dunnart enhancers alignable to the mouse but without a matching peak, we looked at nearby genes and compared expression between mouse and dunnart. For the 4,311 dunnart-specific enhancers we found that 2,310 (54%) were linked to genes expressed >1 TPM in all stages and species, suggesting that these genes in mouse could be regulated by a different set of regulatory regions or could be accounted for by the reduced enrichment in the mouse ENCODE ChIP-seq face datasets for H3K27ac (SupFig2). We found a smaller subset (179 regions, 114 unique genes) where the nearest genes were highly expressed (>10 TPM) only in the dunnart with low to no activity in the mouse at any of the embryonic stages (E10.5-E15.5; SupTable10). This included genes involved in cranial neural crest proliferation and migration (INKA2, TFAP2E, OVOL2, GPR161), keratinocyte proliferation (PLAU, HOXA1), embryonic myogenesis (PDF4), development of the ectodermal placodes and sensory systems (CNGA2, ELF5, EDN1, HOXA1, ATOH1, NPHP4, CFD, WNT2B) and vomeronasal sensory neuron development (TFAP2E; SupTable10).
Dunnart-specific expression of genes involved in the development of the mechanosensory system
Given the large evolutionary distance between the mouse and dunnart and low recovery of alignable regions, we performed a comparison between species at the gene level, by comparing genes assigned to putative enhancers and promoters between the dunnart and mouse. The number of genes that intersect can provide an idea of the similarities in genes and pathways regulated across a larger subset of the total regulatory dataset. The largest intersection size in genes with putative promoters was between the six mouse embryonic stages (1,910 genes; 21.2%) and between the dunnart all six embryonic mouse stages (1,908 genes, 21.2%; Fig5A). Overlap between enhancers was more restricted, with 4,483 predicted target genes (56%) being unique to the dunnart at D0 (Fig5A). The top enriched terms for biological processes were largely shared across dunnart and mouse, with the exception of one GO term, “sensory system development” (SupFig3A). We further investigated this by incorporating gene expression data for mouse and dunnart for genes near putative enhancers. Genes highly expressed in dunnart but lowly or not expressed in mouse (537 total; see SupTable11) were related to three main developmental processes, “epidermis/skin development and keratinization", “sensory system development” and “muscle development and contraction” (Fig5C,D; SupTable12). The majority (70/114) of genes associated with the sequence conserved dunnart-specific enhancers (see SupTable10) overlapped with the list of genes reported here.

Genes near enhancers highly expressed only in dunnart are involved in development of the skin, muscle and mechanosensory systems.
Gene set intersections across mouse (E10.5-E15.5) and dunnart (P0) for (A) genes near promoters and (B) genes near enhancers. (C) Gene ontology term enrichment for top 500 highly expressed dunnart genes. (D) Top 50 highly expressed genes (TPM) in dunnart compared with mouse embryonic stages. Scale bar in E. (E) Expression levels (TPM) for keratin genes across dunnart and mouse.
Genes critical for development of keratinocytes and the establishment of a skin barrier were highly expressed in dunnart facial tissue with lower expression or no transcripts expressed across the mouse embryonic stages including IGFBP2, SFN, AQP3, HOPX, KRT17, KRT7, KRT8 and KRT78 (Fig5D, SupTable12). Keratin genes are also critical for the development of the mammalian mechanosensory system42,43. Krt17 expressing epidermal keratinocytes are necessary to establish innervation patterns during development and Krt8 and Atoh1 expression is required for the specification of the Merkel cells (touch sensory cells)43. KRT17, ATOH1 and KRT8 are all very highly expressed in dunnart compared to the low expression in mouse facial tissue. Other genes in the keratin family such as KRT35, KRT79, KRT4 and KRT80 did not vary greatly between mouse and dunnart (Fig5E). Additionally, we observed high expression of genes involved in development of the olfactory system including CCK, OTX1 and ISLR (expressed in olfactory epithelium)44–47, and Ybx347 (expressed in the nasal epithelium; Fig5D, SupTable12). Muscle contraction genes such as TNNI248 and TNNT349,50 and genes involved in skeletal muscle development51–54 (CAR3, ATP2A2, IGFBP6 and TRIM72) were upregulated in dunnart craniofacial tissue (Fig5D, SupTable12). The majority of conserved toolkit genes involved in embryonic development had consistent expression across mouse and dunnart (SupFig4). To explore the relationship between genes expressed in the dunnart face and temporal gene expression dynamics during mouse development, we categorized mouse gene expression into five distinct temporal patterns (SupFig5A). Each of these groups appeared to reflect biological processes occurring during development (SupFig5B). Although dunnart facial development more closely resembles approximately E12.55 in the mouse, when compared to the temporal gene expression dynamics during mouse craniofacial dunnart expressed genes were associated with two distinct clusters: a set of genes upregulated specifically at E15.5 in mouse (cluster 2: OR = 1.30, CI = 1.15-1.46; SupFig5C; Fig6A) and a set of genes upregulated at E14.5 (cluster 3: OR = 1.99; CI = 1.78-2.24; SupFig5C; Fig6B). Cluster 2 genes were enriched for functions related to sensory perception, skin development and keratinization (Fig6C) while cluster 3 genes were enriched for muscle development (Fig6D). These results align with our observations in dunnart enhancer and gene expression data, suggesting that shifts in the developmental timing of the skin, muscle and sensory perception may play a role in marsupial early life history.

Dunnart expressed genes are associated with two gene clusters with distinct temporal expression patterns in the mouse.
(A) Genes in cluster 2 and cluster 3 plotted with their z-scaled temporal expression (logCPM). Color-coding represents membership value (degree to which data points of a gene belong to the cluster). Gene Ontology enrichment for biological processes enriched in (B) cluster 2 and (C) cluster 3 (FDR-corrected p<0.01).
Discussion
Marsupials display advanced development of the orofacial region relative to development of the central nervous system when compared to placental mammals3,6. Specifically the facial skeleton and muscular tissues begin development early relative to the neurocranium differentiation3,6,31,55–58. Although development of the central nervous system is protracted in marsupials compared to placentals, marsupials have well-developed peripheral motor nerves and sensory nerves (eg. the trigeminal) at birth59,60. Despite increasing descriptions of craniofacial enhancers in model species15,61–64, the genetic drivers of variation in craniofacial development between mammalian species is largely unexplored. We examined the similarities and differences in genomic regions marked by H3K4me3 and H3K27ac between the dunnart and mouse during early craniofacial development and incorporated comparisons of gene expression between species.
Given the large evolutionary distance (∼170 million years) between the mouse and dunnart65,66 and high turnover of non-coding DNA sequences67,68, regulatory elements in the dunnart were largely not sequence conserved in the mouse (∼8% for promoters and ∼0.5% of enhancers). Despite this, regions with conserved activity between the two species were predominantly near genes consistently expressed in both, and were enriched for core craniofacial developmental and signaling processes. Additionally, 54% of dunnart enhancers aligned to the mouse genome but lacking active marks in the mouse were associated with genes expressed throughout all mouse developmental stages, suggesting these genes might be regulated by different enhancers in mice. Moreover, despite differences in experimental methods, when taking a gene level approach there was significant overlap in genes near regulatory elements in both species, with high concordance in enriched biological process terms. The majority of craniofacial developmental genes had highly consistent gene expression levels across the mouse and dunnart, highlighting the substantial conservation of gene regulatory networks driving facial development. This supports the notion that conserved genes and signaling pathways are crucial for mammalian facial development69.
Although there was generally a high-level of concordance between the dunnart and mouse, we discovered dunnart-specific regulatory elements near highly-expressed genes in the dunnart that were lowly or not expressed in the mouse. These genes were related to three main developmental processes, ”epidermis/skin development and keratinization”, ”sensory system development” and ”muscle development and contraction”. In marsupials, pharyngeal muscles are well differentiated before birth preceding development of both the central nervous system and the skeletal system70. Additionally, in the first two days immediately after birth, marsupial pouch young undergo considerable differentiation of the facial muscles70. This pattern varies significantly from rodents where the events of skeletal and muscular development generally occur simultaneously70. Consistent with this, we found that dunnart expressed genes were associated with a cluster of mouse genes highly expressed at E14.5, a key timepoint for myogenesis in the mouse71.
Our data also revealed a less evident developmental constraint experienced by marsupials, with dunnart-specific enhancer and gene expression data showing an enrichment of genes related to skin development. Newborn dunnarts exhibit high expression of KRT17 in the face and other genes essential for periderm establishment and maintenance72–77. Unlike placental mammals, marsupials retain the periderm post-birth60,78,79, which may relate to neonatal transcutaneous gas exchange observed in marsupials in the first few days after birth80,81. In placental mammals such as mouse and human, the periderm only exists in utero and disappears late in gestation with the eruption of hair and the development of a thick keratinized stratum corneum72. The persistence of the periderm aligns with the observation that dunnarts rely heavily on gas exchange through the skin and only begin lung respiration around 5 days postpartum coinciding with the disappearance of the periderm80,82.
The recurrence of genes related to development of the sensory systems in our comparative analyses spotlights a highly unique aspect of early pouch life in marsupials. Newborn marsupial young require highly developed sensory systems (mechanosensory and olfactory systems) to respond to the cues that guide them to the teat inside the mother’s pouch, with the nasal-oral region making regular contact with the mother’s belly during the crawl to the pouch9,83,84. The snout epidermis of newborn marsupials has been shown to be innervated with presence of mature Merkel cells with connected nerve terminals7,8,83. We observe high expression of key genes involved in the development of Merkel cells and sensory placodes uniquely in the dunnart face. In the mouse, Merkel cell development doesn’t begin until later at approximately E16.585. Upregulation of Merkel cell genes in dunnart facial tissue could be a result of prioritization of sensory development required for life outside the womb in a highly underdeveloped state.
In summary, our work suggests that craniofacial developmental constraints in the dunnart may be driven by dunnart-specific gene regulation. Future studies will apply single-cell multi-modal technologies to dunnart tissues to investigate the specific regulatory differences between CNS and orofacial development.
Methods
Tissue Collection
All animal procedures, including laboratory breeding, were conducted in accordance with the current Australian Code for the Care and Use of Animals for Scientific Purposes86 and were approved by The University of Melbourne Animal Ethics Committee (AEC: 1513686.2) and with the appropriate Wildlife Permit (number 10008652) from the Department of Environment, Land, Water and Planning. Animals were housed in a breeding colony in the School of BioSciences, The University of Melbourne. For details on animal husbandry and collection of dunnart pouch young refer to Cook et al. 20215. Details of pouch young used in this study are presented in SupTable13. After removal of pouch young from the teat, young were killed by decapitation and craniofacial tissue dissected using insulin needles (Becton Dickinson). The tongue, neural tube and eye primordia were removed to limit tissue collected to the facial prominences. Specifically, the mandibular, maxillary and fronto-nasal prominences were collected and snap frozen in liquid nitrogen. All pouch young were determined to be <24 hours old but to account for variability in time since birth we scored pouch young based on head shape. Immediately after birth the dunnart has a flat neurocranium that by approximately 1 day after birth has begun to round (see Cook et al. 20255 for more details). We combined craniofacial tissue from 50 pouch young into two replicates ensuring that sex, head shape, and parentage were accounted for (SupTable13).
Immunofluorescence
We assessed the reactivity of the ChIP antibodies in the dunnart using immunostaining on dunnart head sections. Frontal head sections (7 µm thick) on superfrost slides (Platinum Pro, Grale) were deparaffinized and rehydrated according to standard methods87, followed by antigen retrieval using pH 8.8 unmasking solution (Vector) at 99°C for 30 minutes. We then incubated the sections with either rabbit anti-H3K4me3 primary antibody (1:500 dilution; Abcam ab8580) or rabbit anti-H3K27ac primary antibody (1:500, Abcam ab4729). Sections were then incubated with Alexa Fluor 555 donkey anti-rabbit antibody (1:500 dilution; Abcam in 10% horse serum in PBS with 0.1% Triton X-100; Sigma). All sections were counterstained with 300 nM DAPI to visualize cell nuclei. We observed no staining in the negative controls (no primary antibody). Images were captured using fluorescence microscopy (BX51 Microscope and DP70 Camera; Olympus) and processed in ImageJ v 2.0.088.
Chromatin immunoprecipitation and sequencing
Chromatin immunoprecipitation (ChIP) was performed using the MAGnify Chromatin Immunoprecipitation System (Thermo Fisher, 492024) according to manufacturer’s instructions. Briefly, frozen dunnart tissue samples (see SupTable13) were diced quickly with two razor blades in cold dPBS (Gibco) followed by crosslinking in 1% formaldehyde solution (Sigma) for 10 minutes. We then added 0.125 M glycine and incubated for 5 minutes at room temperature to neutralize the formaldehyde. Chromatin was fragmented to 300 bp average size by sonication on a Covaris S2 using the following parameters [duty cycle = 5%, intensity = 2, cycles per burst = 200, cycle time = 60 seconds, cycles = 10, temperature = 4°C, power mode = frequency sweeping, degassing mode = continuous]. In each ChIP experiment, we used sheared chromatin from each replicate for immunoprecipitation with antibodies against H3K4me3 (Abcam ab8580) and H3K27ac (Abcam ab4729). An input control was included for each replicate. DNA was purified according to kit instructions using a DynaMagTM-PCR Magnet (Thermo Fisher).
We assessed the success of the immunoprecipitation in dunnart craniofacial tissues by performing qPCR for primers designed to amplify genomic regions expected to be occupied by H3K4me3 and/or H3K27ac based on mouse and human enhancers active in facial regions of E11.5 mice in VISTA enhancer89 and GeneHancer90 (SupTable14). We also designed primers that amplify regions we predicted would be unoccupied by these histone modifications (enhancers active in heart tissue of E11.5 mice in VISTA enhancer browser89 (SupTable14). qPCR using SYBR Green Supermix (Bio-Rad Laboratories) was performed in triplicate on a QuantStudio™ 5 System (Thermo Fisher) as per manufacturer’s instructions (primers listed in SupTable14). The cycling conditions were [one cycle of 95°C for 15 s, followed by 40 cycles of 95°C for 15 s, 57°C for 30 s and 72°C for 30 seconds]. A dissociation curve was also generated for each primer pair. No-template controls were included in triplicate on each plate as a negative control. Regions expected to be enriched in the test sample were quantified by expressing the test sample as a fold change relative to a control sample (no antibody control).
Illumina sequencing libraries were prepared from ChIP-enriched DNA by GENEWIZ (Suzhou, China). Libraries were constructed following the manufacturer’s protocol (NEBNext UltraTMII DNA Library Prep Kit for Illumina). For each sample, a minimum of 10 ng of ChIP product was used and libraries were multiplexed and sequenced on an Illumina HiSeq 4000 instrument according to manufacturer’s instructions (Illumina, San Diego, CA, USA). Sequencing was carried out using a 2x150 paired-end configuration to an average depth of 57 million read pairs per sample.
Genome assembly and annotation
Previously there was no fat-tailed dunnart genome available to map ChIP-seq reads against. In order to generate a genome for dunnart, tissue was collected and four sequencing libraries were prepared following methods 91. Four libraries were generated to improve molecular complexity and genome representation of input DNA. These libraries were then sequenced using the following technologies: Illumina X Ten 2x150 bp, PacBio Sequel I CLR, ONT PromethION and ONT GridION (SupTable15).
Quality trimming and residual adaptor removal from dunnart Illumina libraries (Library 1) was performed using trimmomatic v0.3892 with options [PE SLIDINGWINDOW 5:20, MINLEN 75, AVGQUAL 30]. Contigs were assembled using 200 Gb of PacBio CLR subreads (Library 2) using Flye v2.793 with options [–iterations 4 –trestle –pacbio-raw –genome-size 3.0g]. Removal of redundant contigs and two rounds of short-read and long-read scaffolding were performed using Redundans 0.14a94 with options [--nogapclosing --limit 1.0]. Inputs for redundans scaffolding were short-insert paired-end reads (Library 1) and 6.5 gigabases of Oxford Nanotechnology reads corresponding to 2 libraries (Library 3 and Library 4). Scaffolds then underwent two rounds of polishing to improve base quality using Pilon v1.2395 with Illumina Library 1 as input and with options [--vcf --diploid --chunksize 10000000 --fix snps,indexls,gaps --minqual 15]. The resulting genome assembly had a total size of 2.84 Gb and an N50 length of 23 megabases (Mb). We used BUSCO v5.2.2 to assess genome completeness [v3.0.2, -l mammalia_odb10 -m genome]. BUSCO gene recovery was 89.9% for complete orthologs in the mammalia_odb10 lineage dataset which includes 9226 BUSCOs. Together, these metrics indicate that the assembly is of comparable completeness and contiguity to other recently-published marsupial genomes96–102 and therefore represents an excellent resource for downstream functional genomic experiments. The resulting de novo assembly with a resulting scaffold N50 of 23 Mb and a total size of 2.84 Gb making it comparable to other marsupial genomes96,98–100. The G+C content of the de novo contigs in the dunnart (∼36.25%), was similar to other marsupial species (Tasmanian devil; 36.4%99, thylacine; ∼36%96 wallaby; 34-38.8%98, opossum; 37.8%100, woylie; 38.6%101 and the brown antechinus; 36.2%102.
Gene annotations from the high-quality genome assembly of the Tasmanian devil (Sarcophilus harrisii, GCF_902635505.1 - mSarHar1.11), which has a divergence time with the dunnart of approximately 40 million years, were accessed from NCBI and then lifted over to dunnart scaffolds using the program liftoff v1.0 103 with option [--d 4].
Whole genome alignment
To compute pairwise genome alignments between the mouse and dunnart, we used the mouse mm10 assembly as the reference. We first built pairwise alignments using Lastz and axtChain to generate co-linear alignment chains104, using the previously described Lastz parameters for vertebrates, [K = 2400 L = 3000 Y = 3400, H = 200] with the HoxD55 scoring matrix105. After building chains, patchChain105 was applied to extract all the unaligned loci and create local alignment jobs for each one. The new local alignments were combined with the original local alignments for an improved set of chains. We then applied chainCleaner106 with the parameters [-LRfoldThreshold = 2.5 -doPairs -LRfoldThresholdPairs = 10 -maxPairDistance = 10000 -maxSuspectScore = 100000 -minBrokenChainScore = 75000] to improve the specificity of the alignment. After generating an improved set of chains, we applied chainPreNet, chainNet and ChainSubset to filter, produce the alignment nets and create a single chain file using only the chains that appear in the alignment nets104. Alignment nets are a hierarchical collection of the chains that attempt to capture orthologous alignments104. Chain fragments were joined using chainStitchId and dunnart to mouse chains generated using chainSwap104. For quality control, maf files were generated using netToAxt and axtToMaf104. Block counts, block lengths and pairwise divergence in the alignments were assessed using MafFilter107.
ChIP sequencing data analysis
First, we assessed the raw sequencing read quality using FastQC v0.11.9108. Raw data were processed by adapter trimming and low quality read removal using Cutadapt v1.9.1109 [-q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --max-n 0.10 -m 75]. ChIP sequencing statistics for raw reads and trimmed reads are described in SupTable16. Sequencing reads were aligned to the dunnart genome with Bowtie2 v.2.3.5.1110 [-q -X 2000 --very-sensitive]. Unfiltered aligned reads from ChIP-seq experiments performed using mouse embryonic facial prominence for E10.5, E11.5, E12.5, E13.5, E14.5 and E15.5 were downloaded from ENCODE.org39–41,111 (accession details described in SupTable17). For both dunnart and mouse aligned reads, low-quality and unpaired reads were removed using Samtools v.1.9112 [-q 30 -f 2] and duplicate reads removed by the MarkDuplicates tool from picard v.2.23.1 (http://broadinstitute.github.io/picard/). Mapping statistics and library complexity for dunnart and mouse reads are described in SupTable18 and SupTable19, respectively. Effective genome size for the dunnart was calculated using the [unique-kmers.py] script from khmer v.2.0113.
Peaks were called on the dunnart-aligned reads using MACS2 v.2.1.1114 [-f BAMPE] and the mouse aligned reads using MACS2 v.2.1.1 with default parameters for mm10, using total DNA input as control and retaining all statistically significant enrichment regions (FDR-corrected P < 0.01). Reproducible consensus peaks for biological replicates within a species were determined using the ENCODE3 [overlap_peaks.py] script39,41. Enriched regions were considered reproducible when they overlapped in two biological replicates within a species by a minimum of 50% of their length using bedtools intersect v2.29.2115. Peak-calling statistics for dunnart and mouse are described in SupTable20 and SupTable21, respectively. Similar to Villar et al. 201519, we overlapped H3K4me3 and H3K27ac reproducible peaks to determine promoter-associated peaks (marked by only H3K4me3 or both H3K4me3 and H3K27ac) and enhancer-associated peaks (marked only by H3K27ac). H3K4me3 and H3K27ac reproducible peaks were overlapped to determine genomic regions enriched for H3K4me3, H3K27ac or both marks using bedtools intersect v2.29.2115. Double-marked H3K4me3 and H3K27ac elements were defined as regions reproducibly marked by H3K4me3 and H3K27ac and overlapping by a minimum 50% of their reciprocal length and were merged with bedtools v2.29.2115. Mouse and dunnart peaks called on 10 million aligned reads are deposited at 10.7554/eLife.103592.1.
Gene Ontology Enrichment Analyses
For the dunnart peaks, gene annotations lifted over from the Tasmanian devil annotation were associated with ChIP-seq peaks using the default settings for the annotatePeak function in ChIPseeker v1.26.2116. As there is no equivalent gene ontology database for dunnart, we converted the Tasmanian devil RefSeq IDs to Ensembl v103 IDs using biomaRt v2.46.3119,120, and then converted these to mouse Ensembl v103. In this way we were able to use the mouse Ensembl gene ontology annotations for the dunnart gene domains. We were able to assign Devil Ensembl IDs to 74% of genes with peaks, and mouse IDs to 95% of genes with a devil Ensembl ID. For calculating enrichment in GO in the dunnart, the list of Tasmanian devil genes with an orthologous Ensembl gene in the mouse were used as the background list. All gene ontology analyses were performed using clusterProfiler v4.1.4117, with Gene Ontology from the org.Mm.eg.db v3.12.0 database118, setting an FDR-corrected p-value threshold of 0.01 for statistical significance.
Short sequence motifs enriched in dunnart peaks were identified with Homer v4.11.130 using [findMotifsGenome.pl]. In this case random GC- and length-match sequences for all promoters and enhancers were used as the background set to test for enrichment compared to random expectation. Enriched motifs were clustered into Homer motif families30.
Mouse and dunnart peak comparison
Dunnart and mouse peaks called from normalized input reads were filtered to 50 bp regions centered on the peak summit. Dunnart peak coordinates were lifted over using liftOver104 to the mouse (mm10) genome and then back to the dunnart genome. Alignable peaks were kept if after reciprocal liftOver they had the same nearest gene call (SupTable22). Alignable peaks were then intersected with enhancer and promoters at each stage in the mouse with bedtools intersect v.2.30.0115 to assess peaks with conserved activity (SupTable23).
RNA-sequencing and analyses
The reads for three replicates were generated from facial prominences of P0 dunnart pouch young. Each replicate is a pool of two pouch young. Libraries were prepared using the Illumina stranded mRNA kit and were sequenced to a depth >=50M read pairs (i.e. 25M F + 25M R) in 2x100bp format. The raw reads were first trimmed using trimmomatic v0.39 92 [ILLUMINACLIP:2:30:10 SLIDINGWINDOW:5:15 MINLEN:50 AVGQUAL:20]. Reads were mapped with hisat2 v2.21121 [--fr --no-mixed --no-discordant] and alignments were filtered using samtools view112 [-f 1 -F 2316]. Finally the count table was generated using featureCounts from the Subread package v2.0.1 122 [-s 2 -p -t exon --minOverlap 10]. Mouse gene count tables were acquired from ENCODE (see SupTable17). Mouse and dunnart gene expression data were normalized for library size with edgeR v.4.0.16123 and lowly expressed genes filtered (>2 cpm) for at least two out of three replicates.
For mouse gene expression data the resulting gene list was tested for differential expressed genes with the [DBanalysis] function in TCseq package124 which implements edgeR to fit read counts to a negative binomial generalized linear model. Differentially expressed genes with an absolute log2 fold-change > 2 compared to the starting time-point (E10.5) were determined. The optimal division of clusters was determined using the Calinski criterion implemented with the [cascadeKM] function in the vegan v. package125 with the parameters [inf.gr = 1, sup.g = 10 iter = 1000, criterion = “calinski"]. Time-clustering for 5 clusters was performed using the [timeclust] function with the parameters: [algo = ‘cm’, k = 5, standardize = TRUE] which performs unsupervised soft clustering of gene expression patterns into five clusters with similar z-scaled temporal patterns. Orthologous genes reproducibly expressed >1 TPM in the dunnart were compared to the list of genes for each cluster using Fisher’s Exact Test followed by p-value corrections for multiple testing with the Holm method. Gene Ontology enrichment was performed using [enrichGO] as part of the clusterProfiler v4.10.1117 with the 9933 genes present across the clusters as background and a false discovery rate of 1%.
Supplementary Notes
Supplementary Note 1. Validation of ChIP-seq in dunnart craniofacial tissue
As the H3K4me3 and H3K27ac antibodies used in this work had not been previously used in marsupials, we first tested their reactivity in the dunnart using immunofluorescence and observed strong positive staining for both antibodies (SupFig6A,B). Therefore, before sequencing, we validated the levels of enrichment in the ChIP libraries using qPCR and primers for sequences in the dunnart that were orthologous to the craniofacial enhancers mm428, mm387, mm423, hs466 and GH07J005561 and an enhancer active in the heart as a negative control, hs222 (SupTable14). All primer sets were enriched as a percentage of the input control, and as expected no enrichment was observed in the rabbit and mouse mock IgG negative control samples (SupFig6C). Although the dunnart ortholog of the human heart enhancer (hs222) was also enriched in both ChIP samples, this enhancer has only been tested at E11.5 in mouse embryos89 and may have alternative roles at other stages in development or in different species.
Having validated the ability of our antibodies to enrich for dunnart chromatin marks, ChIP-seq libraries were sequenced to average depth of 57 million reads. Reads were mapped to a de novo assembly of the dunnart genome generated for this study (SupTable15), which we annotated using the publicly available high-quality genome assembly of the Tasmanian devil (mSarHar1.11; see Methods for additional details). After mapping and filtering, we retained an average of 43 million mapped reads per library (SupTable16). All samples had a NRF of between 0.76-0.85 (SupTable18)41. Read coverage was highly correlated for replicates within each mark (Pearson’s r > 0.99) and also between marks (Pearson’s r > 0.88; SupFig7A). Read coverage for replicate input controls was also correlated, but as expected due to enrichment for specific genomic regions in IP samples, there was no correlation in read coverage observed between the input controls and IP samples (Pearson’s r range = 0.03 to 0.08, SupFig7A). Similarly, alignment BAM files for H3K4me3 and H3K27ac IP replicates show strong and specific enrichment indicated by a prominent and steep rise of the cumulative sum towards the highest rank, whereas input control alignment BAM files are roughly diagonal, highlighting even coverage across the genomic windows (SupFig7B). Fraction of reads in peaks was approximately 60% for consensus H3K27ac and H3K4me3 peaks (SupTable20).
Supplementary Note 2. Investigating promoters located >3 kb from an annotated TSS
To investigate the large number of putative promoters located >3kb from an annotated TSS, we first looked at the relationship between the number of peaks per gene and the distance to the next closest gene. After annotating peaks with the nearest gene call using ChIPseeker116, 72% of genes had at least 1 predicted promoter or enhancer, with 81 genes having more than 50 promoters (SupFig8A). The number of promoters per gene was weakly positively correlated with distance to the next closest gene (Pearson’s r = 0.36, p < 2.2 x 10-16), suggesting that this observation was partially due to the presence of unannotated transcripts between genes (SupFig8B). Enhancers can also be associated with H3K4me3124. However, enrichment levels (peak intensity) tend to be lower than that of H3K27ac127. Hence, peaks characterized as promoters that were located more than 3 kb from a known TSS may instead represent active enhancer regions127. To assess this we compared mean peak intensity in H3K4me3 peaks located greater than 3 kb from the nearest TSS, to H3K4me3 peaks located within 3 kb of the TSS. We found that H3K4me3 peaks located closer to the TSS had a stronger peak signal (mean = 46.10) than distal H3K4me3 peaks (mean = 6.95; Wilcoxon FDR-adjusted p < 2.2 x 10-16). This suggests that although some distal promoter peaks may be due to missingness in the annotation, the majority likely represent peaks associated with enhancer regions.
Supplementary Note 3. Defining high-confidence promoter regions
This analysis identified 3 clusters: upstream distal peaks (cluster 3, 31,285 peaks), downstream distal peaks (cluster 2, 22,863 peaks) and peaks centered on the TSS (cluster 1, 12,295 peaks; SupFig9B). Cluster 1 peaks had a higher intensity (SupFig9C) and length (SupFig9D) when compared to clusters 2 and 3 (Wilcoxon FDR-adjusted p < 2.2 x 10-16) and compared to all predicted enhancers and promoters (Wilcoxon FDR-adjusted p < 2.2 x 10-16). Furthermore, peaks in cluster 1 (those closest to annotated TSS) had a higher GC and CpG island content than clusters 2 and 3 (Wilcoxon FDR-adjusted p < 2.2 x 10-16) and higher than enhancers (Wilcoxon FDR-adjusted p < 2.2 x 10-16), consistent with known features of mammalian promoters (SupFig9E,F). H3K4me3 ChIP-seq peak intensity has previously been correlated with transcriptional activity128 and a higher peak intensity has also been observed in promoters in mammalian liver tissue19. We thus used cluster 1 (12,295 peaks) to define a set of high-confidence promoters for all of the following analyses.
Supplementary Note 4. Investigating differences in the number of mouse and dunnart peaks called
After applying consistent peak calling and filtering parameters to the dunnart ChIP-seq data we found that the number of peaks were fairly consistent across mouse embryonic stages (∼20-30,000 total peaks; Fig4A). This number was significantly lower than the total number of peaks observed in the dunnart (∼150,000 peaks; Fig4A). We investigated this further and found that the strength and specificity of enrichment differed between the mouse and dunnart datasets. Dunnart alignment BAM files for H3K4me3 and H3K27ac immunoprecipitation replicates show strong and specific enrichment (SupFig7B); however, mouse alignment BAM files show a weaker enrichment with the immunoprecipitation samples for H3K27ac being closer to the input (SupFig10). This was also reflected in the similarity between mouse IPs and input controls based on read coverage, with correlation coefficients higher (H3K4me3, Pearson’s r range = 0.17 to 0.32, SupFig11B; H3K27ac, Pearson’s r range = 0.39 to 0.64, SupFig11A) than the corresponding dunnart values (SupFig7A). Therefore, this is likely a technical confounder that may be responsible for the lower numbers of enriched regions called in the mouse, as peaks with lower enrichment signal might not be identified by the peak caller. This was consistent with the distribution of peak enrichment values in the dunnart and mouse for H3K4me3, with a lower mean peak enrichment value in the dunnart compared to all mouse stages (Kruskal-Wallis FDR-corrected p = 6.7 x 10-12; SupFig2A). However, this was not the case for peak enrichment values for H3K27ac peaks (SupFig2A), which generally have lower peak enrichment values than observed in H3K4me319,127.
Supplementary Note 5. Whole genome alignment between mouse and dunnart
In order to compare activity in orthologous mouse and dunnart peaks, liftOver chains are needed to find the corresponding coordinates in the alternative genome. After building a dunnart-mm10 liftOver chain, we examined the quality of the WGA between mouse and dunnart. Approximately a quarter of both genomes were recovered in the WGA, with 26% of the dunnart genome and 28% of the mouse genome were present with an average mismatch between the dunnart and mouse of 37.2% (SupFig12). Previous WGAs between placentals and marsupials (opossum versus human, tammar wallaby versus human) have recovered approximately 6-8% of the genomes with LastZ129. The higher recovery in our WGA may be due to the use of new genome alignment tools like chainCleaner and patchChain. Given the higher conservation of coding regions than non-coding regions, exon coverage is a useful metric for assessing the quality of the alignment. 92% of mouse exon sequence and 69% of dunnart exon sequence was present in the WGA (SupFig12). Coverage of the exons recovered after liftOver were 82.7% and 57.8% in the mouse and dunnart, respectively (SupFig12). The lower exon coverage in the dunnart could be due to the missingness in the dunnart annotation. The majority of the alignment blocks fell within the 100 bp to 1000 bp size range with a total of 578.3 Mb of DNA sequence alignment out of a total of 801 Mb in the alignment within this range (SupFig12). This is very similar to the existing opossum-human WGA where 83% of alignment blocks fall within the size range of 100 to 1000 bp129.
We then used the liftOver chains to find corresponding coordinates for dunnart peaks in the mouse genome. Given the majority of the alignment blocks for the mouse and dunnart WGA fell between 100-1000 bp in length ((SupFig12C), we first assessed the impact of peak length (centered on the peak summit, which represents the point with the highest signal in the peak region) on inter-species recovery of peaks. We defined dunnart peak regions as alignable if they could be reciprocally lifted over to the mouse genome and then back to the dunnart genome. Unsurprisingly, for both enhancers and promoters the number of alignable peaks recovered decreased with increasing peak length (SupTable22 and SupTable23). Promoters had the highest number of regions alignable (17%) using 50 bp peak summit widths which decreased to 1.8% with a 500 bp peak summit length (SupTable23). Similarly, 19% of enhancers were alignable using a 50 bp peak summit length and this decreased to 2% with 500 bp peak summit length (SupTable22). To assess the accuracy of the reciprocal liftOver, we next investigated whether alignable peaks in the mouse and dunnart mapped to the same nearest Ensembl gene before and after liftOver. Accuracy was high for both the promoters and enhancers (from 94% to 100%; (SupTable22 and SupTable23).

Homer motif enrichment for dunnart promoters and enhancers for the top 20 enriched TF families.
Log10 FDR adjusted p-value scores are shown as a heatmap in enhancers and promoters. Individual TFs are labeled on the right hand side of the heatmap. Distinct colors represent TF families.

Features of predicted promoters and enhancers in the dunnart and mouse.
(A) Log10 peak intensity (measure of enrichment) for enhancers (orange) and promoters (blue) prior to filtering. (B) Log10 distance to the nearest TSS for enhancers (orange) and promoters (blue). After clustering and filtering for high-confidence promoters we observed consistent patterns for features including, (D) CpG and GC content and, (E) Log10 peak intensity and Log10 peak length.

Top GO enriched terms in the dunnart and mouse embryonic stages
for (A) genes near enhancers and, (B) genes near high-confidence promoters.

Heatmaps showing gene expression values (TPM) for common developmental genes across dunnart and mouse.

Temporal gene expression dynamics.
(A) Z-scaled temporal expression (logCPM) plotted across embryonic timepoints for five clusters. Membership values are used to indicate to what degree a data point belongs to each cluster. (B) Top enriched biological processes for each cluster (FDR corrected p<0.01, background gene set is all differentially expressed genes used for clustering). (C) Odds ratio estimates with 95% confidence interval for genes expressed in dunnart in each cluster. (D) Number of genes in each cluster for mouse and dunnart.

Validation of antibodies in dunnart craniofacial tissue with immunofluorescence and qPCR.
Localisation of (A) H3K27ac (pink, scale bar = 250um) and (B) H3K4me3 (pink, scale bar = 80um), in D0 dunnart head sections with nuclei stained with DAPI (blue) (C) enhancer regions expected to be enriched in the IP samples presented as the percentage of the input control sample as measured by qPCR.

deepTools quality control plots for dunnart subsampled aligned BAM files.
(A). Overall similarity between BAM files based on read coverage within genomic regions with Pearson correlation coefficients plotted for H3K27ac, H3K4me3 and input control. (B) Fingerprint plot showing a profile of cumulative read coverages for each BAM file. All reads overlapping a window (bin) of the specified length are counted, sorted and plotted for H3K27ac, H3K4me3 and input control.

Number of peaks per gene for enhancer- and promoter-associated peaks.
(A) Log10 number of peaks per gene. Genes with greater than 50 peaks are noted. (B) Scatter-plot with distance to the closest gene on the x-axis and number of peaks per gene on the y-axis. There is a weak but significant correlation between the number of peaks per gene and the distance to the next closest gene in both enhancers and promoters.

Subsetting high-confidence promoter-associated peaks with k-means clustering.
(A) Barplot for the number of promoter-associated peaks per cluster and histogram showing the distribution of peak distance from the nearest TSS in each cluster. (B) Genomic annotations for promoter-associated peaks in each cluster. (C) GC content, (D) Log10 peak length, (E) CpG content, and (F) Log10 of clustered promoter-associated peaks, enhancer-associated peaks, and unclustered promoter-associated peaks. Statistical significance (Wilcoxon, FDR-adjusted, $p <$ 0.00001) compared to cluster 1 promoter-associated peaks is denoted by ****.

deepTools fingerprint plot for mouse subsampled aligned BAM files.
Cumulative read coverages for each BAM file. All reads overlapping a window (bin) of the specified length are counted, sorted and plotted for (A) H3K27ac, (B) H3K4me3.

deepTools correlation plots for mouse subsampled aligned BAM files.
Overall similarity between BAM files based on read coverage within genomic regions with Pearson correlation coefficients plotted for (A) H3K27ac, (B) H3K4me3

Genome alignment between the fat-tailed dunnart (Sminthopsis crassicaudata and mouse (Mus musculus).
(A) Genome alignment workflow. (B) Genome coverage and exon coverage (bp) between mouse and dunnart. Coverage of exons recovered after LiftOver. (C) Block size distribution for the dunnart including number of blocks and total size of the blocks.

Volcano plot for both upregulated and downregulated differentially expressed genes from mouse (any stage) and dunnart.
Stringent log2 fold change and pvalue cutoffs were used given the comparisons between datasets from two different species.
Data availability
The data generated in this study have been deposited in NCBI’s Gene Expression Omnibus126 and are available through GEO Series accession number GSE188990. Accession IDs for previously published data sets from the ENCODE consortium39–41 are given in SupTable17. Processed data and an IGV session for browsing is available in a figshare repository (10.7554/eLife.103592.1. All analyses described were carried out using custom bash, Python3 and R v4.1.0 scripts, and are available at github.com/lecook/chipseq-cross-species.
Acknowledgements
This research was supported by an Australian Government Research Training Program (RTP) Scholarship, the David Lachlan Hay Memorial Grant and an Australian Research Council Grant (DP160103683) awarded to A.J.P. St Vincent’s Institute acknowledges the infrastructure support it receives from the National Health and Medical Research Council Independent Research Institutes Infrastructure Support Program and from the Victorian Government through its Operational Infrastructure Support Program. The authors thanks Eva Suric, Tania Long and Darren Cipolla for their technical contributions and help with animal husbandry.
Additional information
Author contributions
L.E.C, I.G.R and A.J.P designed and conceived the study. L.E.C collected the tissue samples, performed the ChIP experiments, analyzed the sequencing data and wrote the manuscript. D.M.V assisted with data analysis. J.D.H and C.Y.F collected tissue samples, performed RNA-sequencing experiments and initial analyses. C.Y.F performed the genome assembly and annotation. I.G.R and A.J.P supervised the study and gave editorial assistance. All authors reviewed and commented on the final manuscript.
Funding
Australian Research Council (DP160103683)
Additional files
References
- 1.Vertebrate Embryo: Craniofacial Development., Chichester, UK: John Wiley & Sons, Ltd Google Scholar
- 2.Statistical analyses of developmental sequences: the craniofacial region in marsupial and placental mammalsAm. Nat 152:82–101Google Scholar
- 3.Craniofacial development in marsupial mammals: developmental origins of evolutionary changeDev. Dyn 235:1181–93Google Scholar
- 4.The evolution of mammalian developmentBull. Mus. Comp. Zool 156:119–135Google Scholar
- 5.Postnatal development in a marsupial model, the fat-tailed dunnart (Sminthopsis crassicaudata; Dasyuromorphia: Dasyuridae)Commun Biol 4:1–14Google Scholar
- 6.Comparative patterns of craniofacial development in eutherian and metatherian mammalsEvolution 51:1663–1678Google Scholar
- 7.Birth in the brushtail possum, Trichosurus vulpecula (Marsupialia: Phalangeridae)Aust. J. Zool 48:691–700Google Scholar
- 8.Early differentiation of the afferent nervous system in glabrous snout skin of the opossum (Monodelphis domesticus)Somatosens. Res 3:169–184Google Scholar
- 9.Timecourse of development of the wallaby trigeminal pathway. I. periphery to brainstemJ. Comp. Neurol 350:75–95Google Scholar
- 10.Patterns in the bony skull development of marsupials: high variation in onset of ossification and conserved regions of bone contactScience Reports 7:11Google Scholar
- 11.Mammalian skull heterochrony reveals modular evolution and a link between cranial development and brain sizeNat. Commun 5:3625Google Scholar
- 12.Do developmental constraints and high integration limit the evolution of the marsupial oral apparatus?Integr. Comp. Biol 56:404–415Google Scholar
- 13.Constraints on the morphological evolution of marsupial shoulder girdlesEvolution 58:2353–70Google Scholar
- 14.Ontogeny and phylogeny of the mammalian chondrocranium: the cupula nasi anterior and associated structures of the anterior head regionZoological Letters 4Google Scholar
- 15.Fine tuning of craniofacial morphology by distant-acting developmental enhancersScience 342:1241006Google Scholar
- 16.Sequence alteration in the enhancer contributes to the heterochronic Sox9 expression in marsupial cranial neural crestDev. Biol 456:31–39Google Scholar
- 17.Comparative gene expression analyses reveal heterochrony for Sox9 expression in the cranial neural crest during marsupial developmentEvol. Dev 16:197–206Google Scholar
- 18.Development of body, head and brain features in the australian fat-tailed dunnart (Sminthopsis crassicaudata; Marsupialia: Dasyuridae); A postnatal model of forebrain formationPLoS One 12:e0184450Google Scholar
- 19.Enhancer evolution across 20 mammalian speciesCell 160:554–566Google Scholar
- 20.Histone modifications at human enhancers reflect global cell-type-specific gene expressionNature 459:108–112Google Scholar
- 21.Genome-wide chromatin state transitions associated with developmental and environmental cuesCell 152:642–654Google Scholar
- 22.Gene expression differences among primates are associated with changes in a histone epigenetic modificationGenetics 187:1225–1234Google Scholar
- 23.Active genes are tri-methylated at k4 of histone h3Nature 419:407–411Google Scholar
- 24.Histone H3K27ac separates active from poised enhancers and predicts developmental stateProc. Natl. Acad. Sci. U. S. A 107:21931–21936Google Scholar
- 25.Initiating RNA polymerase II and TIPs as hallmarks of enhancer activity and tissue-specificityTranscription 2:263–268Google Scholar
- 26.H3K4 tri-methylation provides an epigenetic signature of active enhancers: Epigenetic signature of active enhancersEMBO J 30:4198–4210Google Scholar
- 27.Modification of enhancer chromatin: what, how, and why?Mol. Cell 49:825–837Google Scholar
- 28.Gene regulatory networks and signaling pathways in palatogenesis and cleft palate: A comprehensive reviewCells 12Google Scholar
- 29.Abnormalities in pharyngeal arch-derived structures in SATB2-associated syndromeClin. Genet 106:209–213Google Scholar
- 30.Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identitiesMol. Cell 38:576–589Google Scholar
- 31.Cranial osteogenesis in Monodelphis domestica (Didelphidae) and Macropus eugenii (Macropodidae)J. Morphol 215:119–49Google Scholar
- 32.Building muscle: molecular regulation of myogenesisCold Spring Harb. Perspect. Biol 4:a008342–a008342Google Scholar
- 33.Gene regulatory networks and cell lineages that underlie the formation of skeletal muscleProc. Natl. Acad. Sci. U. S. A 114:5830–5837Google Scholar
- 34.Myogenic regulatory factors Myf5 and Myod function distinctly during craniofacial myogenesis of zebrafishDev. Biol 299:594–608Google Scholar
- 35.SOX9 in cartilage development and diseaseCurr. Opin. Cell Biol 61:39–47Google Scholar
- 36.Mechanistic insights into skeletal development gained from genetic disordersCurr. Top. Dev. Biol 133:343–385Google Scholar
- 37.Identification of genes responsible for osteoblast differentiation from human mesodermal progenitor cellsProc. Natl. Acad. Sci. U. S. A 100:3305–3310Google Scholar
- 38.Signaling and transcriptional regulation in osteoblast commitment and differentiationFront. Biosci 12:3068–3092Google Scholar
- 39.The encyclopedia of DNA elements (ENCODE): data portal updateNucleic Acids Res 46:D794–D801Google Scholar
- 40.Expanded encyclopaedias of DNA elements in the human and mouse genomesNature 583:699–710Google Scholar
- 41.An integrated encyclopedia of DNA elements in the human genomeNature 489:57–74Google Scholar
- 42.Merkel cells and touch domes: more than mechanosensory functions?Exp. Dermatol 23:692–695Google Scholar
- 43.The touch dome defines an epidermal niche specialized for mechanosensory signalingCell Rep 3:1759–1765Google Scholar
- 44.Cholecystokinin selectively activates short axon cells to enhance inhibition of olfactory bulb output neuronsJ. Physiol 596:2185–2207Google Scholar
- 45.Otx1 and Otx2 in the development and evolution of the mammalian brainEMBO J 17:6790–6798Google Scholar
- 46.Gene expression profiling of the olfactory tissues of sex-separated and sex-combined female and male miceSci Data 5:180260Google Scholar
- 47.Ion transporter NKCC1, modulator of neurogenesis in murine olfactory neuronsJ. Biol. Chem 290:9767–9779Google Scholar
- 48.Mutations in fast skeletal troponin I, troponin T, and beta-tropomyosin that cause distal arthrogryposis all increase contractile functionFASEB J 21:896–905Google Scholar
- 49.TNNT1, TNNT2, and TNNT3: Isoform genes, regulation, and structure-function relationshipsGene 582:1–13Google Scholar
- 50.Mutations in TNNT3 cause multiple congenital contractures: a second locus for distal arthrogryposis type 2BAm. J. Hum. Genet 73:212–214Google Scholar
- 51.TRIM72, a novel negative feedback regulator of myogenesis, is transcriptionally activated by the synergism of MyoD (or myogenin) and MEF2Biochem. Biophys. Res. Commun 396:238–245Google Scholar
- 52.Ebf factors and MyoD cooperate to regulate muscle relaxation via Atp2a1Nat. Commun 5:3793Google Scholar
- 53.Carbonic Anhydrase III Is Expressed in Mouse Skeletal Muscles Independent of Fiber Type-Specific Myofilament Protein Isoforms and Plays a Role in Fatigue ResistanceFront. Physiol 7:597Google Scholar
- 54.Insulin-like growth factor binding protein-6 alters skeletal muscle differentiation of human mesenchymal stem cellsStem Cells Int 2017:2348485Google Scholar
- 55.Early cranial development in marsupial mammals: the origins of heterochronyAm. Zool 39:13–13Google Scholar
- 56.Early development of the neural plate, neural crest and facial region of marsupialsJ. Anat 199:121–131Google Scholar
- 57.Time’s arrow: heterochrony and the evolution of developmentInt. J. Dev. Biol 47:613–621Google Scholar
- 58.On the development of the chondrocranium and the histological anatomy of the head in perinatal stages of marsupial mammalsZoological Letters 3:632Google Scholar
- 59.The functional and anatomical organization of marsupial neocortex: evidence for parallel evolution across mammalsProg. Neurobiol 82:122–141Google Scholar
- 60.Adaptations of the Marsupial Newborn: Birth as an Extreme EnvironmentAnat. Rec 303:235–249Google Scholar
- 61.The FaceBase consortium: a comprehensive resource for craniofacial researchersDevelopment 143:2677–2688Google Scholar
- 62.FaceBase 3: analytical tools and FAIR resources for craniofacial and dental researchDevelopment 147Google Scholar
- 63.Enhancer divergence and cis-regulatory evolution in the human and chimp neural crestCell 163:68–83Google Scholar
- 64.Dynamic enhancer landscapes in human craniofacial developmentNat. Commun 15:2030Google Scholar
- 65.The delayed rise of present-day mammalsNature 446:507–12Google Scholar
- 66.A jurassic eutherian mammal and divergence of marsupials and placentalsNature 476:442–445Google Scholar
- 67.A comparative genomics multitool for scientific discovery and conservationNature 587:240–245Google Scholar
- 68.Mammalian evolution of human cis-regulatory elements and transcription factor binding sitesScience 380:eabn7930Google Scholar
- 69.Exploring the Underlying Genetics of Craniofacial Morphology through Various Sources of KnowledgeBiomed Res. Int 2016:3054578Google Scholar
- 70.Development of craniofacial musculature in Monodelphis domestica (Marsupialia Didelphidae)J. Morphol 222:149–173Google Scholar
- 71.Myogenic cell lineagesDev. Biol. 154:284–298Google Scholar
- 72.Periderm: Life-cycle and function during orofacial and epidermal developmentSemin. Cell Dev. Biol 91:75–83Google Scholar
- 73.Irf6 directly regulates Klf17 in zebrafish periderm and Klf4 in murine oral epithelium, and dominant-negative KLF4 variants are present in patients with cleft lip and palateHum. Mol. Genet 25:766–776Google Scholar
- 74.Ptbp1 and Exosc9 knockdowns trigger skin stability defects through different pathwaysDev. Biol 409:489–501Google Scholar
- 75.IRF6 and SPRY4 Signaling Interact in Periderm DevelopmentJ. Dent. Res 96:1306–1313Google Scholar
- 76.Neural crest and periderm-specific requirements of Irf6 during neural tube and craniofacial developmentbioRxiv https://doi.org/10.1101/2024.06.11.598425Google Scholar
- 77.Developmental changes in cellular and extracellular structural macromolecules in the secondary palate and in the nasal cavity of the mouseEur. J. Oral Sci 118:221–236Google Scholar
- 78.Biological considerations of the marsupial-placental dichotomyEvolution 29:707–722Google Scholar
- 79.Postnatal development of the skin of the marsupial native cat Dasyurus hallucatusJ. Morphol 205:233–242Google Scholar
- 80.Structural and functional development of the respiratory system in a newborn marsupial with cutaneous gas exchangePhysiological and Biochemical Zoology: Ecological and Evolutionary Approaches 84:634–649Google Scholar
- 81.Skin structure in newborn marsupials with focus on cutaneous gas exchangeJ. Anat 233:311–327Google Scholar
- 82.Postnatal development of the epidermis in a marsupial, Didelphis virginianaJ. Anat 125:85–99Google Scholar
- 83.Facial mechanosensory influence on forelimb movement in newborn opossums, Monodelphis domesticaPLoS One 11:e0148352Google Scholar
- 84.Ultrastructure of the olfactory system of three newborn marsupial speciesAnat. Rec 225:203–208Google Scholar
- 85.The cellular basis of mechanosensory Merkel-cell innervation during developmenteLife 8Google Scholar
- 86.Australian Code for the Care and Use of Animals for Scientific PurposesGoogle Scholar
- 87Theory and Practice of Histological TechniquesElsevier Health Sciences Google Scholar
- 88.NIH image to ImageJ: 25 years of image analysisNat. Methods 9:671–5Google Scholar
- 89.VISTA Enhancer Browser--a database of tissue-specific human enhancersNucleic Acids Res 35:D88–92Google Scholar
- 90.GeneHancer: Genome-wide integration of enhancers and target genes in GeneCardsDatabase 2017:1217Google Scholar
- 91.Molecular Cloning: A Laboratory ManualCold Spring Harbor Laboratory Press Google Scholar
- 92.Trimmomatic: A flexible trimmer for illumina sequence dataBioinformatics 30:2114–2120Google Scholar
- 93.Assembly of long, error-prone reads using repeat graphsNat. Biotechnol 37:540–546Google Scholar
- 94.Redundans: An assembly pipeline for highly heterozygous genomesNucleic Acids Res 44:e113Google Scholar
- 95.Pilon: An integrated tool for comprehensive microbial variant detection and genome assembly improvementPLoS One 9:e112963Google Scholar
- 96.Genome of the Tasmanian tiger provides insights into the evolution and demography of an extinct marsupial carnivoreNature Ecology & Evolution 2:182–192Google Scholar
- 97.A Chromosome-Scale Hybrid Genome Assembly of the Extinct Tasmanian Tiger (Thylacinus cynocephalus)Genome Biol. Evol 14Google Scholar
- 98.Genome sequence of an australian kangaroo, Macropus eugenii, provides insight into the evolution of mammalian reproduction and developmentGenome Biol 12:R81Google Scholar
- 99.Genome sequencing and analysis of the Tasmanian devil and its transmissible cancerCell 148:780–791Google Scholar
- 100.Genome of the marsupial monodelphis domestica reveals innovation in non-coding sequencesNature 447:167–177Google Scholar
- 101.A reference genome for the critically endangered woylie, Bettongia penicillata ogilbyiGigabyte 2021:1–15Google Scholar
- 102.The first Antechinus reference genome provides a resource for investigating the genetic basis of semelparity and age-related neuropathologiesGigabyte 2020:1–22Google Scholar
- 103.Liftoff: Accurate mapping of gene annotationsBioinformatics 37:1639–1643Google Scholar
- 104.Evolution’s cauldron: duplication, deletion, and rearrangement in the mouse and human genomesProceedings of the National Academy of Sciences 100:11484–11489Google Scholar
- 105.Increased alignment sensitivity improves the usage of genome alignments for comparative gene annotationNucleic Acids Res 45:8369–8377Google Scholar
- 106.chainCleaner improves genome alignment specificity and sensitivityBioinformatics 33:1596–1603Google Scholar
- 107.MafFilter: a highly flexible and extensible multiple genome alignment files processorBMC Genomics 15Google Scholar
- 108.FastQC: A Quality Control Tool for High Throughput Sequence DataBabraham Bioinformatics
- 109.Cutadapt removes adapter sequences from high-throughput sequencing readsEMBnet.journal 17:10–12Google Scholar
- 110.Fast gapped-read alignment with Bowtie 2Nat. Methods 9:357–359Google Scholar
- 111.Spatiotemporal DNA methylome dynamics of the developing mouse fetusNature 583:752–759Google Scholar
- 112.The Sequence Alignment/Map format and SAMtoolsBioinformatics 25:2078–2079Google Scholar
- 113.The khmer software package: enabling efficient nucleotide sequence analysisF1000Res 4:900Google Scholar
- 114.Model-based analysis of ChIP-seq (MACS)Genome Biol 9:R137Google Scholar
- 115.BEDTools: a flexible suite of utilities for comparing genomic featuresBioinformatics 26:841–842Google Scholar
- 116.ChIPseeker: an R/Bioconductor package for ChIP peak annotation, comparison and visualizationBioinformatics 31:2382–2383Google Scholar
- 117.clusterProfiler 4.0: A universal enrichment tool for interpreting omics dataInnov. J 2:100141Google Scholar
- 118.Org.mm.eg.db: Genome Wide Annotation for MouseR Package Version 3.12.0
- 119.Mapping identifiers for the integration of genomic datasets with the R/Bioconductor package biomaRtNat. Protoc 4:1184–1191Google Scholar
- 120.BioMart and Bioconductor: a powerful link between biological databases and microarray data analysisBioinformatics 21:3439–3440Google Scholar
- 121.Rapid and accurate alignment of nucleotide conversion sequencing reads with HISAT-3NGenome Res 31:1290–1295Google Scholar
- 122.The Subread aligner: fast, accurate and scalable read mapping by seed-and-voteNucleic Acids Res 41:e108Google Scholar
- 123.edgeR: a Bioconductor package for differential expression analysis of digital gene expression dataBioinformatics 26:139–140Google Scholar
- 124TCseq: Time Course Sequencing Data AnalysisBioconductor
- 125.Vegan: Community Ecology PackageCRAN
- 126.NCBI GEO: archive for functional genomics data sets—updateNucleic Acids Res 41:D991–D995Google Scholar
- 127.Widespread transcription at neuronal activity-regulated enhancersNature 465:182–187Google Scholar
- 128.High-resolution profiling of histone methylations in the human genomeCell 129:823–837Google Scholar
- 129.Ensembl 2021Nucleic Acids Res 49:D884–D891Google Scholar
Article and author information
Author information
Version history
- Preprint posted:
- Sent for peer review:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.103592. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2025, Cook et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 1,290
- downloads
- 67
- citation
- 1
Views, downloads and citations are aggregated across all versions of this paper published by eLife.