Abstract
The nuclear METTL3-METTL14 transfers a methyl group from SAM to convert the N6 of adenosine (A) in RNA to m6A and in ssDNA to 6mA. m6A marks are prevalent in eukaryotic mRNAs and lncRNAs and modulate their stability and fate in a context-dependent manner. The cytoplasmic METTL3 can act as a m6A reader. However, the precise mechanism during m6A writing, reading, or sensing is unclear. Here, we present a ~2.5 Å structure of the methyltransferase core of human METTL3-METTL14 in complex with the reaction product mimic, N6-methyladenosine monophosphate (m6A), representing a state post-catalysis but before the release of m6A. m6A occupies an evolutionarily conserved RNA-binding pocket ~16 Å away from the SAM pocket that also frequently mutates in cancer. We propose a two-step model of swiveling of target A upon conversion to m6A and sensing its methylation status by this pocket, enabling it to actuate enzymes’ switch from writer to an m6A-sensor. Cancer-associated mutations show impaired RNA binding dynamics, de-stacking, and defective m6A writing and sensing.
Introduction
A heterodimer of Methyltransferase like-3 (METTL3) and its obligate partner METTL14 installs the majority of m6A (N6-methyladenosine) modification within the consensus DRACH (D=A/G/U, R=A/G, H=A/C/U) motif in eukaryotic mRNAs and lncRNAs1–5, chromosome-associated regulatory RNAs (carRNAs)6,7, and 7SK RNA8. METTL3 and METTL14 contain an MT-A70 family methyltransferase (MTase) core9 diverged from an ancestral β-class of bacterial MTases10–13. METTL3 hydrolyzes SAM to facilitate the transfer of its methyl group to the N6 amino group of the target adenine base in RNA (in vivo and in vitro)1,4,9 and ssDNA (in vitro)11,12. In contrast, catalytically deficient METTL14 stabilizes METTL3 and is thought to position RNA in METTL3’s active site14–17. m6A modifications modulate RNA stability and play essential roles in myriad biological processes, including but not limited to miRNA biogenesis, maintenance of neural stem cells, translation efficiency, transcription elongation, innate immune response, DNA break repair, circadian rhythm, and viral pathogenesis18,19. Consistently, severe growth defects observed in the cellular KO phenotype of METTL3 underscore METTL3’s essential role in maintaining cellular homeostasis during development20–22, cancer growth23–26, and viral infections, including SARS-CoV-227–29.
While m6A deposition in mRNAs occurs in the nucleus and elevated METTL3 levels are associated with survival of acute myeloid leukemia24,30, non-catalytic functions of METTL3 outside the nucleus benefit lung cancer cells23,25. Cytoplasmic METTL3 can act as an m6A reader to promote the translation of mRNA of known oncogenes, thereby facilitating the crosstalk between m6A-bound METTL3 at 3’-end to the translation initiation machinery that has engaged the 5’- mRNA cap23,25,31.
m6A marks are also present in genomes of RNA viruses such as hepatitis C, Zika, dengue, West Nile, yellow fever, and SARS-CoV-2, and modulate viral replication and host immune response27. Thus, METTL3 has emerged as an attractive drug target for anti-cancer and anti-viral therapy development. Consistently, pharmacologic inhibition of METTL3 limits the growth of acute myeloid leukemia26 and SARS-CoV-228,29. The first METTL3 inhibitor STC-15 that targets its SAM pocket has entered Phase I clinical trial (NCT05584111).
Despite significant advancement in the m6A field and interest in targeting it for therapy, the structural details of RNA recognition and catalysis by METTL3-METTL14 are lacking. Here we present a ~2.5 Å crystal structure of the methyltransferase core of METTL3-METTL14 bound to methyladenosine monophosphate (m6A), a product mimic of the methylation reaction (Fig. 1a). We show that m6A occupies a novel cryptic pocket constituted to a large extent by residues from METTL3 and an interface arginine (R298) of METTL14. This pocket is evolutionarily conserved in mammals, plants, and yeast (Fig. 1b). Importantly, residues that partake in interaction with m6A are mutated in gynecologic, stomach, kidney, and bladder cancers32 (Fig. 1b). When introduced into wild-type METTL3-METTL14, the mutant enzymes exhibit a significant loss in catalysis, perturbed RNA binding, and compromised ability of de-stacking of the target adenine for presentation to the active site. Our data suggest that the target base swivels ~120º after methylation for sensing by the cryptic pocket located ~16 Å away from the point of methyl transfer. METTL3-METTL14 uses this unique mechanism to sense the methylation status before releasing the substrate RNA. This arrangement will require de-stacking of the target base during catalysis and sensing. We also show that the wild-type METTL3-METTL14, but not the mutant, binds more tightly to an m6A-modified RNA to distinguish it from the unmethylated RNA. Moreover, the enzyme harboring R298P mutation, the most frequent mutation in endometrial cancer32, exhibits sub-optimal RNA binding, catalysis, and base de-stacking ability. Our results uncover entirely unexpected operating principles underlying methyl transfer and m6A-sensing by METTL3-METTL14.

Structure of m6A bound human METTL3-METTL14 MTase core.
a, Domain architecture of METTL3 and METTL14; and boundaries of each used in crystallization are shown on top. Structure of the complex is shown in cartoon mode for METTL3 in cyan and METTL14 in orange; m6AMP (red) and interacting residues of METTL3 (green) and METTL14 (orange) are shown in stick mode. Blue dot, the position of N6 (in acceptor mode), i.e., ~3Å from the methyl group of the donor SAM. Methylated N6 of m6A is ~16Å away from its acceptor position in the catalytic pocket (blue dot). Black dots, water. Black dashes, h-bonds. The panel on right shows a close-up of the m6A interaction network, including the arginine clasp. b, An alignment of the regions participating in m6A confirms strict conservation of the interaction network throughout the evolution from yeast (Uniprot ID: P41833); arabidopsis (082486) and rice (Q6EU10); fruit fly (Q9VCE6), zebrafish (F1R777), mouse (Q8C3P7), hamster (A0A1U7R3Z3), and monkey (A0A8J8YGJ7); to human (Q86U44). c, Methyltransferase activity results of full-length human METTL3-METTL14 (wild-type, WT) and eight mutant enzymes as derived from three independent experiments, with error bars indicating the range of data points from these experiments (n = 3). d, Quantitative measurement of RNA (red, m6A-RNA; blue, A-RNA) binding (n = 3) by the WT enzyme shown as binding isotherms fitted with a one-site specific binding model. The equilibrium dissociation constant or Kd derived for each mutant enzyme is plotted along with Kd of the WT enzyme (e). ns, not significant (p >0.05), * denotes p ≤ 0.05. Source data for panels c-e are provided.
Results and discussion
Overall structure
The MTase cores of human METTL3 (aa 358 - 580) and METTL14 (aa 116 - 378) form an obligate heterodimer. METTL3 acts as an active SAM-dependent MTase, whereas METTL14, an inactive MTase, stabilizes RNA14–17. We co-purified the MTase core of METTL3-METTL14 from E. coli. We succeeded in resolving its structure in the presence of N6-methyladenosine 5’-monophosphate (m6AMP, referred to as m6A), a product of methylation reaction, by soaking m6A into apo crystals (Fig. 1 a, Extended data Fig. 1a-c). The difference omit map showed clear and unbiased electron density for m6A, which was refined well with no discrepancies for the ligand, surrounding regions, or the rest of the protein (Extended data Fig. 1d-g and table 1). METTL3-METTL14-m6A model was refined to ~2.5 Å resolution, with excellent stereochemistry and Rfree and Rwork of ~26.2 and 22.9%, respectively (Extended data Table 1). The final model contains one molecule each of METTL3 (aa 369 – 579), METTL14 (aa 116 – 402), one m6A, 90 water, and two ethylene glycol.
The overall fold of METTL3-METTL14 is similar to those reported previously14–16, except for notable changes in the region around the m6A binding pocket. MTases adopt a β-class of MTase fold with a central β-sheet of seven parallel and one antiparallel β-strands flanked by three helices on each side. Three major loops (gate loops 1 and 2 and an interface loop) emanating from the central β-sheet of METTL3 participate in SAM, RNA, and METTL14 binding. While the two gate loops exhibit high flexibility upon SAM or SAH binding and release, the interface loop remains rigid due to extensive protein-protein contacts from METTL14 MTase (Fig. 1a).
While the MTase core of METTL3-METTL14 is not catalytically active form, its structures derived by soaking SAM or SAH into these crystals provided crucial insights into the binding of methyl donor (SAM) and byproduct (SAH) and important conformational changes in the regions of METTL3 (gate loops 1, 2) surrounding these ligands14–16. The m6A-bound structure, which we report here, is the first nucleotide-bound form of the MTase core of METTL3-14 and provides crucial insights into the mechanism of this critical enzyme that is central to normal homeostasis and diseases. Since a small molecule targeting the catalytic pocket of METTL3 has entered human clinical trials for cancer therapy, our results showing the nucleotide binding in the regions outside of catalytic and SAM-binding pockets will pave the way for the rational design of more specific inhibitors.
Evolutionarily conserved m6A pocket plays an essential role in m6A sensing
Strikingly, m6A occupies a cryptic pocket ~16 Å away from the methyl donor SAM pocket with its N6-methyl moiety in an energetically favored syn conformation, facing outward (Fig. 1a). Previously, this region was postulated to bind RNA due to its positive charge and polar nature14–16. m6A is stabilized by a vast network of specific interactions, mostly from METTL3 and R298 of METTL14. The purine ring of m6A is sandwiched between the side chain of M402 and the backbone atoms of the interface loop residues, R471, T472, G473, and H474. The two arginine residues (R471 of METTL3 and R298 of METTL14) act like a clasp to hold the N6-methyl moiety in place through a direct h-bond between R298 and N1, van der Waals and hydrophobic interactions between N6-methyl and its aliphatic portion, and the amino group of the R471 side chain, respectively. The carbonyl oxygen of G473 appears to neutralize the positive charge of the R298 residue. The carbonyl moiety of R471 embraces the N6 atom of m6A via a direct h-bond, while the opposite side is stabilized by the side chain of H474 via a π-π interaction. Altogether, the arginine clasp, interface loop residues R471-H474 and M402, forms a partial closure around the methylated purine ring of m6A. The ribose in the C3’-endo conformation is stacked between the backbone atoms of G473 and H478 and the side chains of I400 and H478. The phosphate group of m6A is locked in place by multiple direct h-bonds with its phosphoryl oxygens and side chains of H478, E481, T433, and K459 (water-mediated) – all from METTL3, and another water-mediated interaction with E257 of METTL14. The side chain of H478 holds the m6A phosphate on one side and E257 of METTL14 on the other, thus acting as a hinge (Fig 1a, Extended data Fig. 1g).
Strict conservation of the extensive interaction network of m6A in human, animal, plant, and yeast suggests that m6A sensing by this cryptic pocket is an evolutionarily conserved mechanism (Fig. 1b). Several key residues that partake in m6A binding, such as R471 and R298 of the arginine clasp, E481, and H478 that stabilize the N6-methyl and phosphate groups are recurrently mutated in endometrioid and adenocarcinoma32 (Fig. 1b). We introduced the R298P mutation in METTL14, a recurrent mutation event in endometrioid carcinoma32,33, and the R471H, E481A, T433A, K459A, and H478A mutations in METTL3. In addition, we generated two deletion mutants (Δ472-473, Δ472-474) in which three residues of METTL3 (T472, G473, H474) that stack against the purine ring of m6A were deleted to shorten the interface loop.
We co-purified the full-length wild-type human METTL3-METTL14 and eight mutant enzymes from insect cells and probed their RNA methylation and binding activities. We used a 30-mer RNA oligo (NEAT2*) consisting of one canonical GGACU motif. Consistently, R298P and R471H mutants significantly reduced (up to 85%), whereas T433A resulted in ~20% loss in methyltransferase activity, agreeing with the reduced m6A levels observed in endometrial tumors harboring the R298P mutation33. The other five mutations in METTL3 (Δ472-473, Δ472-474, K459A, E481A, and H478A) completely abolished the RNA methyltransferase activity of METTL3-METTL14 (Fig. 1c). Thus, the evolutionarily conserved m6A binding pocket is essential for efficient conversion of A to m6A.
Next, we quantitatively determined the binding affinities of wild-type (WT) and mutant enzymes to the substrate and a product RNA, wherein the target A base within GGACU is replaced by m6A. We covalently attached a fluoresceine moiety to the 5’-end of both the substrate NEAT2* (A-RNA) and product (m6A-RNA) RNAs and performed fluorescence polarization-based assays. The WT enzyme can still bind the m6A-RNA and A-RNA with high affinity (Kd = 9-20 nM) (Fig. 1 d,e), corroborating previous studies attributing a sort of m6A-reader function to METTL3 in vivo23,25,31,34. In contrast, the mutants, including R298P and R471H (both mutated in cancers and belong to the arginine clasp motif that stabilizes the m6A) exhibited a loss in binding affinity with varying degrees, with R298P showing weakest binding (Fig. 1e, Extended data Fig. 1h). Thus, inability to sense and distinguish m6A properly by the R298P mutation could result in total m6A and promote tumorigenicity and growth of endometrial tumors as observed previously33. The nanomolar affinity observed in this fluorescence polarization (FP)-based assay for mutant enzymes suggests a significant contribution of accessory motifs such as zinc fingers (ZnFs) of METTL3 and RGG repeats of METTL14 to RNA binding, especially the predicted bulged stem-loop structure of NEAT2* RNA (A-RNA). These motifs are intact in both the wild-type and the mutant enzymes. This could be one of the reasons for not observing the radical change in overall RNA binding as measured by the equilibrium dissociation constant (Kd) for A vs. m6A RNA in an FP-based assay. Moreover, the residue aligning the catalytic and cryptic pockets would interact with the substrate (A) and the product (m6A) nucleotide of the ‘DRACH’ sequence during the pivoting of the base upon conversion to m6A, respectively. Even if the mutations in the cryptic pocket retain overall RNA binding dominated by domains flanking the MTase core (ZnFs and RGG) and the secondary structure of RNA itself (GGACU containing stem-loop RNAs show higher affinity), they could still influence the pivoting of the m6A base and its release after conversion.
We also performed a kinetic analysis by varying the concentration range of RNA substrate from 10 nM to 10 μM in the presence of a saturating concentration of SAM (10 μM) (Fig. 2a). Consistently, these results show that the wild-type enzyme yields the highest methylation activity, whereas the mutant enzymes show reduced methylation. Next, we studied the binding kinetics of the full-length METTL3-METTL14, wild-type (WT), and the two mutant enzymes harboring R298P and R471H mutations in METTL14 and METTL3, respectively. We employed the surface plasmon resonance (SPR) technique, a gold standard for studying binding kinetics that includes ON (Kon) and OFF (Koff) rates of RNA binding. We used our original RNA substrate, NEAT2 (30-mer bulged stem-loop) RNA, and its methylated version (NEAT2-m6A). We also examined a 14-mer linear RNA substrate (r6T) and its methylated form (r6T-m6A) to fully understand the kinetics of enzyme binding to GGACU-containing RNAs with different shapes and sequences. The SPR data of the WT enzyme fit well with a 1:1 binding model. As shown in Fig. 2b and Tables 1-3, the binding affinity and kinetics of METTL3-METTL14 enzymes differ significantly on the two RNA oligos tested. The structured NEAT2 RNA shows a 5-fold tighter affinity than a linear r6T substrate, while their methylated counterparts show reduced binding (1.3-fold for NEAT2-m6A and 2.3-fold for r6T-m6A), but the Kds (dissociation constants) are still in sub and low-micromolar range.

Enzyme and binding kinetics.
a, Methylation of NEAT2* RNA by full-length METTL3-METTL14 (wild-type, WT and its mutants) at saturating concentrations of SAM and RNA. b-c, Kinetics of RNA binding to the WT and mutant METTL3-METTL14 as measured using surface plasmon resonance. Two RNA oligos (NEAT2* and a single-stranded RNA) comprising substrate A (grey circle) or product m6A (red circle) were probed.

Capture level of different RNA substrates

Kinetic parameters for all evaluated bindings with 1:1 binding model

Kinetic parameters for all evaluated bindings with two state reaction model
Interestingly, the ON (Kon) and OFF (Koff) rates for a linear substrate RNA differ 2-2.7-fold compared to NEAT2 RNA. A 2.7-fold faster OFF rate on a linear substrate would result in a rapid turnover and higher methylation of the GGACU motif residing in a linear RNA compared to the loop region of a stem-loop RNA. At the same time, the structured elements in RNA can help recruit METTL3-METTL14, as suggested by a 5-fold stronger affinity to NEAT2 RNA. These results suggest the RNA shape surrounding the core ‘GGACU or DRACH’ motif is a crucial determinant of methylation. This observation can explain, in part, why only a fraction of potential DRACH motifs (or perfect GGACU) are methylated in vivo.
The SPR data of the two mutant enzymes (R471H and R298P) revealed a change in Rmax and mode of binding. While the SPR data of the WT enzyme fit well with the 1:1 binding model, the mutant data could only fit well with a two-state reaction model (Table 3). The R298P mutation in METTL14 results in a moderate loss (1.4-1.6-fold) of binding to the stem-loop NEAT2* RNA (Kd=256 vs. 356 nM) and its methylated counterpart (Kd= 337 vs. 538 nM) or the linear r6T RNA (Kd=1360 vs. 2160 nM) but a significant loss (>7-fold) in RNA binding occurred for methylated linear r6T RNA (Kd=3120 vs 22900). On the other hand, the R471H mutant exhibits much slower dissociation after binding, thus hampering the enzyme’s turnover. These data suggest that the two arginines (R471H of METTL3 and R298P of METTL14) in the m6A pocket, which is cryptic in nature, are important for recognizing the methylation status, and the replacement of R298 to proline and R471 to histidine would negatively impact the methylation of the canonical GGACU motif. Of note, striking differences in the mode of binding – two-state binding for R471H/ R298P mutants vs. one-state binding of the WT enzyme – and their dynamics (ON and OFF rates) likely alter the retention time of the enzyme on RNA with varied shapes and sequences or residence time for m6A of these RNAs in the cryptic pocket. Consequently, multi-stage RNA binding and altered dynamics could alter specificity. An independent study by Zhang et al. reported that R298P mutation alters the enzyme’s preference from GGAC to GGAU35. In this context, our structural and binding data provides crucial and timely insights into the existence of a cryptic pocket, the importance of two arginines for methylation of the canonical GGACU motifs, and how mutations at these positions could alter the dynamics of RNA binding of METTL3-METTL14 and ultimately alter enzyme specificity.
To assess the dynamic impact of the mutations in METTL3-METTL14 on m6A binding, we conducted supervised molecular dynamics simulations (SuMD) and analyzed the distances between the center of mass (com) of the m6A and the product m6A binding pocket (defined by residues within 4 Å of m6A (see methods) over time for wild-type and each mutant, including T433A, K459A, R471H, Δ472-473, Δ472-474, H478A, E481A, and R298P. The wild-type METTL3-METTL14 complex displayed distances around 1.5 Å for most of the simulation time, highlighting the presence of m6A within the product m6A binding pocket (Extended data Fig. 3a and 4a). Furthermore, this also indicates that the product m6A binding pocket in the wild-type is well-structured to accommodate m6A securely and thereby maintain a stable binding environment (Extended data Fig. 3b). In the wild-type, interactions between H478, T472, and m6A are observed. Some additional interactions are also formed; for example, T433 and E481 form stable interactions with the phosphate group via a water molecule. A salt bridge between K459 and E481 helps to stabilize the water molecule (Extended data Fig. 4a). In H478A, which is no longer able to interact with m6A, the phosphate group becomes mobile and is unable to anchor to A478 (Extended data Fig. 4f). In T433A and R298P mutations, the distance between the center of mass of m6A and the product m6A binding pocket mostly ranged from 2 to 4 Å, suggesting that these mutations, while impactful, do not entirely abolish m6A binding (Extended data Fig. 4b, c). Consequently, these mutants could retain m6A in the product m6A binding pocket for most of the simulation time. It is interesting to note that in the T433A mutation, in spite of the h-bond interaction between the phosphate group and the side chain of T433 is lost, the interaction between H478 and the phosphate group remains intact (Extended data Fig. 4c). Therefore, this T433A mutation does not significantly affect the binding of m6A. In the case of R298P (Extended data Fig. 4b), although the arginine clasp was broken, the phosphate group remains stabilized in the same position, making interactions with H478. Moreover, E481 in the R289P mutant can also contribute to stabilizing the phosphate group via a water molecule (Extended data Fig. 4b). However, in the E481A mutant, this water bridge is lost. Similarly, the mutation in K459A results in the loss of a salt bridge with E481, leading to localized destabilization (Extended data Fig. 4d, g). The resulting electrostatic repulsion between the negatively charged side chains of E481 and the phosphate group of m6A pushes the m6A out of the product m6A binding pocket (Extended data Fig. 4g). For the two deletion mutants (Δ472-473, Δ472-474), m6A immediately leaves the product m6A binding pocket after the removal of the constraint in the equilibration steps, highlighting the essential nature of these residues in maintaining the binding pocket’s structure (Extended data Fig. 4h, i).
Base swiveling facilitates m6A sensing
The two loops in METTL3 (gate loops 1 and 2) surrounding the methyl donor SAM and acceptor base A pockets show varying degrees of flexibility upon SAM and SAH binding from their original positions in a ligand-free (apo) form14–16. Thus, we compared the m6A structure with three states (SAM, SAH, and apo). These loops also move in opposite directions upon m6A binding from their original positions in the SAM-bound METTL3 (Fig. 3a). Gate loop 1 (aa 398-409) moves ~ 5.7Å inward to the direction of m6A, whereas the gate loop 2 (aa 506-512) moves ~ 7.8Å outward, with several residues in this region, including H512, that flips ~180º. The invariant T433 and G434 from a small loop between β3 and α2 move ~ 2.1Å with the side chain of T433 rotating ~90º to stabilize the phosphate and ribose of m6A (Fig. 3a). This region remains unperturbed in SAH-bound METTL3, suggesting the m6A binding to this pocket occurs after hydrolysis of SAM (Fig. 3b). While the gate loop 2 in SAH remains in open confirmation, akin to SAM conformation, the position of gate loop 1 in m6A experiences significant repositioning of the M402 side chain (Fig 3c). Although m6A-bound METTL3 is most similar to the apo form with the smallest root mean square deviation for superposition of 1539 atoms of METTL3 achieved for apo (1.2), compared to SAH (1.5), and SAM (1.9), we observed notable changes in the m6A pocket (Fig. 3c).

Base swiveling and loop orchestration.
a-c, Upper panels show overlays of regions of METTL3 encompassing the catalytic motif, gate loops 1 and 2, and interface loop in METTL3 bound to m6A (red stick), SAM (pink stick), and SAH (orange stick). Arrows indicate the directional movement of loops. Lower panels: The entire region of each overlay is in stick mode. Green dots, the residues that form the m6A interaction network. d, Close-up of an overlay of m6A and apo MTase of METTL3-METTL14 shown in two orientations for clarity. The exit channel between M402 and H474 in the m6A bound conformation becomes wider (up to 8Å) to stabilize m6A and avoid steric clashes with its purine and ribose moieties. e, An overlay of MTase cores of arabidopsis METTL4 (light blue cartoons)/SAH (light blue stick)/Am (blue stick) and METTL3 (cyan)-METTL14 (orange)/m6A (red stick) clarifies the ~ 120º pivot of the base around phosphate. Black dots, water molecules in the m6A structure help stabilize the m6A and compensate for the loss in binding energy in the site emptied by base pivoting. f, Change in emission fluorescence intensity upon titration of increasing concentration of WT (upper panel) and R298P mutant enzymes (lower panel) with 2-aminopurine (2-Ap) containing RNA (n=3). See the methods section and source data for details.
The side chain of M402 from gate loop 1 in the m6A structure stacks over the purine ring of m6A. In the SAM-bound form, this region is moved >5Å away, but in the SAH and apo forms, the M402 side chain will sterically clash with m6A ribose (distance between Cε of M402 and C4’ of ribose ~1.2 Å). To avoid this clash, the side chain of M402 in m6A-METTL3 rotates > 45º, resulting in a ~3.8Å gain in the distance for the Cε atom compared to its position in the apo structure. As a result of this repositioning, the inter-gate area between interface loop (H474) and gate loop 1 (M402) becomes wider, from 6.8Å in apo to 8.0 Å in the m6A structure (Fig. 3d). Thus, gate loop 1 from one side senses the SAM and targets the RNA base at the point of catalysis (395DPPW398 motif). It then swivels after SAM hydrolysis to facilitate the sensing of m6A status of the target base at the opposite or exit site.
Another change occurs in how the side chain of invariant R298 (METTL14) orients within the arginine clasp. The R298 side chain rotates ~180º around its Cβ, although the guanidino group shifts slightly to form a direct h-bond with N1 of m6A (Fig. 3d, Extended data Fig. 1g). The orientation of the gate loops suggests that m6A-METTL3 represents a state of enzyme post-catalysis before release of any product or enzyme reset.
How does m6A swivel ~16Å from the point of catalysis to occupy this novel pocket in METTL3? To answer this question regarding the mechanism of base-swiveling, we once again employed supervised molecular dynamics (SuMD) simulations. The simulations successfully captured the transition of the m6A from the substrate A pocket to the product m6A binding pocket. The phosphate group of m6A makes h-bond interactions with H478 (Extended data Fig. 4a). This interaction acts like a hinge and anchors m6A, which then allows the nucleotide base in m6A to swivel and eventually occupy the product m6A binding pocket. Once in the product m6A binding pocket, the nucleotide base of m6A can form h-bond with R298 (Extended data Fig. 4a). The most stable structure of the m6A in the product m6A binding pocket displays a root-mean-square deviation (RMSD) of ~ 2 Å with the resolved crystal structure (Extended data Fig. 5). This close structural alignment with the crystallographic data highlights the significance of the observed transition mechanism and corroborates with the H478A mutation where the RNA methyltransferase activity is completely abolished in the METTL3-METTL14 complex. To further validate these interactions, we calculated the interaction energy between m6A and the METTL3-METTL14 complex (Extended data Fig. 5-7). The results showed significant binding affinity and stability, supporting the observed h-bond interactions and the overall structural integrity of m6A within the m6A binding pocket (Extended data Fig. 7).
To verify our findings, we superposed m6A-METTL3 over the structure of Arabidopsis METTL4, a member of the subclade of the MTA-70 family that possesses the substrate 2’-O methyladenosine (Am)36. The central β-sheet and the catalytic motif of the two enzymes (DPPW) overlay very closely. In this model, the acceptor N6 atom of Am resides at ~3Å or less from the methylsulfonium group of SAM for SN2 mechanism of direct methyl transfer. The phosphates of Am and m6A lie in close proximity (~1.2Å). However, their purine and ribose rings are rotated ~120º in opposite directions, suggesting the base (A) pivots after conversion into m6A (Fig. 3e). Such a rotation may necessitate the de-stacking of the target base for its presentation to catalytic pocket and or base swiveling.
A water molecule at the putative site of the substrate A base is present in the m6A structure to compensate for the loss in binding energy in the emptied site by rotation of m6A from this site post-catalysis. This water coordinates with K459, and its mutation to alanine abolishes the methylation activity (Fig. 1c). SAM-dependent DNA methyltransferases, including the ancestral members of MTA-70 family MTases such as EcoP15I, efficiently flip the target adenine base out of the DNA helix into the catalytic pocket37. Although METTL3-METTL14 does not methylate dsDNA and dsRNA11,12, it can still de-stack the target base from a single-stranded RNA into the catalytic pocket, similar to the m6A/m6Am eraser enzyme, FTO38,39, and the m6A reader, YTHDC140. To test this activity, we replaced the target A (6-aminopurine) in a GGACU in a 14-mer ssRNA with 2-aminopurine (2Ap), a fluorescent nucleobase used as a conformational probe due to its high sensitivity to changes in the local environment induced by DNA41 and RNA MTases42. As shown in Fig. 3f, the change in fluorescence intensity (at 371nm) with increasing enzyme concentrations was rapid for WT but not the R298P mutant enzyme, confirming the diminished RNA binding and base de-stacking ability of the mutant enzyme. While the cellular impact of R298P mutation has been studied in the context of cancer33, our data now uncover a precise mechanistic role of R298 in m6A sensing. Thus, an elegant orchestration of loops surrounding the SAM/SAH, substrate A, and product m6A binding pockets enables m6A base swiveling and sensing (see Movie 1).
To capture an AMP-bound METTL3-14, which could serve as a control structure, we extensively attempted co-crystallization and soaking of AMP into apo crystals but could not observe AMP around the catalytic pocket (DPPW or motif IV) or the m6A binding pocket. We reason the highly mobile nature of the substrate adenine base in the catalytic pocket for this. To gain insights into this phenomenon, we examined the Am binding of the published structure of Arabidopsis METTL4 (PDB: 7CV6)36. The slightly low occupancy coupled with high average B-factors (B = 177 Å2) of Am base in Arabidopsis METTL4 suggest a highly mobile nature of the Am base in the catalytic pocket (Extended data Fig. 2a). Furthermore, Am’s RSCC (real space correlation coefficient) score in Arabidopsis METTL4 is 0.66. A value of RSCC score below 0.8 indicates a modest fit43. In contrast, the m6AMP in our hMETTL3-METTL14 methyltransferase core structure fits nicely into the electron density at full occupancy (1.0) (Extended data Fig. 1 d-f). Consistently, an RSCC score of 0.85 with low average B-factors (B = 70 Å2) confirms a relatively stable mode of m6A binding to hMETTL3-METTL14 (Extended data Table 1 and PDB validation report).
While our work was in preparation, Corbeski et al. reported crystal structures of METTL3-METTL14 MTase core in complex with synthetic bisubstrate analogs (BAs), wherein methyl donor SAM was covalently linked to the substrate adenosine. These analogs may represent a transition state during methyl transfer44. This study suggests that the substrate nucleotide-bound structures of METTL3-METTL14 could only be resolved when the N6 of adenosine was covalently attached to SAM via a 2-3 carbon linker. Interestingly, despite spatial restriction imposed by covalent linkage, the substrate adenosine moiety still exhibits significant flexibility within and across crystals obtained from soaking two different analogs, e.g., BA2 and BA4 (Extended data Fig. 2b, c). For example, the adenosine moiety of the covalent analog BA2 samples two different orientations; in a ‘buried’ conformation, it occupies the substrate pocket of METTL3 and interacts with E481 and K513, whereas in an ‘alternate conformation,’ it rotates ~90º and exposes to the solvent. In the BA4-METTL3-14 structure, the covalently attached substrate adenosine rotates into solvent-exposed orientation while the cosubstrate SAM remains rigid and occupies the SAM-binding pocket in both structures (Extended data Fig. 2b, c). Importantly, the movement of the adenosine in BA-analogs will be limited due to the covalent linkage to SAM, which naturally has a high affinity. However, the adenosine continuously tries to move in and out of the catalytic pocket. We believe these structures could serve as a control where adenosine is captured in the methyl acceptor state of the N6, precisely the way we modeled it by comparing the METTL4-Am structure. Moreover, the gate loop 1 and the interface loop are disordered in METTL3-14 bisubstrate analog structures, most likely due to the lack of stabilizing interactions. In contrast, these regions of METTL3-14 are well resolved in our m6AMP-bound structure due to their stabilizing interaction with m6AMP. Altogether, these observations suggest a highly mobile nature of the substrate adenine (A) base in the catalytic pocket.
The center of mass distance measurements in the simulations revealed that m6A consistently maintained the shortest average distance of ~1.5 Å with low variability, indicating a strong and persistent binding interaction. In contrast, other nucleotides exhibited greater and more variable distances, typically exceeding 2 Å and occasionally reaching up to 5 Å, especially AMP, CMP, and GMP, suggesting weaker and less stable interactions. AMP, CMP, and GMP showed the largest RMSD values, > 4 Å, indicating the least stability in their binding positions (Extended data Fig. 3b). This instability can be attributed to the inability of M402 to form hydrophobic interactions with the methyl group of m6A. In AMP, the loss of the methyl group prevents M402 from stabilizing the nucleotide. Although AMP can still form strong interactions with the complex, the RMSD plot indicates significant flexibility within the binding pocket. The results from SuMD are in excellent agreement with our experimental findings, which highlight the specific binding preference of the METTL3-METTL14-core for m6A.
METTL3-METTL14 acts as an atypical m6A sensor
The m6A-METTL3-METTL14 structure allowed us to gain valuable insights into how m6A writer (METTL3-METTL14), eraser (FTO), and reader (YTHDC1) proteins accommodate m6A. We examined their m6A pocket in detail (Fig. 4a-c). Despite the lack of obvious resemblance at the protein sequence, domain, and structure levels, we observed high similarity in the interaction networks of m6A in METTL3-METTL14 to the binding mode of 6mA in FTO (PDB: 5ZMD) and m6A in YTHDC1 (PDB: 4R3I) (Fig. 4). Of note, the purine ring of 6mA in FTO stacks between a hydrophobic amino acid, L109 (the equivalent of M402 in m6A), from the top and the backbone atoms of V228, S229, and H231 (the equivalent of T472, G473, and H474 in m6A) from the bottom. Interestingly, the arginine clasp we found in m6A-METTL3-METTL14 is also present in 6mA-FTO. Notably, the side chain of R96 in FTO forms a direct h-bond to N1 of 6mA, while the guanidino group of its R322 residue forms a van der Waals interaction with N6 methyl group, akin to identical interactions by R298 and R471 to stabilize m6A in m6A-METTL3-METTL14. Stacking interactions that lock the sugar moieties in place also display similarities. For example, the sugar of 6mA in FTO stacks between I85 and H231, whereas the sugar of m6A stacks between I400 and H478 of METTL3 (Fig. 4a, b).

Mode of m6A binding by writer/sensor, eraser, and reader.
Interaction networks of m6A (red) binding to METTL3 (green), and METTL14 (a), 6mA (blue) binding to FTO (b), and m6A binding to YTH domain of YTHDC1 (c). The two nucleotides flanking the flipped methylated base in FTO and YTHDC1 are shown in light blue and grey, respectively. The hydrophobic stacking surface in YTHDC1 can only be aligned by rotating the molecule 180º around the x-axis, suggesting that reader proteins approach RNA from the opposite direction. The m6A pocket of METTL3-METTL14 harbors features that enable it to act as an atypical m6A sensor/reader during its switch from writer to reader. Dashed lines, h-bonds.
We found that m6A in METTL3-14 and YTHDC1 (PDB: 4R3I) had many similarities and striking differences, mainly in the orientation of the base (Fig. 4c). The N1 of m6A forms an h-bond with N367, whereas an h-bond with carbonyl of S378 akin to carbonyl of R471 of METTL3 stabilizes the N6. Additional hydrophobic interactions from W377 and W428 also support the N6 methyl group in YTHDC1. The nature of stacking interactions for the purine ring is also similar, i.e., hydrophobic residues M434, L380, and L439 on one side and backbone atoms of K361, S362, and N363 on the other. However, the orientation of the m6A base in YTHDC1 is reversed by 180º compared to 6mA in FTO and m6A in METTL3-14. As such, when the direction of sugars and phosphates of modified bases is aligned in three structures (facing downward in Fig. 4a, b, and upper panel of c), the hydrophobic residues (M434/L380/L439) in YTHDC1 stack from the bottom side and the backbone atoms of K361, S362, and N363 stack from the top side, in contrast to the base orientation in FTO and METTL3. A ~180º rotation of YTHDC1 will place the interacting residues in all three proteins in the same plane. However, the orientation of ribose and phosphate of m6A in YTHDC1 will also be reversed (facing upward, Fig. 4c lower panel). Thus, a m6A reader protein approaches the m6A entirely differently than a writer or eraser. This unique geometric difference may allow the reader to avoid clashes with a writer or eraser enzyme acting simultaneously on the same transcript.
There could be two scenarios for stabilizing m6A in the cryptic pocket: a. The pocket may have the capacity to bind to all nucleotides, but m6A can outcompete other nucleotides due to its higher binding affinity to the MTase core. b. The pocket may exclusively interact with m6A while nucleotides flanking A/m6A weakly interact with other RNA binding domains of METTL3-14. Consequently, mutations near the pocket could disrupt the binding to m6A or alter the preference from m6A to other nucleotides. We show that METTL3 possesses features that enable it to act as an atypical m6A sensor/reader – a function ideally suited for its emerging non-catalytic functions, including crosstalk with eIF3H to promote mRNA circularization, thereby enhancing RNA translation as observed in lung cancer23,25 and bone marrow mesenchymal stem cells21. Consistently, METTL3 exhibits a strong affinity to a methylated (m6A) RNA form, especially those containing secondary structures, a feature that could be important for its non-catalytic roles such as an ‘m6A reader’ for an alternative mode of translation initiation during oncogenic translation23,25 and cellular stress (e.g., heat shock)34.
Methods
METTL3-METTL14 MTase core
The gene encoding the MTase domains of human METTL3 (aa 357-580aa) and METTL14 (aa 116-402) were cloned into a pETduet-1 vector and expressed in E. coli NiCo21(DE3) cells. The transformed cells were grown in Terrific Broth medium supplemented with 1 mM ampicillin at 37°C until OD600nm reached 0.6. Protein expression was then induced by adding 0.4 mM isopropyl β-D-thiogalactopyranoside, and the culture was grown at 18°C for 16 hrs. The cell pellets were harvested by centrifugation at 6000 r.p.m. at 4°C and resuspended in cold lysis buffer containing 25 mM Tris pH 8.0, 0.5 M NaCl, 10% glycerol, 5 mM imidazole, 0.1 mM TCEP, one tablet of protease inhibitor (Roche), lysozyme (0.1 mg/mL), and DNase I (5U/mL) and stirred gently at 4°C until achieving full homogeneity. Resuspended cells were lysed by two passages through a microfluidizer (Analytik, UK) and subjected to centrifugation at 41,000 r.p.m. for 50 min at 4°C. The clarified supernatant was filtered through a 0.22 μm filter and loaded onto a Nuvia IMAC column (Bio-Rad) pre-equilibrated with wash buffer (25 mM Tris pH 8.0, 0.5mM NaCl, 10% glycerol, 5 mM imidazole, and 0.1 mM TCEP). The His-tagged METTL3 was co-eluted with untagged METTL14 by increasing the imidazole concentration. The eluates were dialyzed in a buffer lacking imidazole overnight at 4ºC in the presence of the ULP1 enzyme to remove the His-SUMO tag from METTL3 proteolytically. The dialyzed proteins were then re-loaded onto an IMAC column to remove un-cleaved proteins and the His-SUMO tag. Two successive passages through MonoQ and Hiload Superdex75 columns (Cytiva) further purified the tag-free complex. The fractions of a homogenous peak eluted in 20 mM Tris pH 8.0, 0.2 M NaCl, and 0.1mM TCEP were pooled, concentrated to 15 mg/ml, and either used immediately or flash-frozen in liquid nitrogen and then stored at -80°C.
Full-length METTL3-METTL14 and mutants
The full-length human METTL3 and METTL14 (wild-type and mutants) were expressed in insect cells (ExpiSF Expression System, Thermo Fisher) and purified using a protocol published earlier12. In brief, the METTL3 and METTL14 plasmids were transformed individually into Max Efficiency DH10Bac competent cells (Thermo Fisher) to generate the DNA bacmids. The successful insertion of genes was confirmed by PCR amplification using a pUC/M13 primer (Forward: 5’-CCCAGTCACGTTGTAAAACG -3’, Reverse: 5’ – AGCGGATAACAATTTCACACAGG -3’). The amounts of purified bacmids and ExpiFectamine SF transfection reagent (Thermo Fisher) were optimized as per the manufacturer’s recommendations (Thermo Fisher). The ExpiSf9 insect cells were cultured in ExpiCD medium (Thermo Fisher) at 125 r.p.m. and 27°C in a non-humidified, air-regulated environment. The cells were harvested 72 hrs post-infection by spinning at 300 × g for 5 min. The PBS-washed cells were resuspended in cold lysis buffer containing 0.5% Igepal, two tablets of protease inhibitor (Roche), and DNase I. Cells were lysed by passing through a microfluidizer (Analytick, UK) and clarified by centrifugation at 41,000 r.p.m. for 40 min.
The proteins were purified using a strategy similar to that of the MTase core, except for removing the His-tag from METTL3. This step was achieved by incubating proteins after the affinity column step with TEV protease for 3 hrs at room temperature. A second passage through a nickel IMAC column removed contaminants and any uncleaved fractions. The complex was then successfully purified by successive passages through HiTrap Heparin and Hiload Superdex 200 columns (Cytiva). Eluates from a homogenous peak of a Superdex column run in a buffer of 0.02 M Tris pH 8.0, 0.15 M NaCl, and 5% glycerol were pooled, concentrated to 1-3 mg/ml, and flash-frozen in liquid nitrogen and stored at -80°C. All full-length METTL3-METTL14 mutants (METTL3: T433A, K459A, R471H, Δ472-473; Δ472-474, H478A, E481A; METTL14: R298P) were generated by site-directed mutagenesis and purified by the same method as the wild-type protein.
Crystallization, data collection, and structure determination
The crystallization of the human METTL3-METTL14 MTase core (at 10 mg/mL concentration) was carried out by an OryxNano robotic system (Douglas Instruments) using the sitting-drop vapor diffusion method at 20°C. Initial crystals were grown in a solution containing 0.1 M MES pH 6.0, 1.0 M potassium sodium tartrate. After several rounds of optimization by varying pH and salt concentrations, large reproducible crystals were grown in seven days. The N6-methyladenosine monophosphate (m6AMP; Sigma, M2780) was soaked into native crystals (2.0 mM concentration) for 1 hr at 20°C. A complete diffraction dataset was measured to ~2.5Å at GMCAT 23ID-D beamline at Advanced Photon Source, Chicago, IL. The apo structure of METTL3-METTL14 MTase core (PDB: 5IL0) was used as a search model for molecular replacement in Phenix45. The structure was iteratively built and refined using Coot (Version 0.9.8.6)46, Phenix (Version 1.15.2-3472) and Buster (Version 2.10.4)47, respectively. The ligand geometry restraints were generated by Grade. All structure figures were generated using Pymol (Schrodinger Suite).
In vitro methyltransferase assays
5 μM [methyl-3H] SAM (PerkinElmer), 10 μM substrate RNA (NEAT2*: 5’ – GCCUAGUAGCAGAGAGGACUGCUCCUUGGU - 3’), and 2 μM purified WT or mutated METTL3-METTL14 were mixed and incubated at 37°C for 1 hr in a total volume of 5 μL in a reaction buffer (50 mM HEPES pH 7.5, 5 mM NaCl, and 1 mM DTT). The reactions were quenched by blotting 3 μL of each on the Hybond-N+ membrane (Amersham). The methylated substrates were then crosslinked by exposing them to ultraviolet light (254 nm) for 2 min. The membranes were washed three times with 1X PBS, followed by two 95% ethanol washes. Then the membranes were air-dried inside the hood for 15 minutes, and the RNA probe’s count per minute (c.p.m.) on each membrane were measured by a scintillation counter (Beckman LS6500). All results are reported as the means from three independent experiments (n=3) for each group, with one standard deviation (s.d.).
Fluorescence polarization
The reactions were carried out in a buffer containing 10 mM HEPES pH 7.5 and 50 mM KCl. The two 30-mer RNA probes (native RNA or A-RNA and its m6A-modified version or m6A-RNA) were synthesized with a fluoresceine moiety covalently attached to their 5’-end, de-protected, and purified using HPLC (HorizonDiscovery). The sequence of A-RNA was identical except the target A base within the characteristic motif (underlined and bold) in native A-RNA (Fl-NEAT2*: 5’ – [Fl]GCCUAGUAGCAGAGAGGACUGCUCCUUGGU - 3’), was replaced by N6-methyladenosine (m6A) in the modified RNA (Fl-NEAT2*-m6A: 5’ – [Fl]GCCUAGUAGCAGAGAGG[m6A]CUGCUCCUUGGU - 3’). A constant 5 nM of RNA probes were incubated with increasing concentrations of the purified WT or mutant METTL3-METTL14 enzymes in a 384-well plate. The fluorescence polarization values (excitation wavelength = 485 nm, emission wavelength = 530 nm) of each reaction were measured by PHERAstar FS (BMG Labtech). The affinity of RNA-protein binding was calculated by a simple one-site specific binding model (Y = Bmax*X/(Kd+X), X = protein concentration, Y = specific binding, Bmax = maximum specific binding, Kd = equilibrium dissociation constant). The results were analyzed and fitted by GraphPad Prism (GraphPad Software, San Diego, CA). Each experiment was repeated three times independently (n=3), and final Kd is reported as the mean of the three replicates with standard deviation (s.d.) for each RNA shown as error bars.
Steady-state fluorescence assays
For this experiment, we used a 14-mer single-stranded RNA probe in which the the target adenine base within the m6A motif was replaced with 2-aminopurine (2-Ap) (r6T*: 5’ – CUUCGG[2-Ap]CUCUGCU – 3’). In a 384-well plate format, 0.5 μM of RNA probe mixed with increasing concentrations (1 – 5 μM) of full-length human WT or mutant METTL3-METTL14 enzymes in a 20 μL reaction in the buffer containing 50 mM Tris pH 8.0, and 10 mM MgCl2 and incubated at room temperature. The reaction was excited at 320 nm with a 325 nm cut-off wavelength in a SpectraMax M5 microplate reader (MolecularDevices). The fluorescence emission was measured at 371 nm and 37°C every 5 minutes from 0 - 60 minutes and then every 30 minutes until the end time point (120 minutes). The data were analyzed and fitted by GraphPad Prism (GraphPad Software, San Diego, CA) using the Michaelis-Menten model (Y=Vmax*X/(Km+X), X = protein concentration, Y = enzyme velocity, Vmax = maximum enzyme velocity, Km = Michaelis-Menten constant). All results reported are mean values from three independent experiments with standard deviations (s.d.) shown as error bars.
Surface plasmon resonance (SPR)
The surface plasmon resonance experiments were performed using a Biacore 1S+ equipped with a CM5 sensor chip. Recombinant streptavidin (Millipore Sigma, 11721674001) was first immobilized at all six flow cells using amine-coupling chemistry. The surfaces of flow cells were activated for 7 min with a 1:1 mixture of 0.1 M NHS (N-hydroxysuccinimide) and 0.4 M EDC (3-(N, N-dimethylamino) propyl-N-ethylcarbodiimide) at a flow rate of 10 μl/min. The streptavidin at a concentration of 50 μg/ml in 10 mM sodium acetate, pH 5.5, was immobilized at a density of around 6,000 RU on all six flow cells. All surfaces were blocked with a 7-minute injection of 1 M ethanolamine, pH 8.0. The biotinyl-RNA substrates were then diluted to 100nM in running buffer (10mM HEPES, 150mM KCl, 0.05% P20, pH 7.5) and captured in flow cell 3-6 respectively (12s, 5 μl/min) to reach a level around 50RU (see details below). To measure kinetic binding data, the analytes (METTL3-METTL14WT, METTL3-METTL14R298P, and METTL3-METTL14R471H proteins) were diluted in the same running buffer, with five concentrations ranging from 2.4 to 1500 nM. The analytes were then injected over all flow cells at various concentrations in single-cycle kinetics format at a flow rate of 30 μl/min at 25°C. The analyte was allowed to associate and dissociate for 120 seconds for each injection and dissociate for 1200 seconds, respectively. Data were collected at a rate of 10 Hz. The data were fit to a 1:1 binding model or two-state reaction model, as mentioned, using the data analysis option available within Biacore Insight Evaluation Software (Version 5.0.18.22102).
Molecular Dynamics Simulations
Structure preparation
The crystal structure of the METTL3-METTL14 complex bound to M6A was used as the starting point for all classical molecular dynamics simulations. The AlphaFold model of the METTL14 subunit (UniProt identifier: AF-Q3UIK4-F1) was integrated into the original crystal structure, filling in the gaps and creating a refined METTL3-METTL14 enzyme structure that accounted for the missing residues. Mutants T433A, K459A, R471H, H478A, E481A, and R298P were generated using ICM-Pro software (www.molsoft.com). Additionally, the Δ472-473 and Δ472-474 deletions were obtained from the AlphaFold model. The refined structure was aligned to the crystal structure (PDB ID: 7CV6), and the position of S-adenosyl-L-homocysteine was identified as the initial position of m6A for the m6A-bound METTL3-METTL14 complex. The ProteinPrepare module implemented in the PlayMolecule was employed to assign the protonation states of residues at pH 7.048.
System setup and simulation protocol
The simulations were conducted using the Amberff14SB force field for the protein49. The m6A was subjected to geometry optimization using Gaussian 16 (HF/631G*) (www.gaussian.com). The m6A parameters were derived with GAFF as implemented in Ambertools23 using antechamber and parmchk tools50. RESP partial charges were calculated with Gaussian 16 following the procedure suggested by antechamber51. The preprocessed structure was explicitly solvated in a cubic periodic of water molecules represented by the transferrable intermolecular potential with 3 points (TIP3P), whose boundary is at least 10 Å from any solute atoms so that the protein does not interact with its periodic images. Periodic boundary conditions in all directions were utilized to reduce the finite system size effects. To neutralize the total charge, Na+/Cl− counterions were added. Subsequently, the systems were energy minimized by 5000 steps with the conjugate gradient method to remove any local atomic clashes. Initial velocities within each simulation were sampled from Boltzmann distribution at a temperature of 300 K. The solvents were equilibrated for five ns under the NPT ensemble. The production simulations of supervised molecular dynamics were run under the NVT ensemble using a Langevin thermostat with a damping of 0.1 ps-1 and hydrogen mass repartitioning scheme to achieve time steps of 2 fs. Berendsen thermostat and Langevin barostat were used to keep the temperature and pressure constant, respectively52. Long-range electrostatic interactions were computed using the particle mesh Ewald summation method53. The cutoff radius for neighbor searching and nonbonded interactions was taken to be 9 Å with a switching distance of 7.5 Å was used, and all bonds were constrained using the LINCS algorithm54. In total, > 20 SuMD simulations were run as a swarm. Of these, the first three replicas that met the supervision criteria were selected for analysis. All simulations were run using the ACEMD engine55.
Supervision procedure
Supervised molecular dynamics is a method that can accelerate the binding process between ligands and protein recognition without introducing bias56. This method employs an algorithm that monitors the distance between the ligand and the protein. Short simulations of specific lengths are run, and the distance between the ligand and the protein is calculated. The fitting of linear least squares is applied to fit the data, showing the distance against time. If the slope of the resulting straight line is negative, indicating that the ligand is approaching the binding site, then the state of the last frame, including the velocity and the coordinates of this short trajectory, will be used as the initial state for the next short trajectory. On the contrary, if the slope is positive, thereby indicating that the ligand is not approaching the binding site, the short trajectory will be discarded, and the simulation will restart from the last initial state. However, to avoid the ligand being stuck, assessed by 10 consecutive failed steps, a relatively longer simulation is run, followed by the final state of the simulation being used as the starting point for the successive step. The supervision algorithm is switched off when the distance reaches a defined threshold value. To explore the m6A swivel from substrate A binding pocket to product m6A binding pocket, a supervision protocol was designed in two steps. In the first step, during the production run of the MD trajectory, the distance between the center of mass of the m6A and the center of mass of the residues constituting the product m6A binding pocket (METTL3: I400, M402, T433, G434, R435, R471, T472, G473, H474, H478, E481, and METTL14: R298) is monitored over a fixed time window (0.02ns). In the second step, the distances between two key atom pairs were calculated, namely R298:NH1-m6A:N1 and H478:ND1-m6A:P1. The trajectory analysis was carried out, and the figures were made using PyMol (www.pymol.org) and VMD57. The graphs were made using Python scripts.
Additional information
Author contributions
Y.K.G. conceived, designed, and supervised the overall study; S.Q. A.K. purified proteins and performed biochemical assays. M.P., C.V., and N.G. assisted with protein purification. S.Q. performed crystallography. S.Z. performed SPR experiments. S.C. and S.H. performed molecular dynamics. S.H.C., M.K.R., and S.F.M. provided critical reagents. S.Q, A.K., S.C, S.Z., S.H., and Y.K.G. analyzed data. Y.K.G. wrote the manuscript with input from all authors. All authors approved this version.
Supplementary material

Data collection and refinement statistics (molecular replacement)

a, Coomassie-stained SDS-PAGE showing high purity of METTL3-METTL14 MTase core. b, Size-exclusion chromatography coupled with multi-angle scattering estimated a molecular mass of this complex of ~59 kDa, in excellent agreement with theoretical mass (~ 60 kDa). c, crystals of METTL3-METTL14 MTase core used for soaking N6-methyladenosine monophosphate (m6AMP or m6A). d, A green mesh showing an unbiased electron density omit map countered at 2.2σ, confirming the presence of m6A. e-f, A blue mesh representing a 2Fo-Fc map (σ = 1.0) showing the final refinement of the m6A-METTL3-METTL14 structure. The map confirms the excellent agreement between calculated and observed electron density for the region surrounding m6A and for m6A itself (f). g, Network of interaction between m6A and residues from METTL3 (green) and METTL14 (orange). g, Quantitative measurement of 30-mer RNA (left panel, A-RNA; right panel, m6A-RNA) binding (n = 3) to the WT and mutant enzymes shown as binding isotherms fitted with a one-site specific binding model, (Y=Bmax*X/(Kd + X). The equilibrium dissociation constant (Kd) was derived from three independent experiments, with error bars indicating the range of data points (n = 3). m6A replaces the central adenine base within the GGACU motif in A-RNA in m6A-RNA. See the methods section and source data for details.

a, Am (blue stick) binding into ‘DPPW (or motif IV)’ in Arabidopsis METTL4 (green stick, PDB: 7CV6). Blue mesh, 2Fo-Fc electron density map contoured at σ = 0.97. b, BA2 SAM-Adenosine covalent analog sampling two different conformations in human METTL3-14 MTase in complex with BA2 (Corbeski et al., PMID: 38470714). c. Overlay of METTL3-14 MTase core bound to BA2 and BA4 analogs and m6A (this study).

The distance between the center of mass of m6A and the center of mass of the product m6A binding pocket for (a) mutants and (b) nucleotides.

The most stable conformation of the mutants, as identified from SuMD simulations.

The distance between the center of mass of (a) m6A and the center of mass of the product m6A binding pocket; the distance between m6A and (b) H478 and (c) R298 and (d) the plots of interaction energies from the three replicas of SuMD.

The base swiveling mechanism of m6A between the starting conformation (orange) and the end (green) conformation.
Different snapshots of m6A are illustrated in cpk sticks. The arrow shows the direction of the swiveling nucleotide.

The interaction energy between m6A and the product m6A binding pocket of the wild-type and mutants.
Additional file
Data availability
The coding sequences of METTL3 (NCBI reference sequence GI: 33301371) and METTL14 (NCBI reference sequence GI: 172045930) used in this study are available at NCBI. We have provided source data as a separate Source Data file. The atomic coordinates and structure factors were deposited in the Protein Data Bank (PDB) under accession code 9DGJ (m6AMP) and DOI: 10.2210/pdb9dgj/pdb. The start files and the trajectories from molecular dynamics simulations can be downloaded from https://doi.org/10.5281/zenodo.12681486. Requests for additional material and information should be directly addressed to Y.K.G. (guptay@uthscsa.edu).
Acknowledgements
This work was supported by the Welch Foundation (AQ-2101-) and, in part, by funding from NIH/NIAID (R01AI161363) to Y.K.G. C.V. is supported by an NIH T32 training grant (T32HL007446). S.F.M. is supported by the Cancer Prevention and Research Institute of Texas (RP210208). GM/CA at APS has been funded by the National Cancer Institute (ACB-12002) and the National Institute of General Medical Sciences (AGM-12006, P30GM138396). This research used resources of the Advanced Photon Source, a U.S. Department of Energy (DOE) Office of Science User Facility operated for the DOE Office of Science by Argonne National Laboratory under Contract No. DE-AC02-06CH11357.
References
- 1Characterizafion and parfial purificafion of mRNA N6-adenosine methyltransferase from HeLa cell nuclei. Internal mRNA methylafion requires a mulfisubunit complexJ Biol Chem 269:17697–704Google Scholar
- 2N6-adenosine methylafion in mRNA: substrate specificity and enzyme complexityBiochimie 76:1109–14Google Scholar
- 3Comprehensive analysis of mRNA methylafion reveals enrichment in 3’ UTRs and near stop codonsCell 149:1635–46Google Scholar
- 4A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylafionNat Chem Biol 10:93–5Google Scholar
- 5Topology of the human and mouse m6A RNA methylomes revealed by m6A-seqNature 485:201–6Google Scholar
- 6N (6)-methyladenosine of chromosome-associated regulatory RNA regulates chromafin state and transcripfionScience 367:580–586Google Scholar
- 7m(6)A mRNA modificafions are deposited in nascent pre-mRNA and are not required for splicing but do specify cytoplasmic turnoverGenes Dev 31:990–1006Google Scholar
- 87SK methylafion by METTL3 promotes transcripfional acfivitySci Adv 9:eade7500Google Scholar
- 9Purificafion and cDNA cloning of the AdoMet-binding subunit of the human mRNA (N6-adenosine)-methyltransferaseRNA 3:1233–47Google Scholar
- 10Structure predicfion and phylogenefic analysis of a funcfionally diverse family of proteins homologous to the MT-A70 subunit of the human mRNA:m(6)A methyltransferaseJ Mol Evol 55:431–44Google Scholar
- 11Human MeftL3-MeftL14 complex is a sequence-specific DNA adenine methyltransferase acfive on single-strand and unpaired DNA in vitroCell Discov 5:63Google Scholar
- 12RNA binding to human METTL3-METTL14 restricts N(6)-deoxyadenosine methylafion of DNA in vitroeLife 11Google Scholar
- 13Beta class amino methyltransferases from bacteria to humans: evolufion and structural consequencesNucleic Acids Res 48:10034–10044Google Scholar
- 14Structural basis of N(6)-adenosine methylafion by the METTL3-METTL14 complexNature 534:575–8Google Scholar
- 15Structural Basis for Cooperafive Funcfion of Meftl3 and Meftl14 MethyltransferasesMol Cell 63:306–17Google Scholar
- 16Structural insights into the molecular mechanism of the m(6)A writer complexeLife 5Google Scholar
- 17N6-methyladenosine modificafion destabilizes developmental regulators in embryonic stem cellsNat Cell Biol 16:191–8Google Scholar
- 18Where, When, and How: Context-Dependent Funcfions of RNA Methylafion Writers, Readers, and ErasersMol Cell 74:640–650Google Scholar
- 19The Proteins of mRNA Modificafion: Writers, Readers, and ErasersAnnu Rev Biochem 92:145–173Google Scholar
- 20Stem cells. m6A mRNA methylafion facilitates resolufion of naive pluripotency toward differenfiafionScience 347:1002–6Google Scholar
- 21Meftl3-mediated m(6)A RNA methylafion regulates the fate of bone marrow mesenchymal stem cells and osteoporosisNat Commun 9:4772Google Scholar
- 22N(6)-methyladenosine RNA modificafion regulates embryonic neural stem cell self-renewal through histone modificafionsNat Neurosci 21:195–206Google Scholar
- 23The m(6)A Methyltransferase METTL3 Promotes Translafion in Human Cancer CellsMol Cell 62:335–45Google Scholar
- 24Promoter-bound METTL3 maintains myeloid leukaemia by m(6)A-dependent translafion controlNature 552:126–131Google Scholar
- 25mRNA circularizafion by METTL3-eIF3h enhances translafion and promotes oncogenesisNature 561:556–560Google Scholar
- 26Small-molecule inhibifion of METTL3 as a strategy against myeloid leukaemiaNature 593:597–601Google Scholar
- 27N(6)-Methyladenosine Regulates Host Responses to Viral InfecfionTrends Biochem Sci 46:366–377Google Scholar
- 28Targefing the m(6)A RNA modificafion pathway blocks SARS-CoV-2 and HCoV-OC43 replicafionGenes Dev 35:1005–1019Google Scholar
- 29METTL3 regulates viral m6A RNA modificafion and host cell innate immune responses during SARS-CoV-2 infecfionCell Rep 35:109091Google Scholar
- 30The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differenfiafion of normal hematopoiefic and leukemia cellsNat Med Google Scholar
- 31METTL3 Gains R/W Access to the EpitranscriptomeMol Cell 62:323–324Google Scholar
- 32COSMIC: exploring the world’s knowledge of somafic mutafions in human cancerNucleic Acids Res 43:D805–11Google Scholar
- 33m(6)A mRNA methylafion regulates AKT acfivity to promote the proliferafion and tumorigenicity of endometrial cancerNat Cell Biol 20:1074–1083Google Scholar
- 34m(6)A Facilitates eIF4F-Independent mRNA TranslafionMol Cell 68:504–514Google Scholar
- 35Cancer mutafions rewire the RNA methylafion specificity of METTL3-METTL14bioRxiv Google Scholar
- 36Structural insights into molecular mechanism for N(6)-adenosine methylafion by MT-A70 family methyltransferase METTL4Nat Commun 13:5636Google Scholar
- 37Structural basis of asymmetric DNA methylafion and ATP-triggered long-range diffusion by EcoP15INat Commun 6:7363Google Scholar
- 38Structural insights into FTO’s catalyfic mechanism for the demethylafion of mulfiple RNA substratesProc Natl Acad Sci U S A 116:2919–2924Google Scholar
- 39Reversible methylafion of m(6)A(m) in the 5’ cap controls mRNA stabilityNature 541:371–375Google Scholar
- 40Structural basis for selecfive binding of m6A RNA by the YTHDC1 YTH domainNat Chem Biol 10:927–9Google Scholar
- 41Targeted base stacking disrupfion by the EcoRI DNA methyltransferaseBiochemistry 35:14757–62Google Scholar
- 42Dynamics of RNA modificafion by a mulfi-site-specific tRNA methyltransferaseNucleic Acids Res 42:11697–706Google Scholar
- 43Validafion of ligands in macromolecular structures determined by X-ray crystallographyActa Crystallogr D Struct Biol 74:228–236Google Scholar
- 44The catalyfic mechanism of the RNA methyltransferase METTL3eLife 12Google Scholar
- 45PHENIX: a comprehensive Python-based system for macromolecular structure solufionActa Crystallogr D Biol Crystallogr 66:213–21Google Scholar
- 46Coot: model-building tools for molecular graphicsActa Crystallogr D Biol Crystallogr 60:2126–32Google Scholar
- 47BUSTER version 2.10.4Cambridge, United Kingdom: Global Phasing Ltd Google Scholar
- 48PlayMolecule ProteinPrepare: A Web Applicafion for Protein Preparafion for Molecular Dynamics SimulafionsJ Chem Inf Model 57:1511–1516Google Scholar
- 49ff14SB: Improving the Accuracy of Protein Side Chain and Backbone Parameters from ff99SBJ Chem Theory Comput 11:3696–713Google Scholar
- 50AmberToolsJ Chem Inf Model 63:6183–6191Google Scholar
- 51Automafic atom type and bond type percepfion in molecular mechanical calculafionsJ Mol Graph Model 25:247–60Google Scholar
- 52High-Strain-Rate Plasfic Flow Studied via Nonequilibrium Molecular DynamicsPhysical Review Lefters 48:1818–1820Google Scholar
- 53Staggered Mesh Ewald: An extension of the Smooth Parficle-Mesh Ewald method adding great versafilityJ Chem Theory Comput 5:2322Google Scholar
- 54LINCS: A linear constraint solver for molecular simulafionsJournal of Computafional Chemistry 18:1463–1472Google Scholar
- 55HTMD: High-Throughput Molecular Dynamics for Molecular DiscoveryJournal of Chemical Theory and Computafion 12:1845–1852Google Scholar
- 56Supervised Molecular Dynamics (SuMD) as a Helpful Tool To Depict GPCR–Ligand Recognifion Pathway in a Nanosecond Time ScaleJournal of Chemical Informafion and Modeling 54:372–376Google Scholar
- 57VMD: visual molecular dynamicsJ Mol Graph 14:33–8Google Scholar
Article and author information
Author information
Version history
- Preprint posted:
- Sent for peer review:
- Reviewed Preprint version 1:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.104909. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2025, Qi et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 1,969
- downloads
- 115
- citation
- 1
Views, downloads and citations are aggregated across all versions of this paper published by eLife.