Abstract
Parkinson’s disease (PD) is commonly associated with the loss of dopaminergic neurons in the substantia nigra, but many other cell types are affected even before neuron loss occurs. Recent studies have linked oligodendrocytes to early stages of PD, though their precise role is still unclear. Pink1 is mutated in familial PD and through unbiased single-cell sequencing of the entire brain of Drosophila Pink1 models, we observed significant gene deregulation in ensheathing glia (EG); cells that share functional similarities with oligodendrocytes. We found that the loss of Pink1 leads to the activation of EG, similar to the reactive response of EG seen upon nerve injury. Using cell-type specific transcriptomics, we identified deregulated genes in EG as potential functional modifiers. Specifically, downregulating two trafficking factors, Rab7 and Vps13, also mutated in PD, or the direct regulators of Rab7, Mon1 and Ccz1, specifically in EG was sufficient to rescue neuronal function and protect against dopaminergic synapse loss. Our findings demonstrate that Pink1 loss in neurons triggers an injury response in EG, and that Pink1 loss in EG in turn disrupts neuronal function. Vesicle trafficking components, which regulate membrane interactions between organelles within EG, play a crucial role in maintaining neuronal health and preventing dopaminergic synapse loss. Our work highlights the essential role of glial support cells in the pathogenesis of PD and identifies vesicle trafficking within these cells as a key point of convergence in disease progression.
Introduction
Parkinson’s disease (PD) is characterized by motor symptoms such as bradykinesia, rigidity and tremor that are caused by the progressive loss of dopaminergic neurons in the substantia nigra (Lang & Lozano, 1998). However, most of the patients report non-motor symptoms such as constipation, hyposmia and sleep defects even before the onset of motor symptoms (Munhoz et al., 2015). This suggests that PD is a progressive neurodegenerative disease that initiates many years before the diagnosis and involves different neuronal systems, multiple anatomical areas and different cell types. While therapies symptomatically improve motor functioning temporarily by restoring dopaminergic tone, they do not effectively prevent neurodegeneration and disease progression. This highlights the necessity to identify cell-types and biological mechanisms that act at the earliest stages of disease.
With the advent of single-cell sequencing applied to PD and control brains in combination with evidence from genome-wide association studies (GWAS), it is now possible to suggest which cells and mechanisms are at play at early stages of PD. Among these, a recent study reported that genes related to GWAS loci are highly enriched for oligodendrocyte-specific gene expression (Bryois et al., 2020). Interestingly, differential gene expression in post-mortem brains with Braak scores of 1-2, 3-4, and 5-6 and controls, suggested a role for oligodendrocytes at an early stage of PD prior to the overt loss of dopaminergic neurons(Bryois et al., 2020). Additionally, two independent single-cell sequencing studies, one of the human substantia nigra and one of the midbrain, both associated PD genetic risk with oligodendrocyte-specific expression patterns (Agarwal et al., 2020; Smajic et al., 2022). While these studies started to link dysfunction of oligodendrocyte-cells to the early stages of PD, they did not address their role in the pathophysiology of the disease.
Here we describe a new Drosophila model to assess how this neuron-glia cross-talk contributes to PD. Drosophila has been successfully used to investigate cellular and molecular dysfunction preceding the onset of age-related symptoms, including dopaminergic neuron-dependent motor symptoms (Kaempf et al., 2024; Pech et al., 2024; Valadas et al., 2018). Drosophila glial cells also display several anatomical and functional features that show remarkable similarity to their mammalian counterparts (Freeman & Doherty, 2006; Kremer et al., 2017). While the small size of the Drosophila brain does not necessitate elaborate myelination, ensheathing glia (EG) in this species share not only anatomical features with oligodendrocytes, such as the ability to wrap around nerve tracts in the CNS (Kremer et al., 2017; Yildirim et al., 2019), but also important molecular and functional features, such as providing metabolic support and regulating neuronal activity (Delgado et al., 2018; Otto et al., 2018).
In a brain-wide single-cell sequencing experiment, we identified EG as the most deregulated cell type in young (pre-motor) Pink1 loss-of-function Drosophila model. Using cell-specific labeling, immunohistochemistry and electrophysiological recordings, we correlated the transcriptional deregulation in EG with an “active cell state” also seen upon nerve injury, and showed that healthy EG are fundamental to support dopaminergic synapse integrity in Pink1 mutants. Finally, using cell-type-specific transcriptomic and a high-throughput screening and immunohistochemistry, we identified Rab7 and Vps13 as EG-expressed modifiers that maintain dopaminergic synapse-integrity. Our study shows that neuron-ensheating glia crosstalk is disrupted already at young age by the loss of Pink1 in neurons but also in EG and that EG are fundamental to support dopaminergic synapse-integrity, suggesting a role for oligodendrocytes in the progression of PD.
Results
Ensheating glia in Pink1 loss of function flies are activated non-cell autonomously
We previously created a whole-brain single-cell RNAseq dataset from different Drosophila PD knock-in models. This dataset was generated from young 5-day-old flies to capture ‘early’ changes (Pech et al, 2024). We re-analyzed the data from Pink1P399L knock-in loss-of-function mutant flies and isogenetic controls, and performed differential gene expression (DEG) analysis for each cell type using DESeq2 (Figure 1A). Glial cell subtypes show the highest degree of deregulation; particularly ensheathing glia are strongly affected (Figure 1A). While flies do not myelinate neurons, ensheating glia (EG) serve similar supporting functions to oligodendrocytes (Otto et al., 2018; Yildirim et al., 2019). These results suggest that ensheating glia are deregulated in young Pink1P399Lmutants (and also Pink1KO, see below) at an age prior to dopaminergic neuron-dependent motor defects (Kaempf et al., 2024; Pech et al., 2024).

(A) tSNE of the cells of Pink1P399L knock-in mutants (5 days old). Cell types are labeled with colors indicating the number of deregulated genes compared to control. EG are encircled and labeled. (B-B”) (B) SUM intensity of confocal images of fly brains (5 ± 1 days old) stained with anti-GFP (Green) and anti-Brp (Magenta), where anti-GFP marks EG and anti-Brp marks presynaptic sites of the antennal lobes. Scale bar: 20 µm (B’) SUM intensity of confocal images of control flies vs control flies 24 hours after ORNs severing. (B”) SUM intensity of confocal images of Pink1KO-WS vs Pink1KO-WS flies 24 hours after ORNs severing. (C) Quantification of GFP intensity with the glomeruli of the antennal lobe area in 5 ± 1 days old flies (as in B) relative to the control. ANOVA with Dunnet’s multiple comparison test, * is p<0.05, ** is p<0.01, *** is p<0.001. Bars: mean ± SD; points are individual animals N≥13 per genotype. (D-D”) SUM intensity of confocal images of fly brains (5 ± 1 days old) stained with anti-GFP (Green) and anti-Brp (Magenta), where anti-GFP marks EG and anti-Brp marks presynaptic sites of the antennal lobes. Scale bar: 20 µm. (D’) SUM intensity of confocal images of w1118 with Pink1 downregulation in EG. (D”) SUM intensity of confocal images of Pink1KO-WSwith Pink1 rescued in EG. (E) Quantification of GFP intensity within the glomeruli of the antennal lobe area in 5 days old flies (as in D) relative to the control. ANOVA with Tukey’s multiple comparison test, * is p<0.05, ** is p<0.01, *** is p<0.001. Bars: mean ± SD; points are individual animals N≥10 per genotype.
When neurons are damaged, activated EG invade the neuropil (Doherty et al., 2009; MacDonald et al., 2006). For example, when fly antennal lobes are removed, severing the olfactory Olfactory Receptor Neurons (ORNs), EG invade the antennal lobe neuropil (MacDonald et al., 2006), potentially as a protective response (Figure 1B’-C). We tested if EG invade the neuropil in Pink1 mutant flies and expressed a transmembrane fluorescent protein (UAS-CD8GFP) under the control of a promoter specific to EG (MZ709-Gal4) in control and Pink1KOflies. Samples were labeled with anti-GFP and the pre-synaptic protein Bruchpilot (NC82). Similar to ORN-severed controls, EG invade the antennal neuropil in Pink1KO, and severing the ORN in Pink1KO does not further exacerbate this phenotype (Figure 1B”-C). These data suggest that Pink1 loss triggers EG activation, similar to neuron-severing, to invade the ORN neuropil.
In order to determine whether this activation is cell-autonomous, we generated cell-type specific Pink1 perturbations. We either downregulated Pink1 using a previously well-validated RNAi line specifically in EG (EG-specific Pink1 loss-of-function – Figure 1D’), or we re-expressed wild-type Pink1 specifically in EG in Pink1KOflies (all cells, but the EG, loss-of-function - Figure 1D”). When Pink1 is knocked-down in EG (but present in other cells, including neurons), EG do not invade the neuropil (Figure 1D’-1E). However, when Pink1 is not present in neurons and expressed in EG, the EG do invade the antennal neuropil (Figure 1D”-E). This suggests that Pink1-defective neurons activate the EG in a cell-non autonomous fashion to invade, and potentially protect, the neuropil.
Ensheathing glia function supports synaptic integrity
Our finding that Pink1KO in neurons elicits an EG activation response, suggested that EG might in turn also functionally modulate neuronal integrity in mutant flies. To test this we made use of a readily accessible model circuit in the fly visual system with an easy electrophysiological read-out, Electroretinograms (ERG). The ERG waveforms are susceptible to changes in intracellular signaling, neuronal function and synaptic transmission and have been well characterized, and amply used to assess neuronal and cellular function(Hardie & Raghu, 2001; Praschberger et al., 2023; Soukup et al., 2016; C. F. Wu & Wong, 1977). We exploited this method to understand the role of Pink1 in EG on neuronal function and synaptic transmission in young flies.
Comparing control with young Pink1KO flies does not show a difference in the “depolarization-response”, indicating that -as expected-there is no neurodegeneration occurring in the photoreceptors at this stage (Figure 2A). However, when comparing the ON peak – which represents synaptic transmission from the photoreceptors and within the underlying neuronal circuit – we detect a significant reduction in the mutant flies compared to the control, suggesting that in Pink1KO flies synaptic communication in this circuit is partially impaired, already at 5 days old (Figure 2A-B).

(A) Representative ERG traces: ON peak is highlighted by the arrow. (B) Normalized ON peak response of flies (5 ± 1 days old). ANOVA with Tukey’s multiple comparison test, * is p<0.05, ** is p<0.01, *** is p<0.001. Bars: mean ± SD; points are individual animals N≥11 per genotype. (C-C”) (C) Maximum projection confocal image of control and Pink1KO-WS in Mushroom Bodies (MB) of aged flies (22 ± 2 days old), stained with anti-TH (cyan) and anti-DLG (magenta) antibodies, DLG is used to mark post-synaptic site of MB. The black and white image is the middle Z-plan within the region of interest of the MB(ROI, yellow), it is used to represent the thresholded TH area (white). Scale bar: 20 µm. (C’) Maximum projection confocal image of w1118 with Pink1 downregulation in EG. (C”) Maximum projection confocal image of Pink1KO-WS with Pink1 rescued in EG. (D) Quantification of dopaminergic synaptic area within MB in aged flies (22 ± 2 days old). ANOVA with Tukey’s multiple comparison test, * is p<0.05, ** is p<0.01, *** is p<0.001. Bars: mean ± SD; points are individual animals N≥12 per genotype.
In order to discern the role of EG in this defective ERG response, we (1) downregulated Pink1 specifically in EG and (2) we expressed Pink1 specifically in EG of Pink1KO. When Pink1 is knocked down specifically in EG, we observe the same reduction in ON peak response as in the Pink1KO flies. This indicates that EG integrity is necessary for efficient neurotransmission in this circuit. Conversely, the ON peak defect of Pink1KO mutants is rescued when Pink1 is reintroduced in EG only. This suggests that activated EG are able to at least partially buffer the detrimental effects of Pink1 deficiency in neurons (Figure 2A-B).
To also test EG function in relation to PD-relevant dopaminergic (DA) synapses we evaluated the loss of dopaminergic neuron afferents. We previously showed that the loss of Pink1 function causes a progressive loss of protocerebral anterior medial dopaminergic neuron (PAM DAN) afferents in the Mushroom Body neuropil (Kaempf et al., 2024) and confirm here that 5 days old Pink1KO flies do not show a decrease in the dopaminergic synaptic area in the mushroom bodies (MB) lobes, while aged, 25 days old animals, do (Figure 2 C-D). Hence, while ensheathing glia are already activated at young age in Pink1KO, DA synapses are structurally still intact and only deteriorate in older flies. We then knocked down Pink1 specifically in EG and find a similar strong decrease in DA synaptic area (Figure 2C’-D). Conversely, when Pink1 is reintroduced specifically in EG of Pink1KO animals, DA synapse-loss is significantly rescued (Figure 2C”-D). Together, these results indicate that Pink1 in EG is necessary to protect dopaminergic neurons from synapse loss.
EG cell type-specific transcriptomics reveals modifiers of neuronal dysfunction
To identify pathways in EG that are deregulated by Pink1KO loss-of-function, we optimized a method to isolate EGs specifically from the rest of the brain, enabling us to perform much higher-sensitivity transcriptomics than what we achieved with our 10x droplet-based single-cell sequencing (Pech et al., 2024). We expressed a fluorescently-tagged histone (UAS-HisTag-eGFP) in EG (GMR-56-gal4) and used Fluorescence-activated Cell Sorting (FACS) to isolate EG. We sorted 300 cells per technical replicate, and performed Bulk-RNA sequencing using a SMART-seq2 protocol (Figure 3A). The sequencing results of EG-sorted cells and of neuron-sorted cells (nsyb-Gal4 instead of GMR-56-gal4) show strong enrichment of EG cell markers in the former and strong enrichment of neuronal markers in the latter (Figure 3B). We then compared the transcriptomic profile of EG in Pink1KO to control using differential expression analysis and find 617 deregulated genes in EG (Appendix 1, padj<0.05). To understand whether the deregulated genes were enriched for a specific pathway or associated with a cellular component compared to non-significantly deregulated genes, we performed GO analysis of the deregulated genes in Pink1KOflies. Our analysis resulted in generic terms and very diverse pathways that did not allow us to draw further conclusions.

(A) Scheme of cell-type specific transcriptomics. Panel created using BioRender.com/p56u250. (B) Scaled gene expression of representative genes for EG and neurons after sorting EG or neurons using the protocol described in figure A. Figure generated using R studio (R Core Team, 2022). (C) Differentially expressed genes in EG in Pink1KO-WScompared to control flies, plotted according to their Log2 Fold change and the -Log10 of the adjusted p-value. Intercept in RED (-Log10 adjusted p-value = 4.31). *Two data points are outside the boundaries of the plot. (D) ERG ON peak value differences to Pink1KO-WS (red) flies (5 ± 1 days old) of Pink1KO-WS flies (5 ± 1 days old) with DEGs downregulated, or upregulated, specifically in EG. ON peak value are expressed as the difference to Pink1KO-WS. ANOVA with Dunnett’s test, * is p<0.05, ** is p<0.01, *** is p<0.001. Bars: mean ± SD; points are individual animals N≥3 per genotype. *One data point is outside the boundaries of the plot.
To test if the genes deregulated in EG are modifiers of the neuronal pink1KO phenotypes, we downregulated and upregulated (when possible) the 50 most deregulated genes, for which we could find RNAi fly lines, specifically in the EG of Pink1KO and recorded ERGs in 5 days old flies. Several of the genes show a rescue of the ON transient defects in Pink1KO (4 were significant suppressors at p<0.05) and few exacerbate the defect (Figure 3D). Among the 4 significant suppressors of the Pink1KOphenotypes, 3 (Ccz1, CG10646, CG17660) are associated with endosomal membranes - or their human ortholog is - (Figure 3C-D) (Borchers et al., 2023; Epp et al., 2011; Gaudet et al., 2011; Gershlick et al., 2016). Hence, several DEG in EG of Pink1KO are modifiers of the Pink1 ERG mutant phenotype, and most of those are associated with the endosome.
Rab7 and Vps13 downregulation in EG rescue synaptic dopaminergic neurons afferent loss
Among the genes associated with the endosome that we identified in our ERG screening, the strongest suppressors, Ccz1, is associated with late endosome function. In particular, Ccz1 forms together with Mon1 a guanosine-nucleotide-exchange factor (GEF) that recruits Rab7 to the endosome (Borchers et al., 2023; Epp et al., 2011). Interestingly, Rab7 is known to physically interact with a peripheral membrane protein that is also causative of PD, Vps13 (Vonk et al., 2017). We therefore also tested if Rab7, Mon1, and Vps13 are also Pink1-modifiers and find that the knockdown of each of these genes also rescues the ON transient defect of Pink1KO mutants (Figure 4A’-B).

(A-A’) (A) Representative ERG traces. (A’) Representative ERG traces of genes Pink1KO-WS flies with Vps13, mon1, and rab7 downregulated in EG (B) Normalized ON peak response of flies (5 ± 1 days old). Kruskal-Wallis with Dunn’s multiple comparison test, * is p<0.05, ** is p<0.01, *** is p<0.001. Bars: mean ± SD; points are individual animals N≥8 per genotype. (C) Maximum projection confocal image of control and Pink1KO-WS in Mushroom Bodies (MB) of aged flies (22 ± 2 days old), stained with anti-TH (cyan) and anti-DLG (magenta) antibodies, DLG is used to mark post-synaptic site of MB. The black and white image is the middle Z-plan within the region of interest of the MB(ROI, yellow), it is used to represent the thresholded TH area (white). Scale bar: 20 µm. (D) Quantification of dopaminergic synaptic area within MB in aged flies (22 ± 2 days old). ANOVA with Dunnett’s multiple comparison test, * is p<0.05, ** is p<0.01, *** is p<0.001. Bars: mean ± SD; points are individual animals N≥13 per genotype.
To determine if manipulation of vesicle trafficking specifically in EG can rescue PAM DAN synaptic innervation in old (20-25 day old) Pink1KO mutants, we expressed RNAi to Ccz1, Vps13, Rab7 or Mon1 using mz709-Gal4. Anti-TH labeling (marking DAN synapses) in the Mushroom Body area (marked by anti-DLG) is significantly reduced in Pink1KO, but rescued to control levels when any of the four genes are knocked down (Figure 4D). These results indicate that Rab7-mediated membrane trafficking in EG regulate glia-neuron crosstalk to maintain synaptic integrity of dopaminergic neuron synapses in the fly brain of Pink1 mutants.
Discussion
In this work, we show there is early, non-cell-autonomous activation of EG in a PD-relevant Drosophila Pink1 model. This occurs already in young Pink1-mutant flies when neuronal defects in dopaminergic neurons are not yet measurable. The EG activation and invasion phenotype appears as a protective response, as Pink1-deficient neurons seem to drive EG activation in a manner that mimics the response to nerve injury (Doherty et al., 2009; MacDonald et al., 2006). In addition to EG activation, we show there is also a non-autonomous role of EG to support Pink1-deficient neurons. When we manipulate the expression of membrane-lipid trafficking genes, including the homolog of the established PD gene VPS13C (Lesage et al., 2016), specifically in EG, we rescue the dysfunction of Pink1 mutant neurons. Our work shows the importance of neuron-glia cross-talk in the context of Pink1-deficiency. We find (1) there is early EG activation secondary to Pink1-loss-induced neuronal impairments; (2) there are specific lipid- and membrane trafficking problems caused by Pink1 loss in EG that center on Rab7-signaling and (3) there is a convergence of Parkinson-relevant genetic factors that act in EG to maintain neuronal function.
The loss of Pink1 function in the context of Parkinson’s disease has been amply linked to the regulation of mitochondrial health. Pink1 maintains the integrity of the electron transport chain by phosphorylating NDUFA10 (Morais et al., 2009, 2014; Pogson et al., 2014) and when mitochondria are damaged, it phosphorylates Parkin and Ubiquitin to facilitate mitophagy (Kane et al., 2014; Narendra et al., 2010; Narendra & Youle, 2024). The regulation of mitophagy is complex and requires mitochondrial rearrangements controlled by mitochondria-organelle contacts (ER and lysosomes) (Wong et al., 2018, 2019; Yamano et al., 2018). Such contacts mediate inter-organellar lipid exchange as well as facilitate organellar fusion (Kumar et al., 2018; Valadas et al., 2018). In Pink1 mutants these contacts are increased in number and this causes cellular defects (Grossmann et al., 2023; Valadas et al., 2018).
We found that in EG, Rab7 and genes encoding proteins that regulate the Rab7 GTPase, functionally interact with Pink1-induced neuronal dysfunction: their genetic manipulation in EG rescues cell non-autonomous neuronal dysfunction. Loss of Rab7 itself, or loss of Mon1 and Ccz1, only in EG are sufficient to rescue neuronal Pink1 phenotypes. Mon1 and Ccz1 form a guanine exchange factor (GEF) that specifically loads Rab7 with GTP, thereby activating the protein (Borchers et al., 2023). This is interesting because Rab7-GTP promotes the formation of mitochondria-organelle contacts (mitochondria-lysosome contacts) (Wong et al., 2018). This is also further supported by previous observations showing that overexpression of Fis1 rescues Pink1 mutant phenotypes: Fis1 localizes to mitochondria to recruit TBC1D15 (Wong et al., 2018), a Rab7 GTPase Activating Protein that hydrolyzes GTP bound to Rab7, thereby inactivating the protein and promoting untethering of lysosome-mitochondrial contacts (Wong et al., 2018). Hence, conditions that inhibit Rab7-GTP-mediated mitochondria-organelle contacts (eg by inhibiting Rab7-GEF or activating Rab7-GAP) in EG rescue Pink1 neuronal dysfunction, possibly by negatively regulating the stability of organelle contacts in Pink1 mutants.
Our observation that downregulation of Vps13 in EG also rescues Pink1 is in further support of a role for organelle membrane contact site regulation. Vps13 physically interacts with Rab7 (Vonk et al., 2017) and it has two mammalian homologs, VPS13A and VPS13C (Vonk et al., 2017; Vrijsen et al., 2022), that is also mutated in familial PD (Lesage et al., 2016). VPS13A tethers ER to mitochondria and lipid droplets and VPS13C tethers ER to late endosomes, lysosomes and lipid droplets (Kumar et al., 2018; Muñoz-Braceras et al., 2019; Vrijsen et al., 2022). The function of these proteins is to facilitate lipid transfer between organelles, a function we previously showed to be increased in Pink1 mutants (Valadas et al., 2018). Hence, the downregulation of Vps13, similar to Rab7 or its regulators, would counteract the effects of excessive organelle membrane contact formation and dysregulated lipid homeostasis in Pink1 mutants.
Lipid homeostasis in glial cells is crucial for supporting neuronal function by providing energy, protecting against oxidative stress, and regulating synaptic health. In oligodendrocytes, maintaining myelin sheaths is critical (Ettle et al., 2016; Lappe-Siefke et al., 2003). While fly EG do not generate such structures, they do wrap processes around neuropil regions, also requiring lipid membrane production (Kremer et al., 2017; Pogodalla et al., 2021). Through lipid metabolism, glia also supply neurons with essential metabolites, cholesterol, and signaling molecules that aid in membrane integrity, synaptic remodeling, and neuroprotection (Delgado et al., 2018; Otto et al., 2018; Saab et al., 2016; Suárez-Pozos et al., 2020). Further work is now required to define which functions supported by organelle contact sites in glial cells drive cell-nonautonomous protective mechanisms in neurons. Our work in flies indicates these glial defects precede dopaminergic synapse loss, and, importantly, that rescuing the glial defects rescues the dopaminergic problems later in life, underscoring the significance for therapeutic development.
Methods
Resource availability
Lead Contact
Further information and requests for resources and reagents should be directed to the lead contact, Patrik Verstreken (patrik.verstreken@kuleuven.be).
Materials Availability
Data, code, Drosophila models, and reagents are available upon request.
Fly stocks
The fruit flies were maintained in an incubator at 25°C under a 12:12 light-dark cycle, and provided with a standard diet consisting of cornmeal and molasses. For experiments, only fly males were used. Flies were raised in parallel on the same batch of food, which was exchanged every three to four days and kept in only male population of similar density. Flies were aged to 5 ± 1 days old, and 22 ± 2 days old as indicated for immunohistochemistry and ERGs respectively.
To create a set of Drosophila models for Parkinson’s disease, CRISPR/Cas9-based gene editing was utilized, as outlined in (Kaempf et al., 2024; Pech et al., 2024). In brief, each knockout line contained an attP-flanked w+ reporter cassette that replaced the first shared exon across different isoforms of the targeted gene. For this study, we used knockout flies for Pink1 from this collection (Kaempf et al., 2024). The “control” strain denotes a semi-isogenized w1118 strain that underwent backcrossing to Canton-S for 10 successive generations, resulting in a strain termed Canton-S-w1118. To generate the fly line Yw; ; UAS-His2Av::eGFP.VK27/TM3Sb, we created the pUASTattB_His2AV-GFP plasmid, linearizing the pUAST.attB (Bischof et al., 2007) with EcoRI-BamHI. A gBlock, containing the His2AV, GS linker and eGFP sequence, was cloned into this linearized plasmid with Gibson Assembly. The plasmid was inserted into the VK27 landing site by BestGene. The sequence His2AV-GS-eGFP gblock is:TGAATAGGGAATTGGGcAAacATGGCTGGCGGTAAAGCAGGCAAGGATTCGGGCAAGGCCAAGGCGAAGG CGGTATCGCGTTCCGCGCGCGCGGGTCTTCAGTTCCCCGTGGGTCGCATCCATCGTCATCTCAAGAGCCGCACT ACGTCACATGGACGCGTCGGAGCCACTGCAGCCGTGTACTCCGCTGCCATATTGGAATACCTGACCGCCGAGG TCCTGGAGTTGGCAGGCAACGCATCGAAGGACTTGAAAGTGAAACGTATCACTCCTCGCCACTTACAGCTCGC CATTCGCGGAGACGAGGAGCTGGACAGCCTGATCAAGGCAACCATCGCTGGTGGCGGTGTCATTCCGCACAT ACACAAGTCGCTGATCGGCAAAAAGGAGGAAACGGTGCAGGAcCCGCAGCGGAAGGGCAACGTCATTCTGTC GCAGGCCTACGGTTCAGGCGGAGGTGGCAGCGGCGGTGGCGGATCCATGGTGAGCAAGGGCGAGGAGCTG TTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGC GAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTG CCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCA GCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGC AACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATC GACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCA TGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGC AGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCT GAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACC GCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAATAAGGGTACCTCTAGAGGATCTT.
Flies were backcrossed for five generations into an inbred Canton-S strain harboring the w1118 mutations. The following genotypes were used in this study:




Olfactory Receptor Neurons (ORNs) axotomy
ORN bilateral axotomy was performed on 4 ± 1 days old flies by surgical ablation of the third antennal segments. Briefly, flies were anesthetized with CO2 and then both antennae were removed with Dumont #5 forceps, and returned to the vial (M. Purice, 2020; M. D. Purice et al., 2017). Flies recovered 24 hours on food at 25°C before dissection.
Immunohistochemistry and confocal imaging – invasion phenotype
Immunohistochemistry was performed on adult flies brains of 5 ± 1 days, with at least two independent experiments. The flies The brains were dissected in ice-cold PBS and fixed for 20 minutes in freshly prepared 3.7% paraformaldehyde (in 1x PBS, 0.3% Triton X-100 [PBX] [Sigma Aldrich]) at room temperature (RT), followed by three 15-minute washes in PBX at RT on a shaker. Then, the brains were incubated for 1 hour in blocking solution (PBX, 10% normal goat serum [NGS]) at RT. Following blocking, the brains were incubated with primary antibodies (rabbit anti-GFP [Thermo Fisher Scientific], 1:1000, mouse anti-brp [DSHB, nc82], 1:100) in blocking solution at 4°C overnight, followed by three 15-minute washes in PBX at RT. Secondary antibodies (goat anti-rabbit Alexa488, goat anti-mouse Alexa555, both at 1:1000 [Thermo Fisher Scientific]) in PBX with 10% NGS were applied overnight at 4°C. Afterward, the brains were washed three times for 15 minutes in PBT at RT on a shaker and mounted with the anterior facing up in RapiClear 1.47 (SUNJin Lab). Imaging was performed using a Nikon A1R confocal microscope with a 40x (NA 1.15) water immersion lens, Z-stacks of the entire antennal lobes were acquired. The acquisition was carried out using a Galvano scanner, with a zoom factor of 1, scan speed of 0.5, and line averaging set to 2. All images were captured with a pinhole of 0.9 Airy units and a resolution of 1024 × 1024. Z-stacks (with 0,5 μm step intervals) were obtained for data acquisition, and the same imaging settings were applied across all genotypes and sessions. Image analysis was performed using Fiji (Schindelin et al., 2009). Image analysis was performed using Fiji (Schindelin et al., 2009). Each antennal lobe is composed of multiple glomeruli, and EG separate them and invade them when active (Doherty et al., 2009; Pogodalla et al., 2021). To quantify EG invasion in the antennal lobe, we calculated the invasion in each single glomeruli. To do so and be consistent with the section of the antennal lobe analyzed, anti-brp was used to identify the 3 Z-planes where DM6 and DM1 glomeruli were present (B. Wu et al., 2017). Then to automatically detect and segment each glomeruli of the antennal lobe section, regions of interest (ROIs) were defined in the SUM projection of the 3 Z-planes by using the Fiji plugin Stardist, which is developed to segment round objects (Weigert et al., 2019). To quantify the EG invasion in the ROIs, anti-GFP SUM projection of the same 3 Z-planes was used. The GFP intensity was detected in each ROI, and it was normalized to the area of each ROI (GFP intensity/glomeruli area) to calculate the EG invasion in each glomeruli. Then, the normalized GFP intensity of each glomeruli of an antennal lobe were summed and normalized for the number of glomeruli detected in the antennal lobe. For each experiment, the EG antennal lobe invasion of each fly was normalized to the mean of the control. Representative images show the SUM projections of the 3 Z-planes.
Immunohistochemistry and confocal imaging – TH staining
Immunohistochemistry was performed on adult fly brains of 22 ± 2 days, with at least two independent experiments. The brains were dissected in ice-cold PBS and fixed for 20 minutes in freshly prepared 3.7% paraformaldehyde (in 1x PBS, 0.2% Triton X-100 [PBX]) at room temperature (RT), followed by three 15-minute washes in PBX at RT on a shaker. Then, the brains were incubated for 1 hour in blocking solution (PBX, 10% normal goat serum [NGS]) at RT. Following blocking, the brains were incubated with primary antibodies (rabbit anti-TH [Sigma], 1:200, mouse anti-DLG [DSHB], 1:100) in blocking solution at 4°C for 1.5 to 2 days, followed by three 15-minute washes in PBX at RT. Secondary antibodies (goat anti-rabbit Alexa488, goat anti-mouse Alexa555, both at 1:500 [Thermo Fisher Scientific]) in PBX with 10% NGS were applied overnight at 4°C. Afterward, the brains were washed three times for 15 minutes in PBT at RT on a shaker and mounted with the anterior facing up in RapiClear 1.47 (SUNJin Lab). Imaging was performed using a Nikon A1R confocal microscope with a 20x (NA0.95) water immersion lens, Z-stacks of the entire brain were acquired. The acquisition was carried out using a Galvano scanner, with a zoom factor of 1, scan speed of 0.5, and line averaging set to 2. All images were captured with a pinhole of 2.3 Airy units and a resolution of 1024 × 1024. Z-stacks (with 3 μm step intervals) were obtained for data acquisition, and the same imaging settings were applied across all genotypes and sessions. Image analysis was performed using Fiji (Schindelin et al., 2009). To quantify dopaminergic neuron innervation of the mushroom body (MB), anti-DLG was used to identify the five z-planes containing the synaptic region of the MB lobes. The region of interest (ROI) for the MB was defined in the sum projection of the five z-planes. To exclude background signal comparable to control, the area of anti-TH fluorescence was thresholded (using the default threshold for all z-planes) within the selected z-stacks. Quantification of the thresholded area within the ROI was performed in each z-plane, then summed and normalized to the MB ROI area for each brain individually (TH+ area/MB area). For each experiment, the individual TH+ area/MB area values were normalized to the mean of the control. Representative images show the maximum projection of five z-planes and the thresholded middle z-plane.
Electroretinograms (EGR)
ERGs were recorded from flies 5 ± 1 day old as previously described (Heisenberg, 1971; Slabbaert et al., 2016). Flies were immobilized on glass microscope slides using double-sided tape. For recordings, glass electrodes (borosilicate, 1.5 mm outer diameter) filled with 3 M NaCl were placed in the thorax as a reference and on the fly eye for recordings. Each fly was exposed to 5 cycles of 3 seconds of darkness, followed by a 1-second of light stimuli with LED illumination. Response to the stimuli was recorded using Axoscope 10.7 and analyzed using Clampfit 10.7 software (Molecular Devices). ERG traces were analyzed with Igor Pro 6.37 (Wave Metrics) using a custom-made macro.
Single-cell dissociation for cell-type specific transcriptomics
To test that EG could be isolated from the rest of the brain we used two cohorts GMR56F03> UAS-His2Av::eGFP.VK27 and nSyb-Gal4> UAS-His2Av::eGFP.VK27. To identify differentially expressed genes in EG two cohorts were used the control w1118 expressing GMR56F03> UAS-His2Av::eGFP.VK27 and Pink1KO-WS expressing GMR56F03> UAS-His2Av::eGFP.VK27. For each genotype, ten brains of flies 5 ± 1 days old were collected, with most of the laminae removed, from each experimental repeat. The dissections were performed in ice-cold PBS that contained 5 μM Actinomycin D (Sigma) to inhibit changes in gene expression during tissue processing(Y. E. Wu et al., 2017). To prevent any bias caused by different experimental batches, all the genotypes were processed in parallel. To minimize variability across batches, the same reagents and procedures were used throughout the experiment. Dissections were completed within one hour. The dissection order and the assignment of genotypes to dissectors were alternated to reduce any experimenter-related variation.
For the dissociation of brain tissue, a mix of Dispase I (0.6 mg/ml) (Sigma), Collagenase I (30 mg/ml) (Thermo Fisher), Trypsin (0.5x) (Thermo Fisher), and 5 μM Actinomycin D was used. The brains were incubated for 20 minutes at 25°C with 1000 rpm shaking, performing four triturations at 5-minute intervals. After dissociation, the cell suspension was washed with PBS containing 5 μM Actinomycin D and then filtered through a 10 μm strainer (Pluriselect), using 300 μl of PBS EDTA (Sigma) 1μM. DAPI (Invitrogen) (1:300.000) was added after filtration.
Fluorescence Activated Cell Sorting (FACS) for cell-type specific transcriptomics
Immediately after the dissociation, cells were sorted using a FACSAria Fusion (BD Biosciences) flow cytometer equipped with 4 lasers (405nm, 488nm, 561nm and 640nm) and a 100 µm nozzle at 20 psi. Live (DAPI-negative), GFP-positive cells were sorted into 96-well PCR plates at 300 cells per well (3 wells per genotype) using a 4-way purity mask with the FACSDiva software v9.0.1 (BD Biosciences).
Bulk transcriptomics of EG cells
Library preparations and sequencing for the Bulk RNA seq of the EG cells was performed using a modified Smart-seq2 protocol based on a previously published protocol (Picelli et al., 2013). Briefly, as per the protocol, 3 ul of cell lysis buffer (0.1% Triton X-100, Sigma Aldrich; 1U/ul of RNase Inhibitor, RNase OUT, Thermo Fisher; 2.5 uM Oligo dT(25), IDT; and 2.5 mM dNTP, Promega) was aliquoted in triplicate to 96 well plates (4titude, Cat. No. 4TI-0960/C). Roughly 300 cells were sorted into the wells with lysis buffer and the plate was spun down at 2000xg for 1 min prior to storage at - 80*C. For the first strand synthesis, the Smart-Seq 2 plates were thawed to room temperature for a minute and subsequently spun down at 2000 xg for minute. The RNA denaturation is carried out at 72*C for 10 mins and then flash cooled on ice for 5 mins. First strand synthesis mix (1X SuperScript II first strand synthesis buffer, Thermo Fisher; 5 mM DTT, Thermo Fisher; 100 U SuperScript II reverse transcriptase enzyme, Thermo Fisher; 10 U RNAse OUT, Thermo Fisher; 1M Betaine, Sigma Aldrich; 6 mM MgCl2, Thermo Fisher; and 1 uM TSO, IDT Technologies) is added to the cell lysis mix to a total volume of 10 ul. The First strand synthesis reaction was carried out with following program: 42*C for 90 mins; 10 cycles of {50*C for 2 mins; 42*C for 2 mins}; 72*C for 15 mins; 4*C indefinite hold. PCR amplification of the first strand product was performed by adding 15 ul of the PCR mix to the first strand product (1X KAPA HiFi HotStart Ready Mix, Roche; and 0.1 uM of IS PCR primer, IDT Technologies). 22 cycles of the following PCR program was used to amplify the first strand product: 98*C for 3 mins; 22 cycles of {98*C for 20 secs; 67*C for 15 secs; 72*C for 6 mins}; 72*C for 5 mins; 4*C indefinite hold. 20 ul of Ampure XP was added to each well and mixed. Standard Ampure XP purification was carried out as per manufacturer’s recommendation and the cDNA library was eluted in 17.5 ul of Elution buffer. 17 ul of the eluted library was transfered to fresh 96 well plate (4titude, Cat. No. 4TI-0960/C). 5 ul of Tn5 tagmentation mix (1X Tagment DNA buffer, Illumina; ATM mix, Illumina and cDNA library 1 ng) was prepared for cDNA fragmentation. Tn5 tagmentation was performed with following program: 55*C for 10 mins; 4*C indefinite hold. Tagementation reaction was stopped by quenching the reaction with 1.25ul of NT buffer for 5 mins (Illumina). 1.25 ul of the i5 and i7 Illumina indexes were added to the plates. Finally 3.75 ul of NPM master mix was added to the plate and mixed well and put for the index PCR amplification: 72*C for 3 mins; 95*C for 30 secs; 12 cycles of {95*C for 10 secs; 55*C for 30 secs; 72*C for 30 secs}; 72*C for 5 mins, and 4*C indefinite hold.
The indexed PCR products were pooled in a single tube and 0.8X Ampure XP purification (Beckman Coulter) was carried out as per manufacturer’s recommendation and finally the sequencing library was eluted in 35.5 ul of Elution buffer (Qiagen).
SMART seq 2 libraries were sequenced on the NextSeq 500 (Illumina) sequencing platform. Sequencing was done as per the protocol recommendations: paired end read of 76 bps (read 1), 76 bps (read 2), 8 bps (index 1) and 8 bps (index 2). For a targeted sequencing depth of ∼30 million reads per sample.
Analysis of RNAseq data - Neuron vs EG
Raw reads from neuron- vs. glia-specific FACsorting experiments were processed with the nf-core/rnaseq pipeline (Patel et al., 2020) with default parameters and the BDGP6 reference genome. The STAR-aligned and salmon-quantified expression matrix was then subset to genes known to be enriched in neurons or glia and displayed as a per gene scaled heatmap.
Analysis of RNAseq data - EG specific differentially expressed genes
After FACsorting of PinkKO-ws vs. control ensheathing glia, library preparation and sequencing resulting FASTQ files were cleaned with fastp (Chen et al., 2018) with default settings. Aligning and counting were carried out with STAR (Dobin et al., 2013)and the 4th 2020 FlyBase Drosophila melanogaster release (r6.35) with the –quantMode flag set as GeneCounts. For differential gene expression testing we used DESeq2 (Love et al., 2014), where we fit a negative binomial model and carried out the Wald-test. We removed experimental batch as a covariate according to the design formula ∼date+genotype. All genes below a Benjamini-Hochberg corrected p-value of 0.05 were considered deregulated.
ScRNAseq data loading, filtering, clustering, and differential expression analysis
Raw counts data from Pech et al., 2024, alongside cell annotations provided by the authors was loaded into Scanpy (v1.9.1) (Wolf et al., 2018) and subset to only include cells in the young control (<= 6d of age) or Pink1 samples. After subsetting the data, filtering was performed to remove any cell with less than 250 genes expressed or a percentage of counts coming from mitochondrial genes greater than 15%, data was then normalized to a total of 10,000 counts and log transformed. Highly variable genes were detected, total_counts and percent of mitochondrial reads was regressed out and finally the data was scaled to unit variance with a zero mean, clipped to a max of 10.
After data pre-processing, a PCA was performed, Harmony (Korsunsky et al., 2019) was used to correct batches using “sample_id” as a batch key, and 122 components were used for dimensionality reduction and clustering analyses. Leiden clustering was performed with a resolution of 8.0 and using the annotations from Pech et al., 2024, all cells within each cluster were labeled by taking the most common, original annotation per cluster.
Per cluster, a differential analysis was performed. First, pseudobulk counts were generated by summing the counts per cell from all cells per sample, these counts were then used in DESeq2 (v1.44.0) (Love et al., 2014) comparing Control vs Pink1 samples. The total number of genes significantly up or downregulated per cluster (padj <= 0.05 and an abs (log2foldchange) >= 1.5) was counted and plotted.
Statistical analysis
GraphPad Prism was used for visualization and to determine statistical significance. Datasets were tested for normal distribution using the D’Agostino-Person Omnibus and Shapiro-Wilk normality test. For normally distributed dataset ordinary one-way ANOVA was used, followed to correct for multiple comparisons by a post hoc Tukey’s test when comparing all the datasets with each other or Dunnett’s test when comparing all the datasets to a general control. For non-normally distributed datasets Kruskal-Wallis test, followed to correct for multiple comparisons by a post hoc Dunn’s test. Significance levels are defined as * is p<0.05, ** is p<0.01, *** is p<0.001 and ns, not significant. ‘N’ in the legends is used to indicate how many animals were analyzed. Data are plotted as mean ± SD. Specifics on the statistical test used for each analysis are reported in the figure legends.
Acknowledgements
We thank the Vlaams Supercomputer Centrum, the VIB Nucleomics Cores, and the Bloomington Drosophila Stock Center (NIH P40OD018537). We are grateful to the members of the Verstreken lab for valuable discussions. R.P. was supported by PhD/postdoc fellowships from EMBO long-term fellowship. Research support was provided in part by the Leuven University Fund and Opening the Future, ERC, the Chan Zuckerberg Initiative, a Methusalem grant from the Flemish government, and FWO Vlaanderen. P.V. is an alumnus of the FENS-Kavli Network of Excellence.
Additional information
Author contributions
Conceptualization, L.G., R.P., P.V.;
Methodology, L.G., U.P., N.S., J.L., K.D., R.P., P.V.;
Software, L.G., K.D., R.P.;
Validation, L.G., K.D., R.P.;
Formal analysis, L.G., K.D., R.P.;
Investigation, L.G., U.P., N.S., J.L., K.D., R.P.;
Writing -Original Draft, L.G., R.P., P.V.;
Writing – review and editing, all co-authors read and edited the manuscript.
Visualization, L.G., K.D., R.P.;
Supervision, R.P., P.V.;
Project administration, L.G.;
Funding acquisition, R.P., P.V.;
Inclusion and diversity
We support inclusive, diverse, and equitable conduct of research.
References
- A single-cell atlas of the human substantia nigra reveals cell-specific pathways associated with neurological disordersNature Communications 11:1–11https://doi.org/10.1038/s41467-020-17876-0Google Scholar
- An optimized transgenesis system for Drosophila using germ-line-specific φC31 integrasesProceedings of the National Academy of Sciences of the United States of America 104:3312–3317https://doi.org/10.1073/pnas.0611511104Google Scholar
- Regulatory sites in the Mon1–Ccz1 complex control Rab5 to Rab7 transition and endosome maturationProceedings of the National Academy of Sciences 120:30https://doi.org/10.1073/pnas.2303750120Google Scholar
- Genetic identification of cell types underlying brain complex traits yields insights into the etiology of Parkinson’s diseaseNature Genetics 52:482–493https://doi.org/10.1038/s41588-020-0610-9Google Scholar
- Fastp: An ultra-fast all-in-one FASTQ preprocessorBioinformatics 34:i884–i890https://doi.org/10.1093/bioinformatics/bty560Google Scholar
- Chaski, a novel Drosophila lactate/pyruvate transporter required in glia cells for survival under nutritional stressScientific Reports 8:1–13https://doi.org/10.1038/s41598-018-19595-5Google Scholar
- STAR: Ultrafast universal RNA-seq alignerBioinformatics 29:15–21https://doi.org/10.1093/bioinformatics/bts635Google Scholar
- Ensheathing Glia Function as Phagocytes in the Adult Drosophila BrainThe Journal of Neuroscience 29:4768–4781https://doi.org/10.1523/JNEUROSCI.5951-08.2009Google Scholar
- Membrane dynamics and fusion at late endosomes and vacuoles - Rab regulation, multisubunit tethering complexes and SNAREsEuropean Journal of Cell Biology 90:779–785https://doi.org/10.1016/j.ejcb.2011.04.007Google Scholar
- Oligodendroglia and Myelin in Neurodegenerative Diseases: More Than Just Bystanders?Molecular Neurobiology 53:3046–3062https://doi.org/10.1007/s12035-015-9205-3Google Scholar
- Glial cell biology in Drosophila and vertebratesTrends in Neurosciences 29:82–90https://doi.org/10.1016/j.tins.2005.12.002Google Scholar
- Phylogenetic-based propagation of functional annotations within the Gene Ontology consortiumBriefings in Bioinformatics 12:449–462https://doi.org/10.1093/bib/bbr042Google Scholar
- TSSC1 is novel component of the endosomal retrieval machineryMolecular Biology of the Cell 27:2867–2878https://doi.org/10.1091/mbc.e16-04-0209Google Scholar
- Mitochondria–Endoplasmic Reticulum Contact Sites Dynamics and Calcium Homeostasis Are Differentially Disrupted in PINK1-PD or PRKN-PD NeuronsMovement Disorders 38:1822–1836https://doi.org/10.1002/mds.29525Google Scholar
- Visual transduction in DrosophilaNature 413:186–193Google Scholar
- Separation of receptor and lamina potentials in the electroretinogram of normal and mutant DrosophilaJournal of Experimental Biology 55:85–100https://doi.org/10.1242/jeb.55.1.85Google Scholar
- Distribution, classification, and development ofDrosophila glial cells in the late embryonic and early larval ventral nerve cordRoux’s Archives of Developmental Biology 204:284–307https://doi.org/10.1007/BF02179499Google Scholar
- Behavioral screening defines three molecular Parkinsonism subgroups in DrosophilabioRxiv https://doi.org/10.1101/2024.08.27.609924Google Scholar
- PINK1 phosphorylates ubiquitin to activate Parkin E3 ubiquitin ligase activityJournal of Cell Biology 205:143–153https://doi.org/10.1083/jcb.201402104Google Scholar
- Fast, sensitive and accurate integration of single-cell data with HarmonyNature Methods 16:1289–1296https://doi.org/10.1038/s41592-019-0619-0Google Scholar
- The glia of the adult Drosophila nervous systemGlia 65:606–638https://doi.org/10.1002/glia.23115Google Scholar
- VPS13A and VPS13C are lipid transport proteins differentially localized at ER contact sitesJournal of Cell Biology 217:3625–3639https://doi.org/10.1083/jcb.201807019Google Scholar
- Parkinson’s DiseaseNew England Journal of Medicine 339:1044–1053https://doi.org/10.1056/NEJM199810083391506Google Scholar
- Disruption of Cnp1 uncouples oligodendroglial functions in axonal support and myelinationNature Genetics 33:366–374https://doi.org/10.1038/ng1095Google Scholar
- Loss of VPS13C Function in Autosomal-Recessive Parkinsonism Causes Mitochondrial Dysfunction and Increases PINK1/Parkin-Dependent MitophagyThe American Journal of Human Genetics 98:500–513https://doi.org/10.1016/j.ajhg.2016.01.014Google Scholar
- Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2Genome Biology 15:1–21https://doi.org/10.1186/s13059-014-0550-8Google Scholar
- The Drosophila Cell Corpse Engulfment Receptor Draper Mediates Glial Clearance of Severed AxonsNeuron 50:869–881https://doi.org/10.1016/j.neuron.2006.04.028Google Scholar
- PINK1 Loss-of-Function Mutations Affect Mitochondrial Complex I Activity via NdufA10 Ubiquinone UncouplingScience 344:203–207https://doi.org/10.1126/science.1249161Google Scholar
- Parkinson’s disease mutations in PINK1 result in decreased Complex I activity and deficient synaptic functionEMBO Molecular Medicine 1:99–111https://doi.org/10.1002/emmm.200900006Google Scholar
- Non-motor signs in Parkinson ’ s disease : a reviewArq. Neuropsiquiatr., January :454–462https://doi.org/10.1590/0004-282X20150029Google Scholar
- VPS13A, a closely associated mitochondrial protein, is required for efficient lysosomal degradationDisease Models & Mechanisms 12:2https://doi.org/10.1242/dmm.036681Google Scholar
- PINK1 Is Selectively Stabilized on Impaired Mitochondria to Activate ParkinPLoS Biology 8:e1000298https://doi.org/10.1371/journal.pbio.1000298Google Scholar
- The role of PINK1–Parkin in mitochondrial quality controlNature Cell Biology 26:1639–1651https://doi.org/10.1038/s41556-024-01513-9Google Scholar
- The sulfite oxidase Shopper controls neuronal activity by regulating glutamate homeostasis in Drosophila ensheathing gliaNature Communications 9:3514https://doi.org/10.1038/s41467-018-05645-zGoogle Scholar
- nf-core/rnaseq: nf-core/rnaseqZenodo https://doi.org/10.5281/zenodo.1400710Google Scholar
- Synaptic deregulation of cholinergic projection neurons causes olfactory dysfunction across 5 fly Parkinsonism modelseLife 13:RP98348https://doi.org/10.7554/eLife.98348.1Google Scholar
- Smart-seq2 for sensitive full-length transcriptome profiling in single cellsNature Methods 10:1096–1100https://doi.org/10.1038/nmeth.2639Google Scholar
- Drosophila ßHeavy-Spectrin is required in polarized ensheathing glia that form a diffusion-barrier around the neuropilNature Communications 12:6357https://doi.org/10.1038/s41467-021-26462-xGoogle Scholar
- The Complex I Subunit NDUFA10 Selectively Rescues Drosophila pink1 Mutants through a Mechanism Independent of MitophagyPLoS Genetics 10:e1004815https://doi.org/10.1371/journal.pgen.1004815Google Scholar
- Neuronal identity defines α-synuclein and tau toxicityNeuron 111:1577–1590https://doi.org/10.1016/j.neuron.2023.02.033Google Scholar
- Olfactory receptor neuron (ORN) axotomy assayBio-Protocol Preprint https://bio-protocol.org/prep625Google Scholar
- A novel Drosophila injury model reveals severed axons are cleared through a draper/MMP-1 signaling cascadeELife 6:1–30https://doi.org/10.7554/eLife.23611Google Scholar
- Oligodendroglial NMDA Receptors Regulate Glucose Import and Axonal Energy MetabolismNeuron 91:119–132https://doi.org/10.1016/j.neuron.2016.05.016Google Scholar
- Fiji - an Open platform for biological image analysisNature Methods 9:7https://doi.org/10.1038/nmeth.2019.FijiGoogle Scholar
- Shawn, the Drosophila homolog of SLC25A39/40, is a mitochondrial carrier that promotes neuronal survivalJournal of Neuroscience 36:1914–1929https://doi.org/10.1523/JNEUROSCI.3432-15.2016Google Scholar
- Single-cell sequencing of human midbrain reveals glial activation and a Parkinson-specific neuronal stateBrain 145:964–978https://doi.org/10.1093/brain/awab446Google Scholar
- A LRRK2-Dependent EndophilinA Phosphoswitch Is Critical for Macroautophagy at Presynaptic TerminalsNeuron 92:829–844https://doi.org/10.1016/j.neuron.2016.09.037Google Scholar
- Glutamate Transporters: Expression and Function in OligodendrocytesNeurochemical Research 45:551–560https://doi.org/10.1007/s11064-018-02708-xGoogle Scholar
- ER Lipid Defects in Neuropeptidergic Neurons Impair Sleep Patterns in Parkinson’s DiseaseNeuron 98:1155–1169https://doi.org/10.1016/j.neuron.2018.05.022Google Scholar
- Drosophila Vps13 Is Required for Protein Homeostasis in the BrainPLOS One 12:e0170106https://doi.org/10.1371/journal.pone.0170106Google Scholar
- Inter-organellar Communication in Parkinson’s and Alzheimer’s Disease: Looking Beyond Endoplasmic Reticulum-Mitochondria Contact SitesFrontiers in Neuroscience 16https://doi.org/10.3389/fnins.2022.900338Google Scholar
- Star-convex Polyhedra for 3D Object Detection and Segmentation in Microscopyhttp://arxiv.org/abs/1908.03636
- SCANPY: large-scale single-cell gene expression data analysisGenome Biology 19:15https://doi.org/10.1186/s13059-017-1382-0Google Scholar
- Lysosomal Regulation of Inter-mitochondrial Contact Fate and Motility in Charcot-Marie-Tooth Type 2Developmental Cell 50:339–354https://doi.org/10.1016/j.devcel.2019.05.033Google Scholar
- Mitochondria–lysosome contacts regulate mitochondrial fission via RAB7 GTP hydrolysisNature 554:382–386https://doi.org/10.1038/nature25486Google Scholar
- Fibroblast growth factor signaling instructs ensheathing glia wrapping of Drosophila olfactory glomeruliProceedings of the National Academy of Sciences 114:7505–7512https://doi.org/10.1073/PNAS.1706533114Google Scholar
- Frequency characteristics in the visual system of Drosophila: Genetic dissection of electroretinogram componentsJournal of General Physiology 69:705–724https://doi.org/10.1085/jgp.69.6.705Google Scholar
- Detecting Activated Cell Populations Using Single-Cell RNA-SeqNeuron 96:313–329https://doi.org/10.1016/j.neuron.2017.09.026Google Scholar
- Endosomal Rab cycles regulate Parkin-mediated mitophagyELife 7:1–32https://doi.org/10.7554/eLife.31326Google Scholar
- Drosophila glia: Few cell types and many conserved functionsGlia 67:5–26https://doi.org/10.1002/glia.23459Google Scholar
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.105386. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2025, Ghezzi et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 1,338
- downloads
- 92
- citation
- 1
Views, downloads and citations are aggregated across all versions of this paper published by eLife.