Introduction

Transport and Golgi Organization 2 (TANGO2) Deficiency Disorder (TDD) is a severe, progressive, neurodegenerative disease primarily affecting children and young adults, frequently accompanied by recurrent, life-threatening metabolic crises.^1–4 While TANGO2 is conserved in species across all three domains of life, its cellular function has not been fully elucidated. Initially identified in a screen of Drosophila genes which, when depleted, precipitate ER-Golgi fusion defects,⁵ TANGO2 has since been shown to localize to both the cytoplasm and the mitochondria.^6,7 Mutations in TANGO2 have been associated with altered mitochondrial respiration and morphology,⁸ disregulated lipid homeostasis^9,10 and defects in fatty acid oxidation⁸ in multiple models. Treatment with supplemental pantothenic acid, the precursor of coenzyme A (CoA), has been shown to improve lipid profile abnormalities in cells,¹⁰ rescue phenotypic defects in a Drosophila TDD model,¹¹ and potentially reduce metabolic crises in patients,¹² implicating reduced CoA, lipid dysregulation, and impaired mitochondrial function as putative drivers of TDD symptoms.

A recent study by Sun et al. suggested that two Caenorhabditis elegans homologs of TANGO2, HRG-9 and HRG-10 (Heme-Responsive Gene), play a critical role in heme export from intestinal cells and lysosome-related organelles and that TANGO2 exhibits a similar function in mobilizing heme from mitochondria in other eukaryotic organisms including yeast.¹³ Two subsequent studies also reported that TANGO2 is involved in heme transport, albeit via discordant mechanisms.^14,15 The notion that defective heme transport underlies the pathophysiology of TANGO2 deficiency marks a sizeable shift from the emerging scientific consensus that TANGO2 is critical for CoA and lipid homeostasis. Therefore, our primary objective was to validate key findings pertaining to heme transport in C. elegans while also replicating key findings in zebrafish and yeast lacking TANGO2 homologs. We hypothesized that, if present, defects in heme transport may be downstream features of aberrant cellular metabolism and thus may not be central to the pathophysiology of TDD.

Results

C. elegans lacking TANGO2 homologs (double knockout; DKO) demonstrate modest survival benefit upon toxic heme analog exposure

We first sought to validate results from prior experiments using heme analogs in worms lacking both HRG-9 and HRG-10 (double knockout; DKO). In previous studies, DKO worms exposed to 1 µM concentration of the toxic heme analog gallium protoporphyrin IX (GaPP) showed a significant survival benefit in contrast with nearly uniform lethality in wild type (Bristol N2) worms.¹³ We exposed gravid DKO and N2 nematodes to GaPP at varying concentrations, removing P₀ worms at 24 hours, and counting alive and dead F₁ progeny at 72 hours. While we required relatively higher concentrations of GaPP to achieve lethality, all strains exhibited a clear dose-dependent reduction in survival (Figure 1A). A statistically significant group effect was observed at 2 µM, with DKO worms showing a modest relative survival benefit compared to N2.

Figure 1:

DKO C. elegans demonstrate increased lawn avoidance and reduced pharyngeal pumping

In maintaining the DKO strain under basal conditions (i.e., no GaPP exposure), we incidentally observed relatively intact E. coli lawns on plates housing DKO worms compared to N2 plates. On closer examination, DKO worms demonstrated several previously undescribed phenotypic features including lawn avoidance, a greater propensity for crawling off plates, reduced pharyngeal pumping, and decreased survival (Figure 2A, B, and F). Based on these observations, we hypothesized that the GaPP survival difference in our initial experiment might have been driven, at least in part, by reduced GaPP consumption. We therefore also examined the effect of GaPP exposure on worms lacking a pharyngeal acetylcholine receptor subunit (eat-2(ad465)). The eat-2 strain exhibits reduced pharyngeal pumping and has been used extensively as a model of dietary restriction.^16,17 Of the three strains tested, survival was highest in eat-2 mutants (Figure 1A) despite the fact that these worms have no known defects in heme metabolism or transport.

Figure 2:

DKO C. elegans demonstrate reduced ZnMP fluorescence

DKO nematodes at the L4 larval stage were previously shown to accumulate the fluorescent heme analog zinc mesoporphyrin IX (ZnMP) in intestinal cells in low-heme (4 µM) liquid media. While attempting to replicate this experiment, we observed that both wildtype and DKO nematodes entered L1 arrest under these conditions. Therefore, to allow for developmental progression, we grew worms on standard OP50 E. coli plates and in media containing physiological levels of heme (20 µM). We then examined whether differences in ZnMP uptake persisted under these basal conditions. DKO worms grown on ZnMP-treated E. coli plates displayed significantly reduced intestinal ZnMP fluorescence compared to N2 (Figure 1B and C). Using basal heme media with ZnMP, there was no significant difference in ZnMP fluorescence between DKO and wildtype nematodes, although DKO worms grown in media without ZnMP exhibited significantly higher autofluorescence (Figure 1D and E). To test whether autofluorescence may have contributed to the higher fluorescent intensities previously reported in heme-deficient DKO worms, we repeated this experiment on agar plates under starved conditions but did not observe a difference between groups (Figure 1B).

DKO C. elegans demonstrate multiple features suggestive of bioenergetic dysfunction

In assessing brood survival in the GaPP assay, we also observed significantly smaller starting broods for DKO nematodes, a previously unreported finding that persisted in the absence of GaPP (Figure 2C). As oogenesis and egg-laying require a high energetic expenditure for gravid C. elegans, reduced brood size is a known feature of several metabolically impaired nematode strains.^18,19 We also observed reduced movement on the plate from DKO worms and decided to further characterize the worms’ capacity for movement by subjecting them to a swim exhaustion assay. Nematodes were placed in isotonic M9 buffer and scored on their swimming ability at 4 minute intervals. While C. elegans are typically able to swim continuously for up to 90 minutes in M9 media,²⁰ we observed that the DKO worms quickly became exhausted and could not maintain normal swimming shortly after being placed in media (Figure 2D). We further quantified the rate of thrashing in M9 media during the first 4-minute interval and found that DKO worms thrashed 61% slower compared to N2 (Figure 2E).

Oxidative stress is a driver of TANGO2 homolog transcription

Given previous observations implicating oxidative stress as a hallmark feature of TDD,⁸ we next sought to examine what other genes were enriched under low heme conditions. We reanalyzed the RNA-seq dataset generated by Sun et al., employing the Empirical Analysis of Gene Expression in R (edgeR) package on raw counts to accurately perform between-group comparisons across low (2 µM), optimal (20 µM), and high (400 µM) heme conditions. We extracted the top 500 enriched genes and plotted those that showed significantly increased expression in the low heme state, based on computational clustering (N=134; Figure 3A). Several genes with no known heme-related functions demonstrated stronger relative expression and higher likelihood ratios of conditional effect than did hrg-9. Furthermore, gene ontology analysis of genes with similar enrichment to hrg-9 revealed a wide spectrum of biological processes and cellular roles, including but not limited to collagen deposition, cellular detoxification, and lipid binding (Figure 3B). To test what alternate forms of cell stress might induce hrg-9 and hrg-10 expression, we exposed N2 nematodes to heat (34°C), starvation (24 hours without OP50), and paraquat (25 mM), a potent generator of superoxide, with subsequent measurement of transcriptional enrichment by way of RT-qPCR. We observed a 12-fold enrichment of hrg-9 after paraquat exposure, suggesting that its expression may be linked to oxidative stress more broadly and is not uniquely driven by heme levels (Figure 3C).

Figure 3:

Yeast deficient in TANGO2 homolog YGR127w exhibit normal growth

As Sun et al. also examined the function of TANGO2 homologs in yeast (YGR127w) and zebrafish (tango2), we sought to validate their findings in these models. It was previously reported that the ygr127w yeast knockout exhibits a severe temperature sensitive growth defect and impaired heme distribution. We also observed a growth defect in the strain generated by Sun et al.; however, two separate strains on different backgrounds (BY4741 and BY4742) and a third strain generated by our lab (W303-1a) showed normal growth (Figure 4A). The growth defect in the initial yeast strain reported by Sun et al. was also not rescued with YGR127w complementation. As the background for this strain is known to be prone to mitochondrial genome instability,²¹ we hypothesize that this line may harbor a secondary mutation.

Figure 4:

Myofiber defects in tango2-deficient zebrafish

In zebrafish, Sun et al. reported no discernable phenotype in tango2^-/-fish bred from heterozygous parents but observed severe skeletal muscle damage in tango2^-/- larvae from tango2^-/- parents. In a recent study, we showed increased lethality and reduced phospholipid and triglyceride levels in tango2^-/- fish obtained from heterozygous parents.²² tango2^-/-larvae from two different alleles (tango2^bwh210 and tango2^bwh211) exhibited defects in myofiber organization irrespective of heterozygous or homozygous parents (Figure 4B) but lacked the striking muscle damage previously reported.

Discussion

Our data, coupled with clinical observations in TDD, do not support a primary role for TANGO2 as a heme chaperone. In C. elegans lacking TANGO2 homologs, we were unable to fully replicate prior findings of defective heme transport using toxic and fluorescent heme analogs. Parallel studies in yeast and zebrafish failed to reproduce previously reported phenotypes in growth and muscle fiber integrity, respectively.

Exposing worms to GaPP, a toxic heme analog, we observed that nematodes deficient in HRG-9 and HRG-10 displayed increased survival compared to WT worms, consistent with prior work,¹³ though the between-group difference was markedly smaller in our study. We required higher GaPP concentrations to induce lethality, potentially due to product vendor differences, but did observe a clear dose-dependent effect across strains. Although it was previously proposed that the survival benefit seen in worms lacking HRG-9 and HRG-10 resulted from reduced transfer from intestinal cells after GaPP ingestion, our data suggest the reduced lethality is more likely due to decreased environmental GaPP uptake. Supporting this notion, DKO worms exhibited lawn avoidance, reduced pharyngeal pumping, and modestly lower intestinal ZnMP accumulation when exposed to this fluorescent heme analog on agar plates. In liquid media, DKO worms demonstrated higher fluorescence, but only in ZnMP-free conditions, suggesting the presence of gut granule autofluorescence. Furthermore, survival following exposure to GaPP was highest in eat-2 mutants, despite heme trafficking being unaffected in this strain.

In addition to altered pharyngeal pumping, DKO worms displayed multiple previously unreported phenotypic features, suggesting a broader metabolic impairment and reminiscent of some clinical manifestations observed in patients with TDD. Elucidating the mechanisms underlying this phenotype, and whether they reflect a core bioenergetic defect, is an active area of investigation in our lab. Several C. elegans heme-responsive genes have been characterized, revealing relatively specific defects in heme uptake or utilization rather than broad organismal dysfunction. For example, hrg-1 and hrg-4 mutants exhibit impaired growth only under heme-limited conditions,²³ and hrg-3 loss affects brood size and embryonic viability specifically when maternal heme is scarce.²⁴ By contrast, hrg-9 and hrg-10 mutants exhibit the most severe phenotypes of the hrg family, to date, including reduced pharyngeal pumping, decreased motility, shortened lifespan, and smaller broods, even when fed a heme-replete diet.

Laboratory abnormalities in human patients TDD include abnormal acylcarnitine profiles, hyperammonemia, and elevated creatinine kinase levels during metabolic crises,^3,12 while abnormalities associated with defective heme transport (e.g., erythrocyte membrane defects, low hemoglobin levels) have not been observed in patients with this condition. Strikingly, retrospective data suggest that patients with TDD receiving B-vitamin supplementation inclusive of pantothenic acid, a precursor of CoA, do not experience metabolic crises¹² and show substantial improvement in other domains as well. Pantothenic acid supplementation also yielded full phenotypic rescue in a Drosophila model of TDD.¹¹ It is difficult to reconcile how this treatment would be beneficial in a condition characterized by dysregulated heme trafficking.

Heme is a hydrophobic molecule; thus, it is plausible that if TANGO2 and its homologs are involved in lipid binding, as was recently demonstrated in Hep2G cells,⁷ these proteins may also weakly bind heme.¹⁴ Han et al. demonstrated that a bacterial heme homolog, HtpA, directly binds heme and is necessary for cytochrome c function.¹⁴ We would note, however, that TANGO2 was not among the 378 heme-binding proteins identified on a recent proteomic screen of three separate cell lines.²⁵ Jayaram et al. recently proposed that TANGO2 may instead interact with the mitochondrial heme exporter FLVCR1b to release mitochondrial heme without directly binding to heme itself, though this interaction was observed only after heme synthesis was potentiated via d-ALA and iron supplementation, raising questions about the role of TANGO2 under basal heme conditions.¹⁵ Furthermore, the investigators identified GAPDH as the exclusive binding partner of heme upon export through FLVCR1b. How GAPDH, a protein important for multiple cellular functions, including glycolysis, is affected in TDD remains unknown.

In this study, we demonstrated that hrg-9 expression is strongly induced by paraquat, a generator of superoxide free radical. Prior work has also identified hrg-9 as a major transcriptional target of the mitochondrial unfolded protein response (mtUPR) through ATFS-1 transcription factor binding.^26,27 Given that heme is an essential component of cytochromes in the electron transport chain, heme deficiency could plausibly activate hrg-9 through the induction of mitochrondial stress. Conversely, artificially stimulating heme synthesis may exert a similar transcriptional effect, as excess heme is mitotoxic and can itself trigger a stress response. Indeed, hrg-9 was also shown to be modestly up-regulated in the high-heme state, unlike other genes in the hrg family (Figure 3A), and our reanalysis of an RNA-seq dataset examining transcription under low-heme conditions revealed broad induction of stress-responsive genes with no established role in heme trafficking (Figure 3B).

In summary, our findings challenge the notion that TANGO2 functions as a heme chaperone. Instead, and consistent with growing clinical evidence, they support a model in which TANGO2 may help mitigate cellular stress and maintain mitochondrial function under conditions of redox imbalance (Figure 5). Clearly, further work is needed to define the precise role of this highly conserved protein as we work to develop effective treatments for patients with TDD.

Figure 5:

Materials and methods

Worm strains and maintenance

Worm strains used include Bristol N2 (obtained from Caenorhabditis Genetics Center (CGC) at the University of Minnesota), DKO (CCH303 (hrg-9(cck301)V; hrg-10(cck302)V) obtained from C. Chen, and eat-2(ad465), obtained from the Samuelson lab at the University of Rochester. All worms were maintained at 20° C on standard nematode growth medium (NGM) plates with OP50 E. coli. All C. elegans assays were performed and scored by blinded observers.

GaPP survival assay

Standard OP50 NGM plates treated with 1, 2, 5, or 10 µM gallium protoporphyrin IX (GaPP; Santa Cruz) after seeding. Plates were swirled to ensure an even distribution of GaPP and allowed to dry completely. Adult worms were placed on plates, permitted to lay eggs for 24 hours, and were then removed. Offspring were assessed 72 hours later for survival and were scored as dead if they did not respond to prodding with a platinum wire worm pick.

Pharyngeal pumping

L4 worms were observed and video recorded for 60 second intervals. The number of pharyngeal pumps per minute was manually counted.

Lawn avoidance

L4 worms were placed in the center of OP50 E. coli lawns on standard NGM plates and incubated at 20° C for 24 hours. Plates were examined 24 hours later and the numbers of worms remaining on the lawn or on unseeded agar were counted. Worms found on the sides of the dish or otherwise absent from NGM surface were scored as off the plate.

Brood size

For 24-hour brood assessments, young adult worms were placed on plates and allowed to lay eggs for 24 hours before being removed. Viable offspring were counted 48 hours later. For total brood assessments, L4 worms were placed on plates and moved to fresh plates every 24 hours for 5 days to ensure all eggs were accounted for. Viable offspring from eggs laid on each plate were counted 48 hours later and summed.

ZnMP fluorescence

L4 worms grown on OP50 plates were placed on plates treated with 40 uM zinc mesoporphyrin (ZnMP; Santa Cruz) for 16 hours before being washed in M9 buffer, aenesthetized in sodium axide, and mounted on slides with 2% agarose pads for imaging.

Worms in the starved condition were placed on uneeded plates for 16 hours before preparation and mounting as above. For liquid media experiments, three generations of worms were cultured in regular heme (20 uM) axenic media, with the first two generations receiving antibiotic-supplemented media (10 mg/ml tetracycline) and the 3^rd generation cultivated without antibiotic. L4 worms from the 3^rd generation were placed in media containing 40uM ZnMP for 16 hours before being prepared and mounted for imaging as above. Worms were imaged on Zeiss Axio Imager 2 at 40x magnification, with image settings kept uniform across all images. Fluorescent intensity was measured within the proximal region of the intestine using ImageJ.

RNA-seq cluster and gene ontology analysis

The RNA sequencing (RNA-seq) dataset generated by Sun et al. was analyzed with Empirical Analysis of Gene Expression in R (edgeR) and the top 500 genes were extracted. Computational cluster analysis was done in RStudio. Gene ontology analysis was performed on significantly enriched genes using WormCat.²⁸ Source code is available in supplemental materials.

Stress conditions and RT-qPCR

N2 worms were subjected to the following stress conditions prior to RNA extraction: 1) fasting: worms were deprived of OP50 E. coli for 24 hours; 2) heat: worms were incubated for 4 hours at 34° C; 3) paraquat: worms were placed on standard NGM/OP50 plates treated with 25 mM paraquat (methyl viologen dichloride hydrate; Sigma Aldrich) for 24 hours. Whole worm RNA was extracted with TRIzol (Invitrogen) and purified using the RNeasy Mini Kit (Qiagen). cDNA generation was performed with the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher). qPCR was performed in triplicate using iTaq Universal SYBR Green Supermix (Invitrogen) with a CFX Duet Realtime qPCR machine (BioRad). Gene expression was normalized to worm act and analyzed using the ΔΔCq method. Primers used were as follows:

hrg-9: GGACCCGCTGCCATACACTAATC and GACAATTCAAATCTGGCATCGTG

hrg-10: AGGCTTCCCGGAGCACATTTAC and CAGGCTCCATGCGTCTATCCAG

act: CAACACTGTTCTTTCCGGAG and CTTGATCTTCATGGTTGATGGG

Yeast strain construction

YGR127w was knocked out by homologous recombination. A strain (BY4741) harboring a ygr127wD was used as a template and the knockout cassette was amplified by PCR using the following primers that anneal upstream and downstream of the locus: TTGGCATCTGCCTAGCTTTCG and AGCGTCTACTGTGGTTACTG

The PCR amplicon was then transformed into W303-1a cells and transformants were selected on YPD plates containing 200mg/ml G418. Integration at the correct locus was confirmed by PCR using the same primers, as above. To complement the ygr127wD in the Sun et al. strain, wild type YGR127w was amplified with 400 base pairs on either side of the gene and cloned into a HIS3-containing plasmid (pRS413). Transformants were selected on synthetic complete (SC) medium lacking histidine.

Yeast growth curves

Cells were grown to stationary phase at 25°C in either SC or SC-histidine medium. Cultures in the same medium were inoculated at an OD600 of ∼0.01 in a 100ml volume in a 96-well plate. The OD600 was read every 15 minutes on a Sunrise Tecan microplate reader.

Zebrafish

All procedures involving zebrafish were approved by the Brigham and Women’s Hospital Animal Care and Use Committee. Fish were bred and maintained using standard methods as described.²⁹ tango2bwh210 and tango2bwh211 zebrafish lines were created in our laboratory by the CRISPR-Cas9 approach as described previously.²² The tango2bwg210 allele has an insertion of seven bases (c.226_227ins7; p.Tyr76Leufs*25) and tango2bwg211 has a 26 base insertions in exon2 (c.226_227ins26; p.Tyr76Leufs*207) resulting in frameshift mutations and loss of protein function. Whole mount phalloidin staining and microscopy was performed as described previously.³⁰

Statistics and Reproducibility

All statistical analyses were performed in GraphPad Prism 9. Data presented are mean ± S.E.M. One-way analysis of variance (ANOVA) followed by Bonferroni’s multiple comparisons was used to determine statistical significance (p < 0.05). Sample sizes were not pre-determined.

Data availability

All raw data from worm behavior, yeast, zebrafish, and RNA-seq studies are available as a supplement to this paper.

Acknowledgements

The authors would like to thank Dr. Keith Nehrke and Dr. Paul Brookes for their guidance and manuscript review, the Chen lab for providing the hrg-9/hrg-10 knockout nematode strain, and the Samuelson lab for supplying the eat-2 nematode strain. SES is a trainee in the Medical Scientist Training Program funded by NIH T32 GM007256. SJM is supported by National Institutes of Health (NIH) National Institute of Neurological Disorders and Stroke Grant #2K12NS098482-06. This work was funded in part by grants from the TANGO2 Research Foundation to VAG, MS, and to SJM and LW.

Additional information

Contributions

SJM, SES, KSY, APW, and LW designed the C. elegans experiments. SES, KSY, OG, and MBB performed the C. elegans experiments and analyzed the data. LDO performed the RNA-seq analysis. MS designed the yeast experiments. AN performed the yeast experiments and analyzed the data. VAG and ESK designed the zebrafish experiments, and EK performed these experiments. VAG and ESK analyzed the zebrafish data. SJM and SES wrote the initial draft of the manuscript. All authors reviewed the manuscript and contributed to its final version.

Funding

NIH (T32 GM007256)

• Sarah E Sandkuhler

TANGO2 Research Foundation

• Samuel J Mackenzie

• Lili Wang

• Michael Sacher

• Vandana Gupta

National Institute of Neurological Disorders and Stroke (2K12NS098482-06)

• Samuel J Mackenzie

Additional files

Supplemental Figure

Extended Data

R Code

RNA Seq Output