Abstract
Although it is well-established that stem cells maintain tissue homeostasis while tumors disrupt it, the mechanisms by which tumors influence the development of nearby stem cells remain poorly understood. Using Drosophila ovaries as a model system, here we discovered that bam or bgcn mutant germline tumors inhibit the differentiation of neighboring wild-type germline stem cells (GSCs). Mechanistically, these tumor cells mimic the stem cell niche by secreting the BMP ligands Dpp and Gbb, but at reduced levels, resulting in moderate BMP signaling activation in adjacent GSCs. Such BMP signaling activation is sufficient to repress bam transcription, thereby blocking GSC differentiation. To our knowledge, this is the first example that tumors can functionally mimic a stem cell niche to inhibit the differentiation of neighboring wild-type stem cells. Similar regulatory paradigms may operate in mammalian tissues, including humans, during tumorigenesis.
Introduction
The homeostasis of many tissues in our bodies is maintained by adult stem cells, but this balance can be disrupted by tumor cells. What occurs when tumorigenesis intersects with stem cell development? To address this question, a mosaic-analysis model system is essential, where wild-type stem cells develop alongside tumor cells. Drosophila offers an exceptional model for such studies, as it allows for the efficient generation of mosaic clones through various established methods (Germani et al., 2018; Pastor-Pareja and Xu, 2013).
In Drosophila ovaries, germline stem cells (GSCs) play a crucial role in sustaining normal oogenesis and maintaining fertility (Fuller and Spradling, 2007; Lin, 1997). These GSCs reside in a specialized microenvironment known as the stem cell niche (hereafter referred to as niche) (Xie and Spradling, 2000). Typically, a GSC undergoes asymmetric division, generating two distinct daughter cells: one remains in the niche to self-renew as a GSC, while the other, called a cystoblast, exits the niche and initiates differentiation. During the differentiation process, each cystoblast performs exactly four rounds of mitotic division with incomplete cytokinesis to produce16 interconnected cystocytes, forming a germline cyst. In each germline cyst, only one germ cell is destined to become the oocyte, while the remaining 15 differentiate into nurse cells that support the development of the oocyte (Figure 1A) (Fuller and Spradling, 2007; Lin, 1997). The principal niche signals are bone morphogenetic protein (BMP) ligands, including Decapentaplegic (Dpp) and Glass bottom boat (Gbb), which are secreted by terminal filament (TF) and cap cells (Chen and McKearin, 2003a; Li et al., 2016; Song et al., 2004; Xie and Spradling, 1998, 2000). These ligands activate BMP signaling in GSCs, leading to the transcriptional repression of bag of marbles (bam), a key gene that promotes differentiation. In contrast, BMP signaling is inactive in cystoblasts, allowing Bam to be expressed and drive their differentiation (Chen and McKearin, 2003a; Song et al., 2004). Bam carries out this function in collaboration with its partner, Benign gonial cell neoplasm (Bgcn) (Li et al., 2009; Ohlstein et al., 2000).

bam or bgcn mutant germline tumors inhibit the differentiation of neighboring wild-type GSCs.
(A) Schematic cartoon for early oogenesis. The red dots and branches indicate spectrosomes and fusomes, respectively. TF cell: terminal filament cell; GSC: germline stem cell. (B) Mosaic analysis strategy. The FLP recombinase triggers mitotic recombination by targeting FRT sequences. The nos>FLP method restricts FLP expression to the germline, while the hs-FLP method enables heatshock-inducible FLP expression. (C-F) Representative samples. The asterisks mark cap cells, and the arrows indicate SGCs that have exited the niche and are surrounded by bam or bgcn mutant germline tumors. Vasa, a germ cell marker, should label all germ cells. However, due to poor tumor permeability, staining often fails to detect tumorous germ cells in the central region (see Vasa panels in D-F). (G-I) Representative samples (z-stack projections). In (G), the arrowheads and arrow respectively mark two GSCs and one cystoblast, all containing dot-like spectrosomes, while the dotted lines delineate cystocytes with branched fusomes. In (H) and (I), the arrows denote SGCs that also contain dot-like spectrosomes, akin to GSCs and the adjacent GSC-like tumor cells. (J and K) Quantification data. For each experiment, three independent replicates were performed, and data represent mean ± SEM. In (J), over 100 SGCs and germline cysts were quantified per replicate, and statistical significance was determined by one-way ANOVA. n.s. (P > 0.05). In (K), over 100 germaria were quantified per replicate. The online version of this article includes the following source data and figure supplement for figure 1: Source data 1. All genotypes. Source data 2. Raw quantification data. Figure supplement 1. SGCs appear in egg chambers.
GSCs mutant for bam or bgcn fail to differentiate and instead hyper-proliferate, forming a well-established Drosophila germline tumor model (Lavoie et al., 1999; McKearin and Ohlstein, 1995; McKearin and Spradling, 1990; Niki and Mahowald, 2003). Notably, these germline tumor cells competitively displace wild-type GSCs from the niche (Jin et al., 2008). The resulting displacement creates a microenvironment where wild-type GSCs are surrounded by tumor cells, providing an excellent model system to study stem cell behavior in tumor neighborhoods.
Here, we demonstrate that bam or bgcn mutant germline tumors inhibit the differentiation of neighboring wild-type GSCs by functionally mimicking the stem cell niche. This mechanism may be conserved in mammals, including humans, during tumorigenesis, where malignant cells could similarly disrupt normal stem cell development.
Results
Germline tumors inhibit the differentiation of neighboring wild-type GSCs
To generate bam or bgcn mutant germline clones, we employed either nos>FLP/FRT or hs-FLP/FRT system that we previously established (Zhang et al., 2023; Zhao et al., 2018). These two systems induce the expression of FLP recombinase either germline-specifically (nos-GAL4-VP16/UASz-FLP) or via heat shock (hs-FLP). The expressed FLP recombinase targets the FRT sites to mediate mitotic recombination on homologous chromosome arms, generating adjacent GFP-negative (bam or bgcn mutant) and GFP-positive (wild-type) germ cell populations (Figure 1B). Remarkably, we observed that many wild-type germ cells located outside the niche retained a GSC-like single-germ-cell (SGC) morphology (Figure 1C, D), even when encapsulated within egg chambers (Figure 1—figure supplement 1). Under normal conditions, GSCs that exit the niche differentiate into interconnected germline cysts, where germ cells are linked rather than remaining as individual, isolated cells (Fuller and Spradling, 2007; Xie and Spradling, 2000). To rule out the possibility that the SGC phenotype is an artifact caused by GFP expression, we repeated the experiments using RFP and arm-lacZ as alternative mosaic-analysis markers. Consistent results were observed (Figure 1E, F), confirming that the phenotype is not attributable to GFP.
To further confirm that these SGCs exhibit GSC-like characteristics, we conducted anti-α-Spectrin immunofluorescent staining, a method that labels a germline-specific organelle known as the spectrosome in GSCs and cystoblasts, and the fusome in cystocytes. GSCs perform complete cell division, whereas cystocytes undergo incomplete cytokinesis, remaining interconnected through fusomes and ring canals. Consequently, spectrosomes appear as dot-like structures, while fusomes exhibit branched morphologies (Figure 1G) (Lin et al., 1994). To accurately capture the three-dimensional (3D) architecture of spectrosomes and fusomes, we acquired z-stack images using confocal microscopy. Strikingly, these SGCs displayed dot-like spectrosomes, closely resembling those observed in wild-type GSCs and bam or bgcn mutant GSC-like tumor cells (Figure 1H, I). We also considered the possibility that SGCs might arise through the dedifferentiation of the cystocytes in germline cysts surrounded by germline tumors. If this were the case, such cystocytes would initially undergo complete cell division, leaving behind midbodies as markers of the late cytokinesis stage. When visualized by anti-α-Spectrin immunofluorescence, midbody appears as a central sphere that is slightly connected to two larger flanking structures, resembling a variant of nunchucks (Mathieu et al., 2022). Notably, in our analyses of over 50 germline cysts surrounded by bam mutant germline tumors, none contained midbodies, suggesting that dedifferentiation is unlikely to be the primary mechanism responsible for the SGC phenotype. Together, these findings indicate that bam or bgcn mutant germline tumors inhibit the differentiation of neighboring wild-type GSCs.
To quantify the SGC phenotype, which requires the presence of both germline tumors and out-of-niche wild-type germ cells, we analyzed germaria containing both. In 14-day-old fly ovaries, 70% of germaria (432/618) met this criterion. We calculated the percentage of SGCs relative to the total number of SGCs and germline cysts, considering the out-of-niche germ cells that are either fully enclosed by germline tumors (e.g., the right SGC in Figure 1I and the marked germline cyst in Figure 2G) or in contact with wild-type germ cells or somatic cells on only one side (e.g., the left SGC in Figure 1I and the outlined germline cyst in Figure 4C). Notably, the SGC phenotype was consistent across the 14-day period analyzed (Figure 1J). For subsequent quantification, we used 14-day-old flies, taking advantage of the robust germline tumor growth at this age to ensure efficient analysis. In qualifying germaria, the average number of SGCs was approximately 1.5 (Figure 1K).

The inhibition of SGC differentiation depends on the lack of Bam expression.
(A) Representative sample. The arrowhead marks a BamC-positive 4-cystocyte germline cyst, while the arrows indicate BamC-negative SGCs. (B) Representative sample. The asterisk denotes cap cells, and the dotted circles outline bamP-GFP-negative GSCs. The solid circle marks a bamP-GFP-positive cystoblast. The arrow and arrowhead point to bamP-GFP-negative and -positive SGCs, respectively. (C) Quantification data. 14-day-old flies were used for the analyses. CBs: cystoblasts. (D) Schematic of the experimental strategy for (E-H). In “with hs-bam” flies (E and G), wild-type germ cells (both bam+/+ and bam+/-) carry the hs-bam transgene, while control “without hs-bam” flies (F) lack this element in their wild-type germ cells. (E-G) Representative samples. The arrows mark SGCs with dot-like spectrosomes, while the arrowhead indicates a 4-cystocyte germline cyst containing branched fusomes. (H) Quantification data. For each experiment, three independent replicates were performed, with over 100 SGCs and germline cysts quantified per replicate. Data represent mean ± SEM, and statistical significance was determined by t test. n.s. (P > 0.05). The online version of this article includes the following source data for figure 2: Source data 1. All genotypes. Source data 2. Raw quantification data.
The inhibition of differentiation in SGCs relies on the lack of Bam expression
Given that Bam is the key factor promoting GSC differentiation (McKearin and Ohlstein, 1995; Ohlstein and McKearin, 1997), we were very curious about the expression of Bam in SGCs. At first, we assessed Bam protein levels using immunofluorescent staining with an anti-BamC antibody (McKearin and Ohlstein, 1995). Strikingly, none of the SGCs examined (n > 100) were BamC-positive (Figure 2A). Then, we analyzed bam transcription levels using a bamP-GFP reporter (Chen and McKearin, 2003b). 100% of GSCs within the niche (n = 153) were GFP-negative, while 98% of cystoblasts (n = 106) were GFP-positive (Figure 2B, C), confirming that bam transcription is associated with the initiation of GSC differentiation (McKearin and Ohlstein, 1995). Notably, 74% of SGCs (n = 132) were GFP-negative, while the remaining 26% were GFP-positive (Figure 2B, C). This suggests that SGCs can be categorized into two distinct groups: those resembling GSCs (GSC-like) and those resembling cystoblasts (cystoblast-like). The cystoblast-like SGCs may have already initiated their differentiation program toward becoming cystocytes. Since bam transcription initiates in cystoblasts (McKearin and Spradling, 1990) but Bam proteins accumulate predominantly in cystocytes (McKearin and Ohlstein, 1995), the Bam protein levels in these cystoblast-like SGCs are likely below the detection threshold at this early stage.
Next, we asked whether ectopic expression of Bam can drive SGCs to differentiate. To address this, we established two experimental scenarios: one with the hs-bam element and one without as the control. In the hs-bam scenario (with hs-bam), GFP-positive germ cells are wild-type (carrying hs-bam), while GFP-negative cells are bam mutant (lacking hs-bam). In the control scenario (without hs-bam), GFP-positive cells are wild-type, and GFP-negative cells are bam mutant (Figure 2D, see genotypes in Source data 1). To induce ectopic Bam expression, 12-day-old female flies were subjected to heatshock treatment, which involved heating at 37°C for two hours, twice daily with a 6-hour interval, and over two consecutive days. In the absence of heatshock treatment, the percentage of SGCs in ovaries of both genotypes showed no significant difference at either 12 or 14 days (Figure 2E-H), indicating that the hs-bam element alone, without heatshock, does not affect the phenotype. However, following heatshock treatment, the percentage of SGCs in ovaries with hs-bam was markedly reduced compared to those without hs-bam (Figure 2E-H), suggesting that ectopic Bam expression can drive SGCs to differentiate. Collectively, these results support that the differentiation defects of SGCs are due to the lack of Bam expression.
SGCs retain moderate BMP signaling activation
Within the niche, BMP signaling functions to repress bam transcription to inhibit GSC differentiation (Chen and McKearin, 2003a; Song et al., 2004). To investigate BMP signaling activation in SGCs, we employed immunofluorescent staining for pMad, a well-characterized marker of BMP signaling activity (Kai and Spradling, 2003). Surprisingly, we observed undetectable pMad levels in all SGCs examined (n > 100) (Figure 3A, B). To investigate this further, we examined the activity of Dad-lacZ, a highly sensitive BMP signaling reporter known to be activated not only in GSCs but also in cystoblasts (Kai and Spradling, 2003; Song et al., 2004). Notably, 73% of SGCs were lacZ-positive (n = 107), a proportion lower than that of GSCs within the niche, which showed 100% lacZ positivity (n = 122) (Figure 3C, D). Furthermore, when comparing Dad-lacZ expression levels exclusively in lacZ-positive cells, we found that SGCs exhibited significantly lower expression levels than GSCs within the niche (Figure 3C, E). These findings indicate that BMP signaling is activated in SGCs but at lower levels than those in GSCs within the niche.

SGCs maintain lower BMP signaling levels than GSCs within the niche.
(A and B) Representative samples. The asterisks mark cap cells, arrowheads indicate pMad-positive GSCs, and arrows point to pMad-negative SGCs. (C) Representative samples. The asterisks denote cap cells, arrowheads mark Dad-lacZ-positive GSCs, and arrows highlight Dad-lacZ-positive SGCs. The dotted cycles outline one Dad-lacZ-negative SGC. (D and E) Quantification data. 14-day-old flies were used for the analyses. In (E), data represent mean ± SEM, and statistical significance was determined by t test. (F) Representative sample. The asterisk marks a cap cell, while the arrows indicate a BrdU+ GSC within the niche. (G) Representative sample. The arrow indicates a BrdU+ SGC surrounded by germline tumors. (H) Quantification data. 14-day-old flies were used for the analyses. Statistical significance was determined by chi-squared test. The online version of this article includes the following source data for figure 3: Source data 1. All genotypes. Source data 2. Raw quantification data.
Beyond maintaining Drosophila female GSCs in the niche, BMP signaling also promotes their division (Xie and Spradling, 1998). Since the activation levels of BMP signaling in SGCs were lower than those in GSCs within the niche, we hypothesized that SGCs would exhibit slower proliferation rates than GSCs. To test this hypothesis, we performed BrdU incorporation assays. The results revealed that only 4.5% of SGCs were BrdU-positive (n = 1034), a significantly lower proportion than the 7.8% observed in GSCs within the niche (n = 1337) (Figure 3F-H). These findings further corroborate the reduced activation of BMP signaling in SGCs relative to GSCs.
BMP signaling inhibits SGC differentiation
Then we investigated whether BMP signaling functions to inhibit SGC differentiation. The BMP type II receptor Punt and the co-Smad Medea (Med) are essential for maintaining GSC stemness within the niche (Xie and Spradling, 1998). To investigate whether they are also required to inhibit SGC differentiation, we established a genetic scenario, in which GFP+/+ RFP-/- germ cells are punt-/- or med-/-; GFP+/- RFP+/- germ cells are punt+/-bam+/- or med+/- bam+/- (similar to wild-type); and GFP-/- RFP+/+ germ cells are bam-/-. In control experiments (with no punt or med mutation), GFP+/+ RFP-/- germ cells are wild-type; GFP+/- RFP+/- germ cells are bam+/-(similar to wild-type); and GFP-/- RFP+/+ germ cells are bam-/- (Figure 4A, see genotypes in Source data 1). Strikingly, the proportion of punt-/- or med-/-SGCs relative to total SGCs was significantly lower than in controls (Figure 4B-E). Conversely, among punt-/- or med-/- germ cells meeting our established criteria for SGC phenotype quantification, germline cysts constituted a higher percentage compared to controls (Figure 4F). These results indicate that Punt and Med function to inhibit SGC differentiation.

BMP signaling inhibits SGC differentiation.
(A) Schematic of the experimental strategy for (B-F). Genotypes were unambiguously distinguished using a triple-color system (red, yellow, and green). (B-D) Representative samples. The dotted cycles mark an SGC, while the solid lines outline germline cysts containing differentiating cystocytes. (E and F) Quantification data. 14-day-old flies were used for the analyses. (G) Schematic of the experimental strategy for (H-J). (H and I) Representative samples. The dotted lines mark an SGC, while the solid lines outline a germline cyst containing differentiating cystocytes. (J) Quantification data. 14-day-old flies were used for the analyses. For each experiment, three independent replicates were performed, with over 100 SGCs and germline cysts quantified per replicate. Data represent mean ± SEM, and statistical significance was determined by t test. The online version of this article includes the following source data for figure 4: Source data 1. All genotypes. Source data 2. Raw quantification data.
Mothers against dpp (Mad) is the primary transcription factor of BMP signaling, and it is also essential for GSC maintenance in Drosophila ovaries (Xie and Spradling, 1998). Unlike punt and med, which reside on the same chromosome arm (3R) as bam, mad is located on a separate chromosome arm (2L). To investigate whether Mad is required to inhibit SGC differentiation, we established a genetic scenario, in which GFP-/-germ cells are mad-/- and GFP+/+ germ cells are bam-/-. In control experiments (with no mad mutation), GFP-/- germ cells are wild-type and GFP+/+ germ cells are bam-/- (Figure 4G, see genotypes in Source data 1). Notably, mad mutation significantly decreased the SGC proportion relative to controls (Figure 4H-J). These results suggest that, like Punt and Med, Mad also plays a crucial role in suppressing SGC differentiation. Together, these findings demonstrate that BMP signaling contributes to inhibiting SGC differentiation, despite at reduced activation levels.
Germline tumors secret Dpp and Gbb
The formation of a differentiation niche by escort cells is required for GSC differentiation and is known to be disrupted by bam mutant germline tumors (Chen et al., 2022; Kirilly et al., 2011). Although this niche disruption could contribute to the SGC phenotype, an unaddressed question is the source of the BMP ligands (Dpp and Gbb) that maintain BMP signaling activation within SGCs. Guided by the Occam’s Razor principle, we focused on bam or bgcn mutant germline tumor cells, as the SGC phenotype is dependent on their presence. To assess the expression of dpp and gbb, we employed third-generation in situ hybridization chain reaction (HCR) (Choi et al., 2018). Successful detection was confirmed by prominent signal foci in TF and cap cells (Figure 5A, C). To enable quantitative comparison, all experiments and confocal imaging were performed under identical parameters. Signal intensity within bam mutant germline tumors and wild-type cystocytes was normalized to the signal in wild-type TF and cap cells. Strikingly, bam mutant germline tumor cells exhibited significantly elevated expression of both dpp and gbb compared to wild-type cystocytes (Figure 5A-D).

Germline tumors secret Dpp and Gbb.
(A and C) Representative samples. The asterisks denote TF or cap cells. The dotted lines highlight wild-type (WT) cystocytes, while the solid lines outline bam mutant germline tumor cells. (B and D) Quantification data for in situ-HCR assays. 14-day-old flies were used for the analyses, and over 10 samples were quantified for each experiment. The dpp or gbb expression levels in both WT cystocytes and bam mutant germline tumor cells were normalized to the average expression levels in WT TF and cap cells. (E and F) Quantification data for RT-qPCR assays. 14-day-old flies were used for the analyses. For each experiment, three independent replicates were performed. Data represent mean ± SEM, and statistical significance in (B and D) was determined by one-way ANOVA and in (E and F) by t test. The online version of this article includes the following source data for figure 5: Source data 1. All genotypes. Source data 2. Raw quantification data.
To more sensitively assess Dpp and Gbb expression, we performed real-time quantitative PCR (RT-qPCR) analyses in bam or bgcn mutant ovaries, comparing samples with and without germline-specific knockdown of dpp or gbb. Detection of reduced transcript levels in knockdown conditions would confirm active expression of these genes in the respective genetic backgrounds. Consistent with the essential roles of these two genes in fly viability, ubiquitous knockdown using act-GAL4 with either dpp-RNAi or gbb-RNAi caused lethality, which results also validated the efficacy of these RNAi lines. Notably, germline-specific knockdown of dpp or gbb significantly reduced their transcript levels compared to yellow (y) or white (w) knockdown controls (Figure 5E, F). Collectively, these findings demonstrate that bam or bgcn mutant germline tumors secrete the BMP ligands, albeit at lower levels than TF and cap cells.
Dpp and Gbb secreted by germline tumors are required to inhibit SGC differentiation
Finally, we investigated whether Dpp and Gbb secreted by germline tumors are required to inhibit SGC differentiation. Using a previously established double-mutant mosaic-analysis strategy for two genes on different chromosomes (Zhang et al., 2024; Zhang et al., 2023), we generated dpp bam or gbb bam double-mutant germline clones using two dpp mutant alleles, dppd6, dppd12, and one gbb allele, gbb1 (Figure 6A, B, see genotypes in Source data 1). Heterozygotes in any of these alleles did not affect GSC maintenance, germ cell differentiation, and female fly fertility (Figure 6—figure supplement 1). However, both dpp bam and gbb bam double-mutant germline tumor cells exhibited reduced proliferation rates compared to bam single-mutant controls (Figure 6—figure supplement 2), indicating that autocrine BMP signaling promotes bam mutant tumor growth. As mentioned earlier, our evaluation focused on germ cells that have exited the niche and are surrounded by germline tumors to quantify the SGC phenotype. Thus, it raises the question of whether the extent of tumor encirclement (i.e., being surrounded by more or fewer tumor cells) influences the phenotype. To investigate this, we compared the SGC phenotype in bigger and smaller bam mutant germline tumors. Using confocal microscopy, we analyzed 70 germaria containing bam mutant germline clones that met our criteria for SGC phenotype quantification. For each bam mutant germline clone, we scanned and measured its maximal 2D cross-sectional area as a proxy for its 3D size. The 35 bigger and 35 smaller clones were categorized as ‘bigger’ and ‘smaller’ tumors, respectively. Strikingly, the SGC phenotype remained consistent between the two tumor groups (Figure 6—figure supplement 3), aligning with our earlier finding that this phenotype is stable over a 14-day period (Figure 1J), a timeframe sufficient for substantial germline tumor growth. These results suggest that direct contact between tumorous and wild-type germ cells, rather than tumor size, is the primary determinant of this phenotype.

Dpp and Gbb secreted by germline tumors are required to inhibit SGC differentiation.
(A) Schematic of the experimental strategy for (C-F). (B) Schematic of the experimental strategy for (G-I). (C-E, G, and H) Representative samples. The arrows mark SGCs containing dot-like spectrosomes, while the arrowheads denote germline cysts with differentiating cystocytes that possess branched fusomes. (F and I) Quantification data for the SGC phenotype. 14-day-old flies were used for the analyses. For each experiment, three independent replicates were performed, with over 100 SGCs and germline cysts quantified per replicate. Data represent mean ± SEM. Statistical significance in (F) was determined by one-way ANOVA and in (I) by t test. The online version of this article includes the following source data and figure supplement for figure 6: Source data 1. All genotypes. Source data 2. Raw quantification data. Figure supplement 1. Monoallelic deletion of dpp or gbb does not affect GSC maintenance, germ cell differentiation, and female fly fertility. Figure supplement 2. dpp bam or gbb bam double-mutant germline tumor cells divide more slowly than bam single-mutant ones. Figure supplement 3. The SGC phenotype is unchanged irrespective of the number of surrounding germline tumors.
The results above demonstrate that comparing the severity of the SGC phenotype is feasible between germ cells surrounded by smaller dpp bam or gbb bam double-mutant germline tumors and those surrounded by larger bam single-mutant germline tumors. Remarkably, both dpp bam and gbb bam double-mutant germline tumors enclosed fewer SGCs but more germline cysts than their bam single-mutant counterparts (Figure 6C-I). Thus, we concluded that the BMP ligands from directly-contacting germline tumor cells mediate the dominant inhibition of SGC differentiation. This amazingly parallels the mechanism observed in normal stem cell niche, where only germ cells in direct contact with cap cells are maintained as GSCs (Chen and McKearin, 2003a; Song et al., 2004; Xie and Spradling, 2000).
Discussion
Our study reveals that bam or bgcn mutant germline tumors in Drosophila ovaries secrete lower levels of BMP ligands Dpp and Gbb than cap cells, resulting in moderate BMP signaling activation in adjacent wild-type GSCs (called SGCs in this study). Such BMP signaling activation is sufficient to repress bam transcription, thereby blocking SGC differentiation (see our working model in Figure 7). Strikingly, this mechanism closely recapitulates the normal niche signaling program mediated by TF and cap cells (Chen and McKearin, 2003a; Song et al., 2004; Xie and Spradling, 1998, 2000). To our knowledge, this represents the first evidence that tumor cells can functionally mimic a stem cell niche to arrest neighboring wild-type stem cells in an undifferentiated state.

A working model.
bam or bgcn mutant germline tumors secrete the BMP ligands Dpp and Gbb to activate BMP signaling in out-of-niche GSCs (called SGCs in this study) to inhibit their differentiation (left panel). In contrast, dpp bam and gbb bam double-mutant germline tumors exhibit a significant loss of this differentiation-inhibiting ability (right panel).
While bam or bgcn mutant germline tumors consist of GSC-like cells expected to resemble SGCs (Lavoie et al., 1999; McKearin and Ohlstein, 1995), we found key differences in BMP signaling. Out-of-niche bgcn mutant tumor cells showed significantly lower BMP activity than neighboring SGCs, as evidenced by reduced Dad-lacZ expression (Figure 3C). Consistent with this, most of out-of-niche bam mutant tumor cells expressed bamP-GFP, a reporter suppressed by BMP signaling (Chen and McKearin, 2003a; Song et al., 2004), whereas only 26% of SGCs were positive (Figure 2B, C). These findings suggest that SGCs are more responsive to BMP signals secreted by germline tumors than the tumors themselves. Future studies are needed to elucidate the underlying mechanisms.
One interesting finding is that bam or bgcn mutant germline tumors secrete lower levels of BMP ligands than TF and cap cells (Figure 5A-D). This aligns with earlier microarray data showing that purified Drosophila female GSCs express minimal Dpp and Gbb (Kai et al., 2005). However, our work reveals that such BMP levels in germline tumors are functionally critical to suppress SGC differentiation (Figure 6). Unlike normal GSCs, which receive unidirectional BMP ligands from cap cells (Chen and McKearin, 2003a; Li et al., 2016; Song et al., 2004; Xie and Spradling, 2000), SGCs are often fully surrounded by bam or bgcn mutant germline tumors. This spatial advantage likely enables tumors to inhibit SGC differentiation efficiently without matching the high BMP output of TF and cap cells. Moreover, since BMP signaling is known to both inhibit normal GSC differentiation and promote their proliferation (Xie and Spradling, 1998), it should similarly stimulate SGC expansion, which is detrimental for bam or bgcn mutant germline tumors. We propose that these tumor cells finely regulate BMP secretion to balance these opposing demands: maintaining differentiation blockade of SGCs while avoiding stimulation of their excessive proliferation.
A well-established principle in oncology is that tumor aggressiveness correlates with poor differentiation, with less-differentiated tumors exhibiting enhanced transformative capacity and metastatic potential (Jogi et al., 2012; Lytle et al., 2018). In Drosophila ovaries, bam or bgcn mutant germline tumors consist of GSC-like cells that may resemble these poorly differentiated human tumors (Lavoie et al., 1999; McKearin and Ohlstein, 1995). This similarity raises the possibility that stem cell-like human tumors may similarly inhibit the differentiation of adjacent wild-type stem cells. By blocking differentiation, such tumors could deplete terminally differentiated cell populations, potentially exacerbating patient mortality. This mechanism may contribute to the heightened lethality of poorly differentiated tumors. Further investigation is needed to test this hypothesis.
The differentiation of a single GSC into a 16-cell germline cyst, comprising 15 polyploid nurse cells and one developing oocyte, represents a substantial metabolic investment (Fuller and Spradling, 2007; Lin, 1997). We propose that bam or bgcn mutant germline tumors block this process to divert nutrients toward their own uncontrolled growth. This phenomenon could have broad implications, as many human tissues and organs (intestine, muscle, skin, blood system, male germline, etc.) similarly depend on adult stem cells for homeostasis (Blanpain and Fuchs, 2006; Gehart and Clevers, 2019; Sousa-Victor et al., 2022; Spradling et al., 2011; Wilkinson et al., 2020). Notably, these stem cell-dependent tissues and organs are frequent sites of tumorigenesis, raising the possibility that human cancers may similarly impair neighboring stem cell differentiation to optimize nutrient allocation for malignant growth. A key limitation of our study is that the evidence is derived solely from Drosophila germline. Future work should explore whether similar regulatory paradigms operate in mammalian tissues during tumorigenesis.
Materials and Methods



Fly husbandry
Flies were raised at 25°C on standard cornmeal/molasses/agar media.
Transgenic flies
hs-bam on chromosome 3R: The coding sequence of the bam gene, amplified from the cDNA clone, was cloned into the BglII-XbaI sites of the pCaSpeR-hs vector, while the attB sequence was inserted into the XhoI site. The resulting attB-pCaSpeR-hs-bam plasmid was then microinjected into the attP154 (Chromosome 3R, 97D2) fly strain to generate site-specific transgenic flies.
Heatshock method to induce germline clones
To ensure developmental synchrony and maintain low-density growth, eggs within 8 hours of laying were collected for heatshock treatment. The animals (late-Larva 3/early-Pupa stage) were subjected to twice-daily heatshocks at 37°C (2 hours per session, with a 6-hour interval between the two sessions) for 6 consecutive days.
Fertility test
For each genotype, three independent crosses were performed. Each cross vial contained two females and four w1118 (wild-type) males, all aged three days old. The crosses were transferred to fresh vials every two days, with five replicate vials quantified per genotype. After all adult flies eclosed, offspring production was assessed by counting the number of empty pupae on the vial walls.
BrdU labeling
Ovaries were dissected in Schneider’s insect medium (SIM) and incubated in freshly prepared BrdU solution (100 μg/mL in SIM) for five hours at 25°C. After washing with PBS for 30 min, samples were fixed in 4% paraformaldehyde (in PBS) for three hours, followed by another PBS wash for 30 min. Samples were then treated with RQ1 DNase reaction solution (Promega, Madison, WI, USA) for one hour, washed with PBST (0.3% Triton X-100 in PBS) for 30 min, and incubated overnight at 4°C with mouse anti-BrdU antibody. Following a PBST wash for one hour, ovaries were incubated with goat anti-mouse 546 and DAPI (0.1 μg/mL) in PBST for three hours, washed again in PBST for one hour, and mounted in autoclaved 70% glycerol.
Immuno-florescent staining, image collection, and data Processing
Ovaries were dissected in PBS, fixed in 4% paraformaldehyde (in PBS) for three hours, washed with PBST for 30 min, and then incubated overnight at 4°C with primary antibodies diluted in PBST as follows: mouse anti-BamC (1:5), mouse anti-β-Gal (1:200), mouse anti-α-Spectrin (1:100), rabbit anti-pMad (1:500), and rabbit anti-Vasa (1:2000). After washing with PBST for one hour, samples were incubated with Alexa Fluor-conjugated secondary antibodies (1:1000) and 0.1 μg/mL DAPI (in PBST) for three hours, followed by a final PBST wash for one hour. Ovaries were mounted in autoclaved 70% glycerol and imaged using a Zeiss LSM 710 confocal microscope (Carl Zeiss AG, Baden-Württemberg, Germany). Images were processed with ZEN 3.0 SR imaging software (Carl Zeiss) and Adobe Photoshop 2022. The quantification data were processed by GraphPad Prism, ImageJ, or Microsoft Excel.
In situ hybridization chain reaction (HCR)
Ovaries dissected from 14-day-old female flies were processed according to the following protocol.
Fixation: Ovaries were fixed in 4% paraformaldehyde (in PBS) for 3 hours at room temperature (RT) or overnight at 4°C;
Hybridization: Following fixation, samples were washed three times for 5 min each in PBST, dehydrated in methanol for 5 min, rehydrated through a methanol:PBST gradient series (3:1, 1:1, and 1:3), followed by another three 5-min PBST washes, treated with Proteinase K (10Lμg/mL) for 5 min, washed again three times for 5 min each in PBST, pre-hybridized in preheated hybridization buffer [50% formamide, 5× SSC, 9 mM citric acid (pH 6.0), 0.1% Tween 20, 50 µg/mL heparin, 1× Denhardt’s solution, 10% dextran sulfate] for 30 min at 37°C, and then incubated with RNA-FISH probes (0.1LμM in hybridization buffer) overnight at 37°C.
Signal amplification: The next day, samples were washed four times for 15 min each at 37°C with preheated probe wash buffer (50% formamide, 5× SSC, 9 mM citric acid, 0.1% Tween 20, 50 µg/mL heparin), followed by three 10-min washes in 5× SSCT (5× SSC, 0.1% Tween 20) at RT. After pre-hybridization in amplification buffer (5× SSC, 0.1% Tween 20, 10% sodium sulfate) for 10 min at RT, an amplification reaction was performed using heat-denatured hairpin h1/h2 nucleic acids (30 nM for each in amplification buffer) overnight in the dark at RT.
Washing and mounting: Samples were washed three times for 10 min each in 5× SSCT, followed by three 10-min washes in PBST, and then mounted in autoclaved 70% glycerol for imaging.
For the detection of dpp and gbb, a pool of 20 RNA-FISH probes targeting each mRNA was employed. The sequences of these probes were as follows:
dpp RNA-FISH probes:
GAGGAGGGCAGCAAACGGaaAGAGCATGGCCACGCTGTCCAGTTG
GCACCACCGTACTTTGGTCGTTGAGtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaTCGTAGCCCAGAGGCGCCACAATCC
GGGCACTTCCCGTGGCAGTAATATGtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaTCTCGGCTGCCGCTTGTTCCGGCCG
GTCGTGGTTCTTGCGCCTCGTAGGCtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaGCTGCTTGTGCTGCCACCGCTCGTG
CGTCGTCCGTGTAGGTGAACAGGAGtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaGGCCGGCTGGACATCGAGGCTCACC
CTGCGGACTCGCCAGCCACCGGTCCtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaCACCTGGTAGCGCGTCCGATTCGCC
CCCGACGCGCGTGATGTCGTAGACAtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaTGCTCTTCACGTCGAAGTGCAGCCG
CCGCCTTCAGCTTCTCGTCGGCGGGtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaCCCATGATCTCGGCGTAGAGCTTCT
GGGATGTTGACCGAGTCGAGCTCGTtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaAGCGCCTCCTTGCTGTAGGTGGACG
GGGTCTGGCTTCAGCTTGTCCTTGAtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaCACGAAGATTGATTCAATCGACGAG
GCGGTCGAGCACCAGCGTCGGCTCCtaGAAGAGTCTTCCTTTACG
gbb RNA-FISH probes:
GAGGAGGGCAGCAAACGGaaGGTGGTACAGAACGGGTAGTGCTCC
TTTTCAGGTTCACATTCTCGTCGTTtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaGCGTTCATGTGCGCATTGAGCGGGA
AGGGTCTGGACGATCGCATGGTTCGtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaGTACAGGGTCTGCATCTGGCAGCTG
ATGCCAGCCCAGATCCTTGAAGTCTtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaTGCTCCTGTGGTGGCTGCTGTGGGC
GCTTGCGTGGATGGCTGGCGCTTCGtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaATGTCGTCCAGCTTCACCTCGCGGT
TCGTCCACCTTGCGGTGGATCAGTCtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaGTTGAGCTCCAACCAGCCCACGTAG
CAGCCACTCGTGCAGGCCCTCGGTCtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaACTCCCTGTTGGCGGTCAGCCACTT
TGCCAATGGCGTATACCGTGATGGTtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaCGACGGCCGTGCTCGTGACGCAGTT
GGCACGTTGGAGACGTCGAACCACAtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaGTTCTTCTGCTGCTCGCCCTCATCC
GGCCCGCTTGTCCAGGTCGGTGATGtaGAAGAGTCTTCCTTTACG
GAGGAGGGCAGCAAACGGaaTGATGCGGTGGTAGACGTCCAGCAG CCTGATCGCTGAGACCCTCCTCCGCtaGAAGAGTCTTCCTTTACG
The hairpin h1/h2 sequences were as follows:
B1H1-594:
CGTAAAGGAAGACTCTTCCCGTTTGCTGCCCTCCTCGCATTCTTTCTTGAGGAGGG
CAGCAAACGGGAAGAG
B1H2-594:
GAGGAGGGCAGCAAACGGGAAGAGTCTTCCTTTACGCTCTTCCCGTTTGCTGCCCT
CCTCAAGAAAGAATGC
Real-time quantitative PCR (RT-qPCR)
Ovaries from 14-day-old flies were dissected, and total RNA was extracted using the RNeasy Micro Kit. Equal amounts of RNA were reverse-transcribed into cDNA using the HiFiScript cDNA Synthesis Kit. RT-qPCR was performed on a CFX Connect Real-Time PCR System (Bio-Rad) with ChamQ SYBR qPCR Master Mix. The PCR protocol consisted of an initial denaturation at 95°C for 30 min, followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec. Relative gene expression was calculated using the 2−ΔΔCT method (Livak and Schmittgen, 2001). The primers described previously were used (Huang et al., 2017):
dpp primer-1: TACCACGCCATCCACTCAAC
dpp primer-2: GCTCGTTACTCGATACGGCT
gbb primer-1: CTGGATCATCGCACCAGAGG
gbb primer-2: GTCTGGACGATCGCATGGTT
rp49 (internal control) primer-1: CACCGGATTCAAGAAGTTCC
rp49 (internal control) primer-2: GACAATCTCCTTGCGCTTCT

SGCs appear in egg chambers.
(A, C) Representative samples. The arrows indicate SGCs enclosed within egg chambers. (B) Schematic of the experimental strategy for (C). See also Source data 1.

Monoallelic deletion of dpp or gbb does not affect GSC maintenance, germ cell differentiation, and female fly fertility.
(A-D) Representative samples. (E) Quantification data. 14-day-old flies were used for the analyses. GSCs are germ cells that are located within the niche and contain dot-like spectrosomes. Cystoblasts are germ cells that have exited the niche, remain in contact with GSCs, and maintain dot-like spectrosomes. Cystocytes in germline cysts are germ cells that are characterized by branched fusomes. (F) Fertility test. 3-day-old flies were used for the analyses. For each genotype, three independent replicates were performed. Data represent mean ± SEM, and statistical significance was determined by one-way ANOVA. n.s. (P > 0.05). See also Source data 1 and 2.

dpp bam or gbb bam double-mutant germline tumor cells divide more slowly than bam single-mutant ones.
(A, B, D, and E) Representative samples. The arrows indicate BrdU+ germline tumor cells mutant for bam, dpp bam, or gbb bam. (C and F) Quantification data. 14-day-old flies were used for the analyses. Statistical significance was determined by chi-squared test. See also Source data 1 and 2.

The SGC phenotype is unchanged irrespective of the number of surrounding germline tumors.
(A) Representative samples. The arrows denote SGCs. Both images are of the same magnification. (B) Quantification data for tumor size. Data represent mean ± SEM. (C) Quantification data for the SGC phenotype. In (B and C), 14-day-old flies were used for the analyses. Statistical significance in (B) was determined by t test and in (C) by chi-squared test. n.s. (P > 0.05). See also Source data 1 and 2.
Data availability
All genotypes are described in Source data 1, and the raw quantification data are included in Source data 2. Fly strains and plasmids are available upon request.
Acknowledgements
We thank Eric Baehrecke, Michael Buszczak, Zheng Guo, Ed Laufer, Ruth Lehmann, Weiwei Liu, Rongwen Xi, Ting Xie, Zhaohui Wang, Guojie Zhang, BDGP, BDSC, DSHB, and THFC for providing antibodies, plasmids, fly strains, and technical assistance. This study was supported by grants 32270841 and 32070871 from the National Natural Science Foundation of China (NSFC) to Shaowei Zhao.
Additional information
Author contributions
S.Z. conceived and supervised this study. Y.Z., Y.W., J.S., L.Y., Z.W., D.S., J.W., S.Y., L.N., C.S., H.Z., Y.D.Z., and S.Z. performed the experiments. S.Z. wrote the manuscript and all authors commented on it.
Funding
MOST | National Natural Science Foundation of China (NSFC) (32270841)
Shaowei Zhao
MOST | National Natural Science Foundation of China (NSFC) (32070871)
Shaowei Zhao
Additional files
References
- Epidermal stem cells of the skinAnnu Rev Cell Dev Biol 22:339–373Google Scholar
- Expression of the Sex-lethal gene is controlled at multiple levels during Drosophila oogenesisDevelopment 118:797–812Google Scholar
- Dpp signaling silences bam transcription directly to establish asymmetric divisions of germline stem cellsCurr Biol 13:1786–1791Google Scholar
- Gene circuitry controlling a stem cell nicheCurr Biol 15:179–184Google Scholar
- A discrete transcriptional silencer in the bam gene determines asymmetric division of the Drosophila germline stem cellDevelopment 130:1159–1170Google Scholar
- Three RNA binding proteins form a complex to promote differentiation of germline stem cell lineage in DrosophilaPLoS Genet 10:e1004797Google Scholar
- Canonical Wnt Signaling Promotes Formation of Somatic Permeability Barrier for Proper Germ Cell DifferentiationFront Cell Dev Biol 10:877047Google Scholar
- Third-generation in situ hybridization chain reaction: multiplexed, quantitative, sensitive, versatile, robustDevelopment 145Google Scholar
- Male and female Drosophila germline stem cells: two versions of immortalityScience 316:402–404Google Scholar
- Tales from the crypt: new insights into intestinal stem cellsNat Rev Gastroenterol Hepatol 16:19–34Google Scholar
- Mosaic Analysis in DrosophilaGenetics 208:473–490Google Scholar
- Yorkie and Hedgehog independently restrict BMP production in escort cells to permit germline differentiation in the Drosophila ovaryDevelopment 144:2584–2594Google Scholar
- Differentiation-defective stem cells outcompete normal stem cells for niche occupancy in the Drosophila ovaryCell Stem Cell 2:39–49Google Scholar
- Cancer cell differentiation heterogeneity and aggressive behavior in solid tumorsUps J Med Sci 117:217–224Google Scholar
- An empty Drosophila stem cell niche reactivates the proliferation of ectopic cellsProc Natl Acad Sci U S A 100:4633–4638Google Scholar
- The expression profile of purified Drosophila germline stem cellsDev Biol 283:486–502Google Scholar
- Self-maintained escort cells form a germline stem cell differentiation nicheDevelopment 138:5087–5097Google Scholar
- Localization and function of Bam protein require the benign gonial cell neoplasm gene productDev Biol 212:405–413Google Scholar
- Control of germline stem cell differentiation by Polycomb and Trithorax group genes in the niche microenvironmentDevelopment 143:3449–3458Google Scholar
- Bam and Bgcn antagonize Nanos-dependent germ-line stem cell maintenanceProc Natl Acad Sci U S A 106:9304–9309Google Scholar
- The tao of stem cells in the germlineAnnu Rev Genet 31:455–491Google Scholar
- The Drosophila fusome, a germline-specific organelle, contains membrane skeletal proteins and functions in cyst formationDevelopment 120:947–956Google Scholar
- Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) MethodMethods 25:402–408Google Scholar
- Stem cell fate in cancer growth, progression and therapy resistanceNat Rev Cancer 18:669–680Google Scholar
- The deubiquitinase USP8 targets ESCRT-III to promote incomplete cell divisionScience 376:818–823Google Scholar
- A role for the Drosophila bag-of-marbles protein in the differentiation of cystoblasts from germline stem cellsDevelopment 121:2937–2947Google Scholar
- bag-of-marbles: a Drosophila gene required to initiate both male and female gametogenesisGenes Dev 4:2242–2251Google Scholar
- Ovarian cystocytes can repopulate the embryonic germ line and produce functional gametesProc Natl Acad Sci U S A 100:14042–14045Google Scholar
- The Drosophila cystoblast differentiation factor, benign gonial cell neoplasm, is related to DExH-box proteins and interacts genetically with bag-of-marblesGenetics 155:1809–1819Google Scholar
- Ectopic expression of the Drosophila Bam protein eliminates oogenic germline stem cellsDevelopment 124:3651–3662Google Scholar
- Dissecting social cell biology and tumors using Drosophila geneticsAnnu Rev Genet 47:51–74Google Scholar
- Bmp signals from niche cells directly repress transcription of a differentiation-promoting gene, bag of marbles, in germline stem cells in the Drosophila ovaryDevelopment 131:1353–1364Google Scholar
- Control of satellite cell function in muscle regeneration and its disruption in ageingNat Rev Mol Cell Biol 23:204–226Google Scholar
- Germline stem cellsCold Spring Harb Perspect Biol 3:a002642Google Scholar
- Regulation of zygotic gene expression in Drosophila primordial germ cellsCurr Biol 8:243–246Google Scholar
- Haematopoietic stem cell self-renewal in vivo and ex vivoNat Rev Genet 21:541–554Google Scholar
- decapentaplegic is essential for the maintenance and division of germline stem cells in the Drosophila ovaryCell 94:251–260Google Scholar
- A niche maintaining germ line stem cells in the Drosophila ovaryScience 290:328–330Google Scholar
- Genetic circuitry controlling Drosophila female germline overgrowthDev Biol 515:160–168Google Scholar
- Division promotes adult stem cells to perform active niche competitionGenetics 224Google Scholar
- Autophagy Promotes Tumor-like Stem Cell Niche OccupancyCurr Biol 28:3056–3064Google Scholar
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Reviewed Preprint version 3:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.108910. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2025, Zhang et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 1,042
- downloads
- 66
- citations
- 0
Views, downloads and citations are aggregated across all versions of this paper published by eLife.