Abstract
The circadian clock enables anticipation of the day/night cycle in animals ranging from cnidarians to mammals. Circadian rhythms are generated through a transcription-translation feedback loop (TTFL or pacemaker) with CLOCK as a conserved positive factor in animals. However, CLOCK’s functional evolutionary origin and mechanism of action in basal animals are unknown. In the cnidarian Nematostella vectensis, pacemaker gene transcript levels, including NvClk (the Clock ortholog), appear arrhythmic under constant darkness, questioning the role of NvCLK. Utilizing CRISPR/Cas9, we generated a NvClk allele mutant (NvClkΔ), revealing circadian behavior loss in constant light conditions (LL and DD) while a 24-hour rhythm was maintained under light-dark condition (LD). Transcriptomics showed distinct rhythmic genes in wild-type (WT) genes in LD compared to DD. The LD NvClkΔ/Δ showed comparable numbers of rhythmic genes, but were greatly reduced in DD. Furthermore, the LD NvClkΔ/Δ showed alterations in temporal pacemaker gene expression, affecting their potential interactions. Additionally, differential expression of non-rhythmic genes associated with cell division and neuronal differentiation was observed. These findings revealed that a light-responsive pathway can partially compensate for circadian clock disruption and that the Clock gene has evolved in cnidarians to synchronize rhythmic physiology and behavior to the diel rhythm of the earth’s biosphere.
Introduction
Throughout the history of life on Earth, organisms have had to adapt to a constantly changing environment, including the ∼24-hour daily rhythm of light/dark, driving the development of endogenous biological clocks. The circadian clock, entrained by external stimuli such as light, enables the organism to anticipate the onset of the light and dark phases and synchronize its physiology and behavior in harmony with the environment. This, in turn, enhances the organism’s fitness and survival1–3. From single-celled organisms to metazoans, circadian clocks have evolved multiple times, highlighting their importance to living organisms1,2. Despite the fundamental role circadian clocks play in regulating the rhythmicity of living organisms, their evolutionary origin and intricate molecular mechanisms remain ambiguous in early diverging animal lineages, such as cnidaria.
Rhythmic phenomena, including calcification, reproduction, and diel behavior patterns, have been examined in cnidarian species3–8. While environmental stimuli, such as light, directly triggered some of these patterns, others persist in the absence of external cues, suggesting the presence of an internally generated and self-sustaining circadian clock6,9,10. At the molecular level, cnidarians possess homologs of putative core pacemaker genes found in bilaterians11–13. Several studies have shown that most of these genes display diel expression patterns under light/dark cycles. However, unlike most animals, their oscillation generally ceases without light cues14–16. Thus, how the core pacemaker genes orchestrate rhythmic gene expression and circadian behaviors in cnidarians remains unclear.
One of the most studied cnidarian species in the field of chronobiology is the estuarine sea anemone, Nematostella vectensis. Few studies have shown that in diel lighting, the locomotor behavior of Nematostella has a ∼24-h rhythm that is maintained under constant conditions, suggesting it is regulated by an endogenous circadian clock6,17–19. By this, the Nematostella genome codes for conserved core pacemaker genes such as NvClk, NvCycle, and the cryptochromes NvCry1a and NvCry1b12,13. The proposed circadian clock model in Nematostella is composed of the positive transcription factors (bHLH-PAS family), NvCLK and NvCYCLE, that heterodimerize and upregulate light-dependent cryptochrome genes in the feedback loop, and NvPAR-bZIPs in the feed-forward loop, which repress the transcription of the positive elements11,12,19. More recently, the NvCLK-interacting pacemaker, NvCIPC, was predicted to act as an additional repressor of the NvCLK:NvCYCLE dimer19. However, in contrast to the free-running oscillation demonstrated for Nematostella behavior6,17,19, transcriptional expression profiles of most candidate genes implicated in the pacemaker do not retain their oscillation period without light14,15,19.
We employed the CRISPR/Cas9-mediated genome editing system to establish a NvClk mutant (NvClkΔ/Δ) Nematostella. By combining behavioral monitoring and transcriptomic analysis, we aimed to elucidate the role of NvClk in regulating rhythmic locomotor activity and gene expression under varying light conditions. Our study revealed a robust light response pathway capable of compensation and a conserved function of CLOCK as a timekeeper without a light cue.
Results
Phylogenetic analysis and spatial expression pattern of NvClk
Phylogenetic analysis of NvCLK protein sequences positioned NvClk within the cnidarian branch (Fig. 1a). It contains a basic helix–loop–helix (bHLH) DNA binding domain and two Per-Arnt-Sim (PAS) domains, similar to the protein structure found in other animals. PAS domains are crucial structural motifs in protein-protein interactions that drive the self-sustaining molecular mechanism underlying the circadian clock20,21.

NvClkΔ/Δ cannot maintain circadian behavior in non-diel light conditions.
(a) Phylogenetic tree showing the evolutionary relationship of CLK orthologs across different animal species. (b) In situ hybridization of NvClk in the WT juvenile with scale bars representing 0.1mm. (c) Schematic representation of the NvClk gene in grey, with the open reading frame (ORF) in dark grey and the conserved protein domains bHLH (yellow) and PAS1 and PAS2 (dark red). The CRISPR-generated NvClkΔ allele has a +20nt insertion after the PAS1 domain, represented by a black arrowhead. NvCLK dimerizes via its three functional domains with NvCYCLE binding the CACGTG ebox to drive rhythmic transcription. (d-g-j-m). Normalized Movement (a.u), hourly binned over 72h, under different light conditions: 12h light:12h dark, continuous dark (Dark - Dark), continuous light (Light - Light), and 6h light:6h dark. The black line represents the WT, and the red line represents the NvClkΔ/Δ mutant. (e-h-k-n) Lomb-Scargle Periodograms for each corresponding light condition. The significant period value (p<0.01) is indicated for each genotype in the top left corner of each graph. (f-i-l-o) Phase detection (Cosinor) and genotype comparison of 24h rhythmic individuals. See the number rhythmic/total on the x-axis indicating the number of 24h-rhythmic animals over the total population for each genotype.
In situ hybridization chain reaction (HCRv.3) was performed to localize NvClk expression at the polyp stage. Polyps were sampled at ZT10, i.e., peak expression of NvClk6,12,22. NvClk mRNA expression was observed throughout the animal tissue, and enriched expression was visible in the tentacle endodermis and mesenteries. In contrast, no signal was observed in the negative control (Fig.1b, Extended Data Fig.1a). This expression pattern resembled the expression observed at the larvae stage22. To date, functional manipulation of the NvClk gene has not been performed in basal animal lineages including, cnidarians, and its function is unknown in cnidarians20,21 (Fig.1a).
Generation of NvClkΔ/Δ Nematostella
To investigate the function of NvClk in Nematostella, we employed the CRISPR-Cas9 system to generate mutants. Based on existing knowledge from mouse and Drosophila models, we hypothesized that NvCLK:NvCYCLE dimer binds to the DNA motif CACGTG within the promoter of rhythmic target genes (Fig. 1c). Guide RNA (gRNA) was synthesized to target a region between the two PAS domains of the NvClk coding sequence (CDS). This gRNA and the Cas9 endonuclease were microinjected into zygotes (Methods). Subsequently, F0 animals were outcrossed with wild type (WT), and the F1 progeny were raised to adulthood. Genotyping of F1 polyps identified ten different mutated alleles, with six displaying a frame-shift mutation, including one with a 20 bp insertion (NvClkΔ), resulting in a premature stop codon (Extended Data Fig. 1b). The predicted 203 amino acid truncated protein lacked 459 amino acids, including one co-factor dimerization PAS domain (Fig. 1c, Extended Data Fig. 1b). To obtain homozygous NvClkΔ/Δ polyps, we crossed heterozygous NvClkΔ F1 animals. Genotyping of F2 polyps confirmed the expected 25% frequency of NvClkΔ/Δ mutants. Subsequently, we intercrossed NvClkΔ/Δ animals to obtain F3 NvClkΔ/Δ polyps for use in subsequent experiments aimed at assessing the role of NvClk in regulating behavioral and genetic rhythms.
NvClk is necessary to maintain circadian behavior in constant conditions
To assess the impact of the NvClkΔ mutation on circadian rhythm, we monitored the locomotor behavior of WT and NvClkΔ/Δ polyps under different light conditions (Supp. Table 1). Both the WT and NvClkΔ/Δ populations exhibited a 24-hour periodicity in 12:12 hour Light-Dark (LD) cycles (Fig. 1d, e), with 15 out of 21 WT animals displaying 24-hour rhythmicity compared to only 9 out of 20 NvClkΔ/Δ animals (Fig. 1f, Table 1, Supp. Table 2). The average acrophase for WT polyps (13.3 hours) was significantly earlier than for NvClkΔ/Δ polyps (17.3 hours) (Fig. 1f, Table 1). While we could detect a 24-hour rhythm for both genotypes, the delayed acrophase and reduced number of significant rhythmic polyps in the NvClkΔ/Δ suggest an alteration of the underlying rhythmicity mechanism.

Summary of rhythmic analysis of individual behavior.
We then investigated locomotor behavior under continuous conditions, namely continuous dark (DD) or continuous light (LL). WT polyps exhibited a 22-hour rhythmic behavior under both constant light conditions, with 17 out of 25 WT polyps displaying a 24-hour rhythm under DD and 7 out of 25 under LL (Fig. 1g-l). In contrast, a few NvClkΔ/Δ polyps displayed rhythmic behavior under constant conditions (1 out of 24 in DD and 1 out of 26 in LL) (Table 1). Additionally, we observed an intermediate phenotype in the locomotor behavior of heterozygous polyps for the NvClkΔ allele in DD (Extended Data Fig. 1c-f). These results revealed that NvClkΔ/Δ polyps could not maintain circadian rhythmicity without diel light cues.
A 24-hour rhythm of NvClkΔ/Δ polyps under LD conditions could be attributed to either direct light response or the partial functioning of the circadian clock due to the nature of the mutation. To distinguish between these two possibilities, we monitored locomotor activity under a 6-hour light: 6-hour dark (LD 6:6) cycle after a regular diel 72-hour entrainment under 12:12 LD. While WT polyps maintained a marginally significant periodicity of 22 hours, NvClkΔ/Δ polyps displayed a 12-hour rhythm at the population level (Fig. 1m-o). Specifically, we identified a clear difference of 12-hour rhythmic individual polyps between WT and NvClkΔ/Δ groups (1 out of 25 WT polyps vs. 13 out of 26 NvClkΔ/Δ polyps) (Table 1). Notably, entrainment with LD 6:6 did not lead to a 12-hour rhythm in DD for both WT and NvClkΔ/Δ polyps (Extended Data Fig. 1g-i). These results support the hypothesis that the 24-hour rhythm observed in the NvClkΔ/Δ polyps in LD condition is due to the light-response pathway and not from an endogenous oscillator.
NvClk regulates rhythmic gene expression differentially in response to light conditions
We conducted transcriptional profiling to investigate the underlying molecular correlates of the behavioral phenotype found in NvClkΔ/Δ polyps. WT and NvClkΔ/Δ polyps were sampled seven times every 4 hours over 24 hours under LD and DD conditions (Fig. 2a). To identify rhythmic genes, we employed stringent statistical parameters, including Benjamini-Hochberg (BH.Q) for the JTK method23 and adjusted p-value (p.adj) for the RAIN method24. This resulted in the identification of a minimal number of rhythmic genes. We detected only six rhythmic genes under LD conditions in WT polyps using the JTK method and 40 rhythmic genes using the RAIN method (Supp. Table 3). In DD condition, in the WT polyps, only two rhythmic genes were identified using the RAIN method (Supp. Table 3). Despite the risk of false positives, we opted not to use multiple testing but instead proposed to combine the JTK and RAIN algorithms to identify rhythmic genes, ensuring a robust approach to data analysis (p<0.01). We identified 119 rhythmic genes rhythmic under LD and 107 rhythmic genes under DD in WT polyps (Fig. 2b, Supp. Table 3). In NvClkΔ/Δ polyps, we detected 147 rhythmic genes under LD and only 37 under DD (Fig. 2b, Supp. Table 3).

NvClkΔ/Δ shows rhythmic gene reduction in constant darkness with altered rhythmic features.
(a) Overview of the experimental design used to generate RNA-seq data. Polyps were entrained for 72 hours before sampling at 4-hour intervals over a 24-hour period (dark arrows) in both LD and DD cycles. (b) Venn diagram comparing the total number of 24h rhythmic genes identified in WT and NvClkΔ/Δ in LD and DD cycles with a p <0.01 with RAIN and JTK. (c) Average acrophase comparison between rhythmic genes in LD and DD in WT polyps. Mann-Whitney test, p<0.001. (d) Average acrophase comparison between rhythmic genes in LD and DD in NvClkΔ/Δ polyps. Mann-Whitney test, p>0.05. (e) Average relative amplitude comparison between rhythmic genes in LD and DD in WT polyps. Mann-Whitney test, p<0.05. (d) Average relative amplitude comparison between rhythmic genes in LD and DD in NvClkΔ/Δ polyps. Mann-Whitney test, p>0.05. (c-f) sample size (n) indicated below each boxplot.
The rhythmic genes in WT polyps displayed a delayed acrophase under DD compared to LD (17.20h vs. 12.93h, Fig. 2c). However, no differences were detected between LD and DD rhythmic genes in NvClkΔ/Δ polyps (Fig. 2d). Similarly, the relative amplitude (the gene amplitude divided by its baseline, rAMP) of DD rhythmic genes was higher in WT polyps compared to LD (0.61 vs. 0.43, Fig. 2e), but no rAMP difference was observed between LD and DD rhythmic genes in NvClkΔ/Δ polyps (Fig. 2f).
Are rhythmic genes organized into “transcriptional time clusters”? Does the NvClkΔ mutation modify cluster recruitments, causing the loss of rhythmic behavior under DD conditions? We performed a clustering analysis on the rhythmic genes using the DPGP model (Dirichlet process Gaussian process mixture model). The number of genes per cluster between LD and DD conditions in WT polyps did not differ significantly (7.3 vs. 7.6, Extended Data Fig. 2a, Supp. Table 4). Interestingly, when clusters are organized by their acrophase, we observed clusters with higher numbers of genes peaking at subjective night in WT under DD conditions (Extended Data Fig. 2b, Supp. Table 4). In NvClkΔ/Δ polyps, the number of genes per cluster was significantly reduced in DD compared to the LD condition (4.1 vs. 8.6, Extended Data Fig. 2c,d). We did not identify GO-term enrichment in any cluster. However, the overlap between clusters and behavior opens new directions for further functional analysis (Extended Data Fig. 3b,d and Supp. Table 4). Overall, the reduced number of rhythmic genes in NvClkΔ/Δ polyps under the DD condition and the reduced number of genes per cluster confirm the necessity of NvClk to recruit rhythmic genes in the DD condition and to organize them in transcriptional time clusters.
NvClk regulates the temporal expression pattern of pacemaker genes
In line with previous findings in Nematostella12,14, candidate pacemaker genes showed arrhythmic expression under DD conditions (Fig. 3a, Supp. Table 3). However, the altered expression patterns observed in NvClkΔ/Δ compared to WT polyps in LD condition showed increased transcripts for some genes (i.e., NvClk and NvPar-bzipd). In contrast, others (NvCipc and NvPar-bzipc) exhibited a reduction in transcript numbers (Fig. 3a, Supp. Table 3). If we hypothesize that the first two genes (NvClk and NvPar-bzipd) act as positive factors and the latter two (NvCipc and NvPar-bzipc) potentially serve as negative regulator of the former, the lack of functionality of the NvClkΔ allele would explain the observed difference in transcript levels between NvClkΔ/Δ and WT polyps.

NvClkΔ/Δ alters temporal pacemaker gene expression.
(a) Four pacemaker genes are plotted, showing the read counts over 24h in LD and DD in WT (black) and NvClkΔ/Δ (red). The continuous line represents significant rhythmicity (RAIN&JTK p<0.01), while the dashed line indicates no rhythmicity. (b) correlation matrix of candidate pacemaker genes expression in LD for WT on the left and NvClkΔ/Δ on the right. (c) schematic representation of the promoter sequences analyses 5kb upstream of the putative ATG. Black boxes represent canonical E-boxes, while circadian E-boxes are green. Below is the logo motif we used to identify canonical and circadian Ebox. (d) Circadian / Canonical ratio (in %) per condition. Kruskal-Wallis, multiple comparison, a vs b : p<0.05.
To systematically assess the mutation’s impact on all the potential pacemaker genes, we utilized a correlation matrix based on their temporal transcript number levels, offering a comprehensive overview of their temporal organization. In WT polyps under LD conditions, the clustering categorized genes into two groups: one exhibiting a daytime peaking, containing NvClk, and another peaking at night comprising NvPar-bzipc and NvCipc. Notably, in LD NvClkΔ/Δ polyps, this second cluster contained two additional genes and displayed a weakened anticorrelation with the NvClk cluster (Fig. 3b). These observations suggest that the pacemaker oscillation, generated by the interplay of positive and negative feedback loops, relies on the precise temporal organization of these potential pacemaker factors into distinct clusters. The disruption of this organization by the NvClkΔ allele underscores the central role of NvClk in pacemaker function.
To go further into the regulatory mechanisms downstream of the pacemaker, we examined the presence of circadian E-box motifs (CACGTG) within 5kb upstream of the predicted ATG of rhythmic genes. We calculated circadian/canonical E-box enrichment to account for the total variation in the number of canonical E-boxes (Fig. 3c). Notably, only the candidate pacemaker genes exhibited a significant enrichment in circadian E-boxes in their promoters (15.9%) compared to the WT (5.6%), NvClkΔ/Δ (4.8%) rhythmic genes, and non-rhythmic genes (6.8%) (Fig. 3d).
NvClk coordinates cell division and neuronal pathways in constant darkness
In addition to the transcriptomic rhythmic analysis, we aimed to identify processes regulated by NvClk that may not necessarily exhibit rhythmicity. We conducted a differential gene expression analysis on the total transcriptome between genotypes under each light condition to achieve this. Under LD conditions, NvClkΔ/Δ polyps exhibited 457 down-regulated genes and 646 up-regulated genes, with no significant enrichment in GO terms observed (Fig. 4a, Supp. Table 4 and 5). However, in DD conditions, NvClkΔ/Δ displayed 2450 down-regulated genes and 1770 up-regulated genes (Fig. 4b, Supp. Table 4). Notably, we identified enrichment in down-regulated genes in processes related to mitosis, microtubules, and ciliary/flagellar motility. Conversely, the up-regulated genes showed significant enrichment in processes such as the modulation of another organism’s processes, axonal guidance, and sensory perception (Fig. 4b, Supp. Table 5).

NvClkΔ/Δ disrupts cell-cycle and neuronal pathways in constant darkness.
(a) Volcano plot showing the differential expression of genes (DEG) between WT and NvClkΔ/Δ in LD (Left) and DD (right). Dashed line indicates the threshold used to detect DEG (p.adj<0.01). Red dots indicate down regulated genes and black dots up-regulated genes in NvClkΔ/Δ compare to WT polyps (b) Gene Ontology (GO) terms with with significant fold-enrichment (Bonferroni corrected p-value or p.adjusted <0.01) for the DEG analysis in DD. Down regulated genes in Red while Up regulated genes in Black.
Discussion
Conserved behavioral CLOCK function through animal evolution
Our study provides valuable insights into the evolution of circadian clocks by characterizing the effects of the first Clock mutation in a cnidarian, the sea anemone Nematostella vectensis. Our behavioral assays showed that NvClk is essential for maintaining rhythmic locomotor activity without an entraining light cue. Although the rhythmicity of the NvClk+/Δ heterozygote polyps was affected in DD, our results could not discriminate a dominant-negative from a total loss of function to identify the nature of this mutation (Extended Data Fig. 1g-i). Studies in various model organisms further support the importance of CLOCK in regulating circadian locomotion. For instance, DmClkar/ar flies exhibit a loss of circadian locomotion in constant darkness25, while the DnClk1adg3/dg3 zebrafish mutant displayed a shortened period under the same conditions26. The dominant-negative mutant MmClock Δ5–6/Δ5–6 mice showed a loss of circadian locomotion in constant darkness, however the complete deletion of the MmClock gene did not affect the circadian behavior rhythm in constant darkness suggesting compensation by a paralog27–29. Overall, these findings support a conserved role of CLOCK in preserving circadian behavioral rhythms in the absence of light cues across the distant Nematostella, flies, zebrafish, and mice.
Moreover, the conservation of a 24-hour locomotion rhythm in LD of the NvClkΔ/Δ polyps with a delayed acrophase revealed a light-response pathway independent of the circadian circuit, consistent with observations in other animal models25,27,30 (Fig. 1f). NvClkΔ/Δ polyps exposed to a 12:12h LD cycle exhibited a 24-hour period. In contrast, those exposed to a 6:6h LD cycle displayed a 12-hour period. Notably, nearly no WT polyps exhibited a 12-hour rhythm under this condition, suggesting that the circadian clock overrides the light-response pathway (Fig. 5a). While some of the circadian factors can directly sense the light, such as CRY proteins31, 29 putative NvOpsin have been identified in the genome which could be involved in the light-response pathway32. Behavioral tracking of NvClkΔ/Δ polyps exposed to different wavelengths could help to identify candidates for further functional studies of the light-response pathway.

Summary of NvClk function in the regulation of Nematostella circadian rhythmicity.
Transcriptional rhythmicity plasticity downstream NvClk
At the transcriptomic level, previous studies in Nematostella have shown large changes in the transcriptional profile of many genes after a single day of constant darkness, including the candidate pacemaker genes that were found arrhythmic despite sustaining circadian locomotion12,14,22. Consistent with previous transcriptomic analysis in cnidarian7,14,16,33, most of the rhythmic genes identified in LD differed from those identified in DD in the WT polyps. Notably, they displayed higher mean acrophase and larger mean amplitude in DD, suggesting a differential regulation in response to light conditions, which had not been investigated in previous cnidarian studies. Furthermore, the overlap observed between our LD rhythmic genes and those identified by Leach et al.14 underscores the robustness of pacemaker rhythmic transcription in LD conditions (Extended data Fig. 3). However, the lack of overlap for rhythmic genes raises intriguing questions. Differences in experimental conditions, including genetic backgrounds, light system (Neon vs. LED), salinity (12ppt vs. 15ppt), and temperature (17°C vs. 25°C), may contribute to these discrepancies. Further investigations are necessary to determine if the lack of overlap of rhythmic genes downstream of the potential pacemaker genes results from an organism’s adaptation to its environment and, therefore, reflects the plasticity of the pacemaker in regulating its downstream rhythmic genes.
Our study identified 24-hour rhythmic behavior in NvClkΔ/Δ polyps under LD conditions, suggesting an alternative mechanism for generating molecular rhythmicity via the light-sensing pathway. However, it is crucial to note minimal overlap between the rhythmic genes identified in NvClkΔ/Δ and WT polyps under LD conditions. This discrepancy indicates that the light-response pathway may not fully replicate the normal pacemaker functions observed in WT polyps, highlighting the need for further investigation into the recruitment and function of these genes. Additionally, the reduced number of rhythmic genes identified in NvClkΔ/Δ polyps under the DD condition underscores the crucial role of NvClk in maintaining molecular rhythm without light cues.
The clustering analysis revealed that rhythmic genes can be categorized into “transcriptional time clusters” (aka synexpression clusters)16,34 by group of seven/eight genes in average in the WT (Fig. 5b). Their existence raises a fundamental question that has yet to be answered: How is a group of genes co-regulated in time and space (cell types) by the pacemaker? Their recruitment is disrupted in the DD NvClkΔ/Δ polyps suggesting an essential function of NvClk in absence of light. The combination of published scAtlas35 and multiplexed FISH techniques36 will be essential to further investigate the biological regulation and function of these transcriptional time clusters.
NvClk temporally organizes pacemaker gene expression to drive rhythmic gene recruitment
Our study reveals that NvClk plays a crucial role in regulating the temporal transcription of pacemaker candidate genes (Fig.3a). Our analysis identified two clusters of pacemaker genes: One containing NvClk and a second one containing a potential NvClk inhibitor (NvCipc)37,38. These two clusters suggest the organization of the potential pacemaker genes transcription into interlock feedback loops with antiphase peaks, probably at the origin of the pacemaker oscillator function21,39,40. The alteration of cluster composition with a weaker anticorrelation in LD NvClkΔ/Δ polyps might generate a desynchronization of the pacemaker factors’ availability. Indeed, regulation of rhythmic transcription involved a complex protein-protein-DNA timing interaction. Furthermore, we did not identify any circadian E-boxes enrichment in rhythmic genes between conditions, except for the candidate pacemaker genes. Altogether, this supports the function of NvClk in orchestrating the timing interaction of pacemaker factors to select downstream rhythmic genes, indicating a more complex regulatory landscape at play.
However, one significant unanswered question in our study is the reason for the arrhythmic transcription of putative pacemaker genes in DD. Using whole animals for sampling material might mask oscillating gene expression signals, especially if signals are present in a small number of cells or if tissues exhibit rhythmic gene expression in different phases. Furthermore, we must acknowledge a limitation in our interpretation, which is common in chronobiology: using RNA oscillation as a proxy for protein oscillation and function. The development of tools to study the pacemaker factors at the protein level in Nematostella will leverage this limitation in the field.
NvClk regulates processes involved in cell proliferation and the neural system in the absence of light
Our study of NvClk suggests coordination of cellular processes, especially in the absence of light. Our rhythmic transcriptomic analysis results (Fig. 2 and Extended data Fig. 2) raised questions regarding indirect effects and the non-rhythmic function of NvClk. We performed a differential gene expression analysis on the total transcriptome for each light condition. Under LD conditions, while NvClkΔ/Δ polyps exhibited significant changes in gene expression, we could not identify any GO term enrichment (Fig. 4a, Supp. Table 5), revealing multiple altered processes we cannot yet identify.
In contrast, under DD conditions, NvClkΔ/Δ polyps displayed more pronounced alterations, with more DEGs and enriched GO-terms for down-regulated genes related to mitosis, microtubule organization, and ciliary/flagellar motility, while the up-regulated genes showed enrichment in processes such as the modulation of other organism’s processes, axonal guidance, and sensory perception (Fig. 4b, Supp. Table 5). These results imply that NvClk has non-circadian functions dependent on light availability. This is particularly noteworthy considering the expression of core pacemaker genes, known to be arrhythmic during larvae stages, potentially involved in developmental processes22.
This study provides novel insights into circadian regulation in Nematostella vectensis and sheds light on the evolutionary origin of circadian time maintenance. Our findings indicate that CLOCK function is conserved from cnidaria to mammals to maintain rhythmicity without diel light cues. Furthermore, it revealed a light-response pathway able to compensate at both behavioral and molecular levels using light cues. This circadian clock mutant opens new avenues for investigating cell-type-specific mechanisms of the circadian clock that drive the molecular and phenotypical oscillations of cnidarians. By further exploring the circadian clock mechanisms in cnidarians, we can gain deeper insights into the evolutionary origins of this critical aspect of biology, enhancing our understanding of how organisms have evolved to keep track of time and adapt to their environment.
Supporting information
Methods
Animal husbandry
Nematostella were grown in 12g.L sea salt water at 17°C, and fed with Artemia salina nauplii three times a week. Spawning of gametes and fertilization was performed according to a published protocol41. In brief, temperature was raised to 25 °C for 9 h and the animals were exposed to strong white light. Three hours after the induction, oocytes were mixed with sperm to allow fertilization.
CRISPR/Cas9 mediated mutagenesis
Genome editing in Nematostella was carried out following established CRISPR/Cas9 protocols, with slight modifications42,43. ZiFiT targeting software (http://zifit.partners.org/)44 was used to select a guide RNA (gRNA) target site within the beginning of the NvClk exon and to design complementary oligonucleotides. To ensure specificity of the gRNA, the selected target site sequence (GGTCCTCTCGTGGACTCTAC) was BLASTed against Nematostella vectensis genome (using JGI expected E value threshold of 0.1 to adjust for short sequences: http://genome.jgi.doe.gov/Nemve1/Nemve1.home.html). To generate the gRNA template, the following oligonucleotides were used:
Oligo 1: 5’- TAGGTCCTCTCGTGGACTCTAC -3’
Oligo 2: 5’- AAACGTAGAGTCCACGAGAGGA -3’
To construct the gRNA expression vector, pDR274 (plasmid # 42250; Addgene) was digested with the BsaI restriction enzyme. Subsequently, the gRNA oligonucleotides were annealed and cloned into the BsaI-digested pDR274 vector. Next, DraI-digested gRNA expression vectors, purified via ethanol precipitation followed by PureLink PCR purification kit (Invitrogen), were transcribed and purified using HiScribe T7 High Yield Transcription Kit (New England BioLabs) and illustra Microspin G-50 Columns (GE Healthcare Life Sciences), respectively. Cas9 recombinant protein with nuclear localization signal (260 ng/μl; PNA Bio, USA) was co-injected with the gRNA (140ng/µl) into Nematostella zygotes. Injected embryos were raised in petri dishes at 22°C under constant darkness with daily water changes.
CRISPR/Cas9 mediated mutagenesis screening
To evaluate genome editing efficiency and mosaicism in F0 animals, genomic DNA flanking the guide sequence was amplified and Sanger sequenced. PCR was performed using two strategies. For the first, PCR reactions were performed using individual injected Nematostella (7-days post-fertilization), directly pipetted into a 25-μl PCR reaction containing a 2x concentration of PCR MasterMix (Tiangen) and 10 pmol of each PCR primer. For the second, genomic DNA was extracted from tissue sampling from live adult animals, after relaxation in 7% MgClphy2 (Sigma-Aldrich), using NucleoSpin Tissue DNA purification kit (MACHERY-NAGEL). Subsequent PCR reactions were performed as above using 50-ng of genomic DNA. The primers used for these reactions (listed below) were designed to amplify a ∼750bp region around the targeted NvClk genomic locus. Mosaicism was determined if sequenced PCR products showed overlapping peaks in their chromatograms. The second strategy, which takes advantage of the ability of Nematostella to fully regenerate within a few days45,46, is the one we refer to in the text hereafter. The injected individuals determined mosaic mutants were raised as F0 founders to sexual maturity and outcrossed with wild-type animals. The progeny of these crosses was raised and individually genotyped as described above. To determine inheritable mutations, sequences were further analyzed using the Tracking of Indels by DEcomposition web-tool (TIDE). TIDE quantifies editing efficiency and identifies the predominant types of DNA insertions and deletions (indel) mutation composition from a heterogeneous PCR product compared to a wild-type sequence47. Different heterozygous mutants were raised to sexual maturity and outcrossed with wild-type animals. The resulting F2 progenies were then raised to sexual maturity and genotyped before spawning for F3. Heterozygous mutants from each F2 progeny were intercrossed to obtain 25% homozygous F3 mutants. All animals used in this study are derived from heterozygous F2 mutants intercrosses, harboring the mutant allele NvClkΔ. PCR genotyping was performed using the following primer:
Forward 5’- GATAAACACGGGCCGAAGATA -3’
Reverse 5’- CAGTCCACGCTGGTCTAAAT -3’
Determination of NvClkΔ F3 mutant genotypes
Genomic DNA was extracted as described above and used for following PCR and electrophoresis-based genotyping. PCR primers (listed below) encompassing the NvClk targeted site were used to produce PCR products of approximately 100 bp. The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour. The genotype of each F3 animal was determined by visualizing differences in migration speed of the PCR products caused by the CRISPR/Cas9 genome editing. The homozygous mutant animal (NvClkΔ/Δ) produces only the larger ∼120 bp amplicon while the wild-type animal (NvClk+/+) produces only the lower ∼100 bp amplicon. Animals heterozygous for the deletion (NvClk+/Δ) produce both the larger mutant and the smaller wild-type amplicons. PCR genotyping was confirmed by subsequent DNA sequencing of selected F3 animals.
PCR was performed using the following primer:
Forward 5’- ACCCCACTGAGTGACCTCTT -3’
Reverse 5’- ATACGCCTGCGCTATACACC -3’
Behavioral assays
Locomotor activity of individual Nematostella were monitored using a lab-made setup equipped with an IP Infra-Red camera (Dahua Technology, Hangzhou, China), a white neon illumination (Aquastart8, Sylvania Lightning Solution,) and constantly illuminated with low-intensity infrared (850nm) LED light. The camera output 1h mp4 movie files which were AVI converted then stitched. The data collection and analysis were carried out by EthoVision XT8 video tracking software (Noldus information technology, Wageningen, Netherlands). Animals were isolated in wells of six-well plates, each of which was manually defined as a tracking ‘arena’ in the EthoVision software. Center-point detection with gray scaling (detection range of 25–77, contour erosion of 1-pixel, high pixel smoothing) was used to monitor movements, which were calculated according to the change in position of the average center pixel each second.
Illumination was provided with an intensity of 17 PPFD (+/−2) and did not significantly affect the experimental temperature (20 °C). The illumination cycles were 12: 12 h Light-Dark, 6: 6h Light-Dark or continuous light (LL). Parameters were optimized to ensure that organisms were detected throughout the entire observation period.
Behavior analysis
The total distance moved was summed in hourly bins and individually normalized min/max by the software GraphPad Prism 9.4. The average and standard errors were calculated for all tested animals based on the normalized values of each hour. The oscillation frequencies of the average population were evaluated based on the average values of each experiment using Fourier analysis-based software LSP with a p<0.01. For individual analysis we used the online platform Discorythm, combining different algorithms including Cosinor, JTK and LSP48. We chose Cosinor it is the one designed to detect efficiently the acrophase.
RNA-seq experimental design
All polyps were isolated in wells of six-well plates. Then, they were subjected to the 12: 12h LD cycle with 17 PPFD (+/−2) light intensity during 72 hours for entrainment in an incubator with a stable temperature at 18°C. Subsequently, the polyps were divided into 2 experimental subgroups: 12: 12h LD and Continuous Dark or DD. Sampling began at 7 am (ZT0) and was performed at 4-hour intervals over 24 hours. At each time point, three or four individual polyps were sampled from each experimental group, immediately snap-frozen in liquid nitrogen, and transferred to − 80°C for storage.
RNA extraction, library preparation, and sequencing
Total RNA was extracted from all sampled polyps (n = 96) using TRIzol reagent (Invitrogen). Purified RNA samples were analyzed using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific) to assess RNA quantity and 2200 TapeStation (Agilent) to assess RNA quality (RNA integrity number, >8.5). From each of the 96 samples (4 biological replicates in LD and 3 in DD, with the highest-quality extracts × 4 experimental subgroups × 7 time points, 1.5 μg of RNA was sent for library preparation (INCPM mRNAseq protocol) and sequencing at the Weizmann Institute Sequencing Unit, Israel. The libraries were sequenced using the bulk MARS-seq protocol (Jaitin et al. Science, 2014, Keren-Shaul et al., Nature Protocols,2019) on an Illumina NovaSeq 6000, resulting in an average of 17 million single-end reads of 113 bases per sample.
Bioinformatic analysis
First, the unique molecular identifier (UMI) sequence of each read was extracted and placed within the read1 header file using UMI-tools extract (umi_tools v1.1). Next, the reads were mapped onto the Nematostella genome (NCBI genome GCA_000209225.1) using STAR (v2.6.0a) (Dobin et al., 2013) with default parameters. Mapped reads were then deduplicated based on UMIs using the umi_tools dedup. The mapped reads were sorted by SAMtools (version 1.9). The number of reads per gene were quantified using HTSeq-Count (v0.12.4) (Anders et al., 2015).
Rhythmicity analysis
Rhythmicity in transcript expression was assessed using the RAIN (ref-23) and metacycle (Wu et al., 2016) packages in R. The RAIN and JTK algorithms from metacycle were run separately for each Nematostella genotype in both light conditions (LD and D D), treating them as individual datasets. All replicates (n=3) for each time point within a dataset were analyzed as regular time series to identify transcripts exhibiting daily oscillations. Specifically, we focused on transcripts with a precise 24-hour period, excluding those with a range (e.g., 10 to 14 or 20 to 28 hours). To improve the accuracy of identifying true rhythmic genes, only transcripts with a P value < 0.01 in both RAIN and JTK analyses were deemed confidently cycling transcripts. Genes identified as significant cycling genes were subsequently utilized as input for the DPGP_cluster program (McDowell et al., 2018), which clusters genes based on their expression trajectories. Gene clusters comprising 10 or more genes underwent testing for GO term enrichment. Heatmaps were generated using the heatmap package (v4.5.5) in R. Venn diagrams were generated using the web tool Venn diagram (http://bioinformatics.psbugent.be/webtools/Venn/) And redraw with Inkscape. Expression plots were generated using GraphPad Prism (V.9.1).
GO term enrichment analysis
After obtaining the differential gene expression results, Gene Ontology (GO) analysis was performed using the R TopGO package (v2.50.0).This analysis aimed to identify significantly enriched biological processes, cellular components, and molecular functions among the differentially expressed genes. The file “nveGenes.vienna130208.GO_annotation_141017.txt” was utilized for GO analysis, and it was obtained from the following source: https://figshare.com/articles/dataset/Nematostella_vectensis_transcriptome_and_gene_models_v2_0/807696. This file contains the set of GO-transcript annotations that served as input for TopGO. The algorithm assigns a significance score to each GO term based on the enrichment p-value and the specificity of the term. In this study, the GO analysis was performed separately for the up-regulated and down-regulated genes in each condition (LD and DD) to identify the specific biological processes and molecular functions that are affected by the NvClkΔ mutation.
E-box motif enrichment analysis
Sequences for promoter regions (5000kb upstream ATG) of differentially expressed genes were extracted. We manually identified in the list of motif enrichment all the E-box motifs and Circadian E-box motifs. Boxplot were generated using GraphPad Prism version 9.5.1.
Differential Expression Analysis
Differential expression analysis was performed using R (v4.2.2) Bioconductor package, DESeq2 (v1.38.3)49. Raw read counts were obtained using HTSeq-Count (v0.12.4)50 and then imported into DESeq2 for normalization and statistical analysis. Differentially expressed genes were identified using the Wald test with an adjusted p-value cutoff of 0.05. The analysis was performed on all the time-points pooled of each genotype per light condition. The output of the analysis includes a list of genes with their log2 fold change, p-value, and adjusted p-value. Volcano-plots were generated using GraphPad Prism version 9.5.1.
HCR v.3 in situ hybridization
A custom NvClk (NVE2080, amplifier: B3 and B5) and NvMyhc-st probe set (NVE14552, amplifier: B5) were generated. We used zfHcrt probe set (ZDB-GENE-040324-1, amplifier: B1 and B3) as a negative control. For HCR on Nematostella juvenile, several alterations were made to a previously described protocol36. Briefly, polyps were plucked and fixed in 4% PFA overnight at 4°C. Polyps were washed 3× in 1× PBS and then dehydrated and permeabilized with 2×5 min washes in 100% methanol. The samples were stored at –20°C overnight. To rehydrate the samples, a series of graded MeOH/PBST washes were used for 5 min each: 75% MeOH:25% 1× PBST, 50% MeOH:50% 1× PBST, 25% MeOH:75% 1× PBST, and finally 2× washes in 100% 1× PBST. To further permeabilize the polyps, samples were incubated in 10 μg/ml Proteinase K diluted in 1× PBST for 10 min. Samples were quickly washed 3× in 1× PBST, and then post-fixed with 4% PFA for 10 min. After post-fixation, samples underwent 3×5 min washes with 1× 2xSSC+0.1% Triton. From now, the following solutions (Pre-hybridization, hybridization and probe wash buffers) were lab-made from the cnidarian-adapted hybridization buffer51. Samples were then pre-hybridized with pre-hybridization buffer at 37°C for 30 min. After pre-hybridization, samples were incubated with 2 pmol of the probe set diluted in hybridization buffer for 16 hr at 37°C. To remove the probe mixture solution, samples were washed 2× for 30 min each with probe wash buffer at 37°C. Samples were washed 2× for 5 min with 5× SSC +0.1% Triton and then treated with probe amplification buffer for 30 min at room temperature. Samples were washed into hairpin amplification buffer containing snap cooled amplifier hairpins and were incubated at room temperature, protected from light, overnight. Samples were then washed with successive 3× 5xSSC +0.1% Triton washes: 2× washes for 15min. Nuclear staining was performed using DAPI 1:1000 in PBST during 1h. Samples were then washed with successive 2× 5xSSC +0.1% Triton washes: 2× washes for 5min. Eventually were slide-mounted in glycerol and stored at 4°C.
Microscopy and Image processing
Samples were imaged using a Zeiss LSM 710 with a x63 oil objective. They were slide-mounted in glycerol. Image manipulation was performed with Fiji52. For the double probes NvClk imaging (Fig1.B), ROIs were generated from each NvClk probes signal and only the ROIs positive for the 2 fluorophores were kept. These ROIs were then used to extract from the original picture the signal considered as true mRNA signal. Figures were then assembled in Inkscape (http://www.inkscape.org/)
Data availability
The RNA-seq data reported in this study have been deposited to the Sequence Read Archive (SRA), under accession PRJNA935092. All data supporting the findings of this study are included in the manuscript and its supplementary files or available upon request from the corresponding authors.
Acknowledgements
We would like to thank the lab of Yehu Moran (The Hebrew University) for their help with advice on applying the CRISPR-Cas9 system in Nematostella vectensis. We thank Ms. Roni Turgeman for her assistance with Nematostella cultures. We thank Dre Julie Batut for hosted RA during the manuscript revision of the manuscript. The research was funded by the Moore Foundation “Unwinding the Circadian Clock in a Sea Anemone” (OL, grant no. 4598), and the Israel Science Foundation (LA, ISF, grant no. 961/19), we also acknowledge German Israeli Foundation GIF Nexus (OL, LA, No. G-1566-413.13/2023). Raphael Aguillon was funded by the Azrieli Foundation. This study represents partial fulfillment of the requirements for a Ph.D. thesis for M. Rinsky at the Faculty of Life Sciences Bar-Ilan University, Israel.

(a) In situ hybridization HCRv.3 of control probe (zebrafish transcripts) in the WT juvenile with scale bars representing 0.1mm. (b) Nucleotide and translated amino acid sequences of wild-type and NvClkΔ alleles. sgRNA target site is boxed in green, PAM site is in bold, a black arrow indicates predicted site of editing. Predicted translation termination site is boxed in black. Insertion is labeled in red. Predicted immature peptide sequences in red. (c) Normalized Movement (a.u), hourly binned over 72h, under continuous dark (Dark - Dark), Blue line represents the NvClk +/Δ heterozygote. (d) Individual locomotor amplitude comparison between the three genotype. Kruskal-wallis, multitest comparison *** is p<0.001; * is p<0.05. (e) Lomb-Scargle Periodograms for each corresponding genotypes in constant darkness. The significant period value (p<0.01) is indicated for each genotype in the top left corner. (f) Phase detection (Cosinor) and genotype comparison of 24h rhythmic individuals. See number nrhythmic/ntotal on the x-axis indicating for each genotype the number of 24h rhythmic animals over the total number analyzed. (g) Normalized Movement (a.u), hourly binned over 72h, under continuous dark (Dark - Dark) after 72h of LD 6h: 6h entrainment, Black line represent the WT and red line represents the NvClkΔ/Δ. (h) Lomb-Scargle Periodograms for each corresponding genotypes in constant darkness. The significant period value (p<0.01) is indicated for each genotype in the top left corner. (i). Phase detection (Cosinor) and genotype comparison of 24h rhythmic individuals. See number nrhythmic/ntotal on the x-axis indicating for each genotype the number of 24h rhythmic animals over the total number analyzed.

(a) Gene per cluster counts comparison between LD and DD in WT polyps. The cluster number is indicated below each boxplot. Mann-Whitney, p > 0.05. (b) On the left Y-axis, each dot represents the count of genes per cluster acrophase, with the number associated indicating its number ID in supplementary Table 4. On right Y-axis, the normalized behavior over time in LD and DD conditions. Data from both Y-axis are organized over 24 hours (c) Gene per cluster counts comparison between LD and DD conditions in NvClkΔ/Δ polyps. The cluster number is indicated below each boxplot. Mann-Whitney, p < 0.05. (d) On the left Y-axis, each dot represents the count of genes per cluster acrophase, with the number associated indicating its number ID in supplementary Table 4. On right Y-axis, the normalized behavior over time in LD and DD conditions. Data from both Y-axis are organized over 24 hours.

Venn diagram showing overlaps of rhythmic genes in LD (WT on the left and NvClkΔ/Δ on the right) condition with rhythmic genes from Leach et al., 2019 and the candidate pacemaker genes (based on protein conservation).
References
- 1.Evolution of time-keeping mechanisms: early emergence and adaptation to photoperiodPhilos. Trans. R. Soc. Lond. B Biol. Sci 366:2141–2154Google Scholar
- 2.Temporal organization: reflections of a Darwinian clock-watcherAnnu. Rev. Physiol 55:16–54Google Scholar
- 3.A gonad-expressed opsin mediates light-induced spawning in the jellyfish ClytiaeLife 7Google Scholar
- 4.Photobehaviour of Hydra (Cnidaria, Hydrozoa) and correlated mechanisms: a case of extraocular photosensitivityJ Photochem Photobiol B, Biol 55:88–101Google Scholar
- 5.Evidence for rhythmicity pacemaker in the calcification process of scleractinian coralSci. Rep 6:20191Google Scholar
- 6.Profiling molecular and behavioral circadian rhythms in the non-symbiotic sea anemone Nematostella vectensisSci. Rep 5:11418Google Scholar
- 7.Circadian clock gene expression in the coral Favia fragum over diel and lunar reproductive cyclesPLoS ONE 6:e19755Google Scholar
- 8.Setting the pace: host rhythmic behaviour and gene expression patterns in the facultatively symbiotic cnidarian Aiptasia are determined largely by SymbiodiniumMicrobiome 6:83Google Scholar
- 9.Light-responsive cryptochromes from a simple multicellular animal, the coral Acropora milleporaScience 318:467–470Google Scholar
- 10.The cnidaria, past, present and futureSpringer International Publishing https://doi.org/10.1007/978-3-319-31305-4Google Scholar
- 11.Circadian clocks in the cnidaria: environmental entrainment, molecular regulation, and organismal outputsIntegr. Comp. Biol 53:118–130Google Scholar
- 12.Light entrained rhythmic gene expression in the sea anemone Nematostella vectensis: the evolution of the animal circadian clockPLoS ONE 5:e12805Google Scholar
- 13.A genome-wide survey of photoreceptor and circadian genes in the coral, Acropora digitiferaGene 515:426–431Google Scholar
- 14.Transcriptional remodelling upon light removal in a model cnidarian: Losses and gains in gene expressionMol. Ecol 28:3413–3426Google Scholar
- 15.Transcriptome-wide analysis of differential gene expression in response to light:dark cycles in a model cnidarianComp. Biochem. Physiol. Part D Genomics Proteomics 26:40–49Google Scholar
- 16.Temporal gene expression patterns in the coral Euphyllia paradivisa reveal the complexity of biological clocks in the cnidarian-algal symbiosisSci. Adv 8:eabo6467Google Scholar
- 17.Characterization of circadian behavior in the starlet sea anemone, Nematostella vectensisPLoS ONE 7:e46843Google Scholar
- 18.Environmental entrainment demonstrates natural circadian rhythmicity in the cnidarian Nematostella vectensisJ. Exp. Biol 222Google Scholar
- 19.Decoupling behavioral and transcriptional responses to color in an eyeless cnidarianBMC Genomics 21:361Google Scholar
- 20.Structural and functional analyses of PAS domain interactions of the clock proteins Drosophila PERIOD and mouse PERIOD2PLoS Biol 7:e94Google Scholar
- 21.Interacting molecular loops in the mammalian circadian clockScience 288:1013–1019Google Scholar
- 22.Developmental and light-entrained expression of melatonin and its relationship to the circadian clock in the sea anemone Nematostella vectensisEvodevo 5:26Google Scholar
- 23.JTK_CYCLE: an efficient nonparametric algorithm for detecting rhythmic components in genome-scale data setsJ. Biol. Rhythms 25:372–380Google Scholar
- 24.Detecting rhythms in time series with RAINJ. Biol. Rhythms 29:391–400Google Scholar
- 25.A recessive mutant of Drosophila Clock reveals a role in circadian rhythm amplitudeEMBO J 22:3367–3375Google Scholar
- 26.Identification of a mutation in the Clock1 gene affecting zebrafish circadian rhythmsJ. Neurogenet 22:149–166Google Scholar
- 27.A clock shock: mouse CLOCK is not required for circadian oscillator functionNeuron 50:465–477Google Scholar
- 28.Mutagenesis and mapping of a mouse gene, Clock, essential for circadian behaviorScience 264:719–725Google Scholar
- 29.A CLOCK-less clockTrends Cell Biol 16:547–549Google Scholar
- 30.A mutant Drosophila homolog of mammalian Clock disrupts circadian rhythms and transcription of period and timelessCell 93:791–804Google Scholar
- 31.All light, everywhere? photoreceptors at nonconventional sitesPhysiology (Bethesda) 39:0Google Scholar
- 32.Nematostella vectensis exemplifies the exceptional expansion and diversity of opsins in the eyeless HexacoralliaEvodevo 14:14Google Scholar
- 33.Circadian cycles of gene expression in the coral, Acropora milleporaPLoS ONE 6:e25072Google Scholar
- 34.Synexpression groups in eukaryotesNature 402:483–487Google Scholar
- 35.UCSC Cell Browser: visualize your single-cell dataBioinformatics 37:4578–4580Google Scholar
- 36.Third-generation in situ hybridization chain reaction: multiplexed, quantitative, sensitive, versatile, robustDevelopment 145Google Scholar
- 37.CIPC is a mammalian circadian clock protein without invertebrate homologuesNat. Cell Biol 9:268–275Google Scholar
- 38.CLOCKWORK ORANGE promotes CLOCK-CYCLE activation via the putative Drosophila ortholog of CLOCK INTERACTING PROTEIN CIRCADIANCurr. Biol 31:4207–4218Google Scholar
- 39.Pdp1, and dClock form a second feedback loop in the Drosophila circadian clockCell 112:329–341Google Scholar
- 40.Molecular bases for circadian clocksCell 96:271–290Google Scholar
- 41.Induction of spawning in the starlet sea anemone Nematostella vectensis, in vitro fertilization of gametes, and dejellying of zygotesCold Spring Harb. Protoc 2009:pdb.prot5281Google Scholar
- 42.Efficient genome editing in zebrafish using a CRISPR-Cas systemNat. Biotechnol 31:227–229Google Scholar
- 43.TALEN and CRISPR/Cas9-mediated genome editing in the early-branching metazoan Nematostella vectensisNat. Commun 5:5486Google Scholar
- 44.ZiFiT (Zinc Finger Targeter): an updated zinc finger engineering toolNucleic Acids Res 38:W462–8Google Scholar
- 45.Comparison of developmental trajectories in the starlet sea anemone Nematostella vectensis: embryogenesis, regeneration, and two forms of asexual fissionInvertebr. Biol 126:99–112Google Scholar
- 46.Conserved and novel gene expression between regeneration and asexual fission in Nematostella vectensisDev. Genes Evol 219:79–87Google Scholar
- 47.Easy quantitative assessment of genome editing by sequence trace decompositionNucleic Acids Res 42:e168Google Scholar
- 48.DiscoRhythm: an easy-to-use web application and R package for discovering rhythmicityBioinformatics 36:1952–1954Google Scholar
- 49.Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2Genome Biol 15:550Google Scholar
- 50.HTSeq — a Python framework to work with high-throughput sequencing dataBioinformatics 31:166–169Google Scholar
- 51.A safer, urea-based in situ hybridization method improves detection of gene expression in diverse animal speciesDev. Biol 434:15–23Google Scholar
- 52.Fiji: an open-source platform for biological-image analysisNat. Methods 9:676–682Google Scholar
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Reviewed Preprint version 3:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.89499. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2023, Aguillon et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 2,267
- downloads
- 192
- citations
- 14
Views, downloads and citations are aggregated across all versions of this paper published by eLife.