Abstract
Numerous lipids are heterogeneously distributed among organelles. Most lipid trafficking between organelles is achieved by a group of lipid transfer proteins (LTPs) that carry lipids using their hydrophobic cavities. The human genome encodes many intracellular LTPs responsible for lipid trafficking and the function of many LTPs in defining cellular lipid levels and distributions is unclear. Here, we created a gene knockout library targeting 90 intracellular LTPs and performed whole-cell lipidomics analysis. This analysis confirmed known lipid disturbances and identified new ones caused by loss of LTPs. Among these, we found major sphingolipid imbalances in ORP9 and ORP11 knockout cells, two proteins of previously unknown function in sphingolipid metabolism. ORP9 and ORP11 form a heterodimer to localize at the ER-trans Golgi membrane contact sites, where the dimer exchanges phosphatidylserine (PS) for phosphatidylinositol-4-phosphate (PI(4)P) between the two organelles. Consequently, loss of either protein causes phospholipid imbalances in the Golgi apparatus that result in lowered sphingomyelin synthesis at this organelle. Overall, our LTP knockout library toolbox identifies various proteins in control of cellular lipid levels, including the ORP9-ORP11 heterodimer, which exchanges PS and PI(4)P at the ER-Golgi membrane contact site as a critical step in sphingomyelin synthesis in the Golgi apparatus.
Introduction
Many types of lipids are heterogeneously distributed among various organelles of the cell1. Due to the hydrophobic nature of lipids, their trafficking needs to be facilitated. While vesicular trafficking transports lipids in bulk between organelles, non-vesicular trafficking of lipids also play a role in defining lipid compositions of organelles. In fact, many organelles that do not receive any vesicular cargo rely on this route. Non-vesicular trafficking of lipids is achieved by a group of lipid transfer proteins (LTPs) that carry lipids using their hydrophobic cavities to stabilize lipids in the aqueous intracellular environment2. LTPs often contain targeting domains, motifs, transmembrane regions, amphipathic helices or surface charge to define their donor and acceptor organelles3. Many LTPs localize at two organelles simultaneously at membrane contact sites, where these organelles come closer to exchange information and material, including lipids4,5.
The human genome encodes over 150 LTPs; new LTPs and LTP families are being characterized every so often2,6–13. About 50 of these proteins are secreted and are involved in carrying lipids, metals, lipopolysaccharides, and other small molecules in blood plasma2. The remaining intracellular LTPs are mainly responsible for intracellular lipid trafficking among organelles. Since many lipid-modifying enzymes are localized to different organelles, LTPs also feed metabolic lipid fluxes, eventually defining cellular lipid levels14. For example, LTP-mediated trafficking of ceramide from the endoplasmic reticulum (ER) to the trans Golgi is needed for sphingomyelin synthesis15. While achieving a considerable understanding of some LTPs in the last years, the function of many LTPs in defining cellular levels and distributions remains unclear.
To study LTPs systematically, we designed and created an arrayed gene knockout library targeting 90 intracellular LTPs based on the CRISPR/Cas9 technology. Lipidomics analysis of the library-generated LTP knockout cells confirmed known and identified novel lipid disturbances emerging from loss of LTPs. These included CERT, GLTP, NPC1 and NPC2 knockout cells with altered sphingolipid levels. Furthermore, we identified major sphingolipid imbalances in ORP9 and ORP11 knockout cells, two proteins of unknown function in sphingolipid metabolism. ORP9 and ORP11 form a heterodimer to localize at the ER-trans Golgi membrane contact sites. At this contact site, the ORP9-ORP11 dimer transfers phosphatidylserine (PS) from the ER to the Golgi and phosphatidylinositol-4-phosphate (PI(4)P) in the opposite direction. Consequently, loss of either protein causes phospholipid imbalances in the Golgi apparatus that results in lowered sphingomyelin synthesis capacity at this organelle. Collectively, our LTP knockout library toolbox identified various proteins controlling cellular lipid levels. Among these, we found the ORP9-ORP11 heterodimer defining phospholipid composition of the trans Golgi as a critical step in sphingomyelin synthesis. These findings highlighted that phospholipid and sphingolipid gradients along the secretory pathway are linked at the ER-Golgi membrane contact sites.
Results
1) A CRISPR knockout library targeting lipid transfer proteins
To understand the function of LTPs in defining cellular levels and distributions, we created an arrayed CRISPR/Cas9 knockout library targeting LTPs. We targeted only the intracellular LTPs in the library and excluded extracellular proteins, such as LIPOCALIN and LBP-BPI-CETP families2. In this library, 90 wells of a 96-well plate were used for targeting LTPs and 6 for non-targeting (NT) controls (Fig. 1A). For optimal gene disruption, we used a lentiviral gene delivery system and 3 guide RNAs per gene – a method also used by others to increase the frequency of gene disruption16. We applied the LTP knockout library to MelJuSo, a human melanoma cell line. The efficiency of the knockout strategy was confirmed by western blotting of selected wells (Fig. 1B).

Lipidomics analysis of a LTP knockout library revealed known and candidate controllers of cellular lipid levels.
(A) Overview of the arrayed gene knockout library targeting LTPs. NT: non-targeting. (B) Western blotting of the selected wells showing the efficiency of the LTP knockout library on MelJuSo cells. gNT: Non-targeting, control cells. (C) Summary plot of the lipidomics analysis: Z-scores calculated for 17 lipid classes are plotted. Each data point represents the mean Z-score of an LTP knockout cell line; size and color of data points represent the standard deviation of Z-scores for 3 experiments on average. PC: phosphatidylcholine, LPC: lyso-phosphatidylcholine, PE: phosphatidylethanolamine, LPE: lyso-phosphatidylethanolamine, PS: phosphatidylserine, PI: phosphatidylinositol, PA: phosphatidic acid, PG: phosphatidylglycerol, DCer: dihydroxyceramide, Cer: ceramide, SM: sphingomyelin, HexCer: hexosylceramide, LacCer: lactosylceramide, DG: diacylglycerol, TG: triacylglycerol, CE: cholesterol ester, FFA: free fatty acids.
Next, we performed whole-cell lipidomics analysis of the LTP knockout cells. To this end, library-generated MelJuSo cells were grown in lipid-depleted serum and analysed using a lipidomics platform detecting 17 different lipid classes thrice on average (Fig. 1A). One of the detected lipid classes, hexosylceramide, can correspond to glucosylceramide and galactosylceramide – two isomeric lipids in mammalian cells. By metabolic chasing of a fluorescent ceramide analogue in cells silenced for glucosylceramide synthase or galactosylceramide synthase; or treated with the glucosylceramide synthase inhibitor PDMP, we validated that glucosylceramide is the major hexosylceramide in MelJuSo cells (Fig. S1). This further substantiated the previous reports of galactosylceramide being present mainly in oligodendrocytes17.
We next calculated the z-scores within each lipid class based on their relative abundance per measurement and plotted their average for LTP knockout cell lines. The analysis revealed many LTP knockout cells with lipid imbalances (Fig. 1C, Fig. S2A). Meanwhile, no z-score above the absolute value of 2 was observed for NT control cells (Fig. S2B). Overall, the lipidomics analysis of the LTP knockout library uncovered numerous candidate regulators of cellular lipid levels.
2) NPC1 and NPC2 knockout cells accumulate sphingomyelin in lysosomes and the plasma membrane
Lipidomics analysis of the LTP knockout library revealed various anticipated imbalances. Among these candidate regulators of cellular lipid levels, those related to sphingolipid metabolism are notable. This is likely due to many enzymatic steps of sphingolipid metabolism being more linear and lacking the elasticity of phospholipids1,14. In the analysis, we identified GLTP knockout cells with lowered glucosylceramide levels (Fig. 2A, Fig. S3A-C). Loss of GLTP is recently reported to block ER-to-Golgi anterograde vesicular trafficking that results in lowered glucosylceramide synthesis18.

NPC1 and NPC2 knockout cells accumulate sphingomyelin in lysosomes.
(A) GLTP knockouts show decreased glucosylceramide levels compared to control cells. GlcCer: glucosylceramide (B) NPC1 and NPC2 knockout cells have increased sphingolipids levels compared to control cells. (C) Increased sphingolipid levels in NPC1 and NPC2 knockouts are represented in all sphingolipid classes. (D) Immunofluorescence images of NPC1 and NPC2 knockout cells permeabilized and stained with recombinant GFP-EQT show the accumulation of sphingomyelin in the lysosomes compared to the parental MelJuSo (MJS) cells. Pixel intensities of the images were adjusted evenly. Scale bar 10µm. (E) Flow cytometry analysis of cells stained with EQT-GFP, CTB-Alexa568 and CD63-V450 on the cell surface. Analysis demonstrates the accumulation of sphingomyelin (EQT-GFP) and the glycosphingolipid GM1 (CTB-Alexa568) on the cell surface without affecting the surface protein levels. (F) Mean fluorescence intensities for each staining normalized to control cells from 3 experiments. Red lines and error bars correspond to mean and standard deviations from 3 experiments, respectively. Approximately 2000 cells were analyzed per experiment.
In addition, we observed NPC1 and NPC2 knockout cells with elevated sphingolipid levels (Fig. 1B). Mutations in NPC1 and NPC2 genes are the cause of Niemann-Pick disease, type C that leads to lysosomal accumulation of cholesterol19. Cells lacking NPC1 or NPC2 function also accumulate sphingolipids20. Our observation of elevated sphingolipid levels in NPC1 and NPC2 knockout cells was present in all sphingolipid classes (Fig. 2B, C). Meanwhile phospholipid levels were not altered dramatically in these cells (Fig. S3D). To confirm whether this increase is associated with lysosomal accumulation of sphingolipids, we used a sphingomyelin-binding biosensor based on the equinatoxin secreted by the beadlet anemone Actinia equina (Fig. S3E)21,22. Immunofluorescence staining of NPC1 and NPC2 knockout cells using the biosensor showed lysosomal accumulation of sphingomyelin (Fig. 2D). Flow cytometry analysis using the sphingomyelin biosensor and the GM1 glycosphingolipid biosensor, the B subunit of cholera toxin, demonstrated that sphingolipid accumulation is also reflected on the cell surface of NPC1 and NPC2 knockouts (Fig. 2E, F). Meanwhile, the surface protein levels were not altered as detected by staining for the tetraspanin protein CD63. Collectively, our results corroborate the sphingolipid accumulation in NPC1 and NPC2 deficient cells and illustrate that the LTP knockout library is a viable tool to study LTPs and their role in regulating cellular lipid levels.
3) CERT, ORP9 and ORP11 knockout cells demonstrate reduced sphingomyelin levels
Sphingomyelin is the major sphingolipid in mammalian cells, and it is mainly synthesized in the trans Golgi from ceramide delivered from the ER. The non-vesicular trafficking of ceramide from the ER to the trans Golgi is mediated by the ceramide transfer protein CERT15,23 (Fig. 3B). Our analysis identified CERT knockouts with the lowest sphingomyelin levels (Fig. 1C, 3A). These cells also demonstrate increased glucosylceramide levels, likely as a compensation mechanism (Fig. 3A). Furthermore, we found decreased sphingomyelin and increased glucosylceramide levels in ORP9 and ORP11 knockout cells – two proteins of unknown role in sphingolipid metabolism (Fig. 1C, 3A). The sphingolipid imbalances in all three knockout cells –CERT, ORP9, and ORP11– were also represented in many sphingolipid subspecies (Fig. 3C, Fig. S4B). Lowered sphingomyelin levels of the three knockout cells were further confirmed by their sensitivity towards methyl-β-cyclodextrin treatment (Fig. 3D). Meanwhile, none of the three knockout cells demonstrated phospholipid imbalances to a compelling degree (Fig. S4A).

CERT, ORP9 and ORP11 knockout cells demonstrate reduced sphingomyelin levels.
(A) CERT, ORP9 and ORP11 knockouts demonstrate decreased sphingomyelin and increased glucosylceramide levels. (B) Schematic representation of de novo sphingomyelin synthesis pathway of mammalian cells. (C) Decreased sphingomyelin and increased glucosylceramide levels observed in knockout cells are present in various sphingolipid subspecies. (D) Similar to CERT knockouts, ORP9 and ORP11 knockouts are sensitive to methyl-β-cyclodextrin treatment. Red lines correspond to mean values from 4 experiments. (E) Western blot of knockout cells showing that the loss of ORP9 or ORP11 does not affect CERT protein levels. (F) ORP9 and ORP11 localize at the Golgi apparatus. Scale bar 10µm. (G) Domain architecture of CERT, ORP9 and ORP11. All proteins contain PH domains for Golgi localization. CERT and ORP9, but not ORP11, contain a FFAT motif for interacting with VAP proteins.
The observation that ORP9 and ORP11 knockout cells mimic CERT knockouts implied a role for ORP9 and ORP11 in de novo sphingomyelin synthesis, whereas loss of neither ORP9 nor ORP11 reduced CERT protein levels (Fig. 3E). ORP9 and ORP11 each contain a PH domain mediating localization at the trans Golgi, the site of de novo sphingomyelin synthesis (Fig.3F, G). As loss of either ORP9 or ORP11 did not alter the Golgi ultrastructure as detected by light or electron microscopy (Fig. S5), it further suggested that ORP9 and ORP11 affect sphingomyelin levels by a previously unknown mechanism. Next, we investigated the possible mechanism by which ORP9 and ORP11 regulate cellular sphingolipid levels.
4) Dimerization is critical for the ER-Golgi contact site localization of ORP9 and ORP11
ORP9 and ORP11 interact with each other via their regions between their PH and ORD domains24. As no other domain is found in this region, we speculated some secondary structures must facilitate the dimerization. AlphaFold and PCOILS coiled coils prediction tool suggested that ORP9 and ORP11 contain two alpha helices each in this region – hereafter referred as “coils” (Fig. 4A, S6A, B). AlphaFold-Multimer suggested that the coils of ORP9 and ORP11 interact with each other (Fig. 4B, S6C-D). Identical analysis of the full-length proteins predicted that the coils drive dimerization of the two proteins (Fig. 4C, D, S6E). This was tested by targeting the coils of ORP9 to the mitochondrial outer membrane using the N-terminal sequence of TOM70. In cells expressing mitochondria-targeted ORP9 coils, the coils of ORP11 located to this organelle (Fig. 4C, D). The absence of either coil prevented the colocalization, suggesting that the coils of ORP9 and ORP11 are sufficient for their dimerization. This finding was validated by co- immunoprecipitations (Fig. 4E).

ORP9 dimerization is critical for ER localization of ORP11.
(A) AlphaFold revealing coiled coils in ORP9 and ORP11. (B) AlphaFold-Multimer shows that coiled coils of ORP9 and ORP11 interacting with each other. (C) ColabFold protein complex prediction for full length ORP9 and ORP11 shows the dimerization via coiled coils (arrow). (D) Position aligned error for panel C. Note that the interaction of coils has a lower score (yellow arrows). (E) Coiled coils of ORP9 and ORP11 is sufficient to define their localization as ORP11 coiled coils colocalizes with the mitochondria-targeted ORP9 coiled coils at mitochondria. Scale bar: 10µm. (F) Colocalization analysis of immunofluorescent images corresponding to panel E. Red lines correspond to mean values from 3 experiments; n is number of analyzed cells. (G) Co- immunoprecipitation confirming that the coils of ORP9 and ORP11 interact with each other. (H) Immunofluorescence images of PH domain localizations. Compared to individual PH domains of ORP9 and ORP11, ORP9-ORP11 chimera demonstrates better affinity towards the Golgi. Scale bar: 10µm. (I) Colocalization analysis of immunofluorescent images corresponding to panel H. Red lines correspond to mean values from 3 experiments; n is number of analyzed cells. (J) Co-immunoprecipitation analysis of VAPA, ORP9 and ORP11 from over-expressing cells. Despite lacking a FFAT motif, ORP11 interacts with the ER-resident VAPA protein. This interaction is facilitated by the FFAT motif of ORP9 as a VAPA mutant unable to interact with FFAT motifs (VAPA**) was unable to co-precipitate ORP9 or ORP11.
ORP9, but not ORP11, contains a FFAT, two phenylalanines in an acidic tract, motif that drives ER localization by interacting with the ER-resident VAPA and VAPB25. Despite not containing a FFAT motif, ORP11 could interact with VAPA and VAPB by its dimerization with ORP9. We tested this by co- immunoprecipitations, where ORP11 could be co-isolated with VAPA from cells expressing VAPA, ORP9 and ORP11 (Fig. 4J). This interaction was diminished significantly when ORP9 was not co-expressed. Furthermore, a VAPA mutant unable to interact with FFAT motifs failed to interact with either ORP9 or ORP11, showing that ORP11 interacts with VAPA indirectly via the ORP9-FFAT motif.
We and others previously showed that in addition to VAPA and VAPB, the human proteome contains three other proteins interacting with FFAT and related short linear motifs: MOSPD1, MOSPD2 and MOSPD326,27. In our earlier efforts to identify interaction partners of VAPA, VAPB and other motif-binding proteins, we performed BioID, proximity biotinylation followed by proteomics, identification of membrane contact sites proteins27. In this analysis, ORP9 and ORP11 were found in proximity with VAPA and VAPB but not with other motif-binding proteins (Fig. S6F). This further confirmed that despite lacking a FFAT motif, ORP11 together with ORP9 is part of VAPA- and VAPB-mediated membrane contact sites.
The Golgi localization of ORP9 and ORP11 is mediated by their PH domain interacting with phosphatidylinositol phosphates24. We observed that the PH domains of ORP9 and ORP11 localized only partially to the Golgi and demonstrated strong cytoplasmic localization, unlike the PH domains of OSBP and CERT that show exclusive localization to this organelle28,29 (Fig. 4H, S7D). We hypothesized that the dimerization of ORP9 and ORP11 is a mechanism to increase their avidity towards trans Golgi membranes. To test this, we created a chimera containing ORP9- and ORP11-PH domains that localized to the Golgi more efficiently than the individual PH domains (Fig. 4H, I). This also implied that loss of either protein should reduce the other’s localization to the trans Golgi. Immunofluorescence staining of ORP9 and ORP11 knockout cells for the same proteins confirmed that both ORP9 and ORP11 are required for the Golgi localization of the other protein (Fig. 5). Meanwhile, loss of either protein did not influence the levels of the other (Fig. 3E). Our results collectively show that the dimerization of ORP9 and ORP11 via their coils is required for the localization of ORP9-ORP11 dimer to the ER and the trans Golgi simultaneously.

ORP9 and ORP11 dimerization is critical for their Golgi localization.
(A) Immunofluorescence images of cells stained for ORP9. ORP9 fails to localize at the Golgi as efficiently in ORP11 knockout cells. (B) Colocalization analysis of immunofluorescent images corresponding to panel A. Red lines correspond to mean values from 3 experiments; n is number of analyzed cells. (C) Immunofluorescence images of cells stained using an ORP11 antibody. Similar to ORP9, ORP11 fails to localize at the Golgi as efficiently in ORP9 knockout cells. Note that the effect of ORP9 loss on ORP11 localization is more dramatic than vice versa. (D) Colocalization analysis of immunofluorescent images from panel C. Red lines correspond to mean values from 3 experiments; n is number of analyzed cells. All scale bars are 10µm.
5) ORP9 and ORP11 are essential for PS and PI(4)P levels in the Golgi apparatus
ORP9 and ORP11 belong to the OSBP-related protein (ORP) family that transfers sterols or PS while transferring phosphatidylinositol phosphates in the opposite direction30–33 (Fig. 6A, S7B). ORP9 and ORP11 carry the conserved PS binding site and are recently shown to relocate to the site of lysosomal damage to supply PS for membrane repair34. Using an in vitro lipid transfer assay, we confirmed that the lipid transfer domains (ORD) of ORP9 and ORP11 are sufficient to traffic PS in vitro (Fig. 6B, C). ORP9 and ORP10, but not ORP11, are shown to traffic PI(4)P35,36. Using a PI(4)P transfer assay that utilizes the PI(4)P-binding PH domain of FAPP1, we show that ORD of ORP11 can also traffic PI(4)P between model membranes (Fig. 6D, E, S7C, D)37. Furthermore, similar to ORP5, ORP8 and ORP10, the PS-trafficking activity of ORP9- and ORP11-ORDs was improved when acceptor liposomes were decorated with PI(4)P35,38,39 (Fig. S7E). This indicated that ORDs of ORP9 and ORP11 transport PI(4)P in the opposite direction of PS trafficking.

ORP9 and ORP11 are essential for PS and PI(4)P levels in the Golgi apparatus.
(A) Phylogenetic tree of human OSBP-related domains showing that ORP9 and ORP11 belong to the PS transporter branch. (B) Schematic representation of FRET-based PS transfer assay. Rhodamine in the donor vesicles quenches NBD fluorescence unless NBD-labeled lipid is transferred to acceptor liposomes. (C) FRET- based lipid transfer assay using the OSBP-related domains of ORP9 and ORP11, ORD9 and ORD11 respectively, demonstrate the PS trafficking ability between vesicles in vitro. (D) Graphical representation of PI(4)P transfer assay that utilizes the NBD-labelled PH domain of FAPP1. PI(4)P transfer by a protein leads to inrease NBD-fluorescence by dequenching. (E) PI(4)P transfer assay using ORP9-ORD and ORP11-ORD (ORD9 and ORD11, respectively). (F) Schematic representation of in vitro reconstitution of membrane contact sites for lipid transfer assays. (G) PS transfer assay at in vitro reconstituted membrane contact sites formed by the VAPB-ORP9-ORP11 trimer. (H) Vmax quantifications of PS transfer assays from panel E. (I) The PS sensor Lact-C2 localizes less prominently to the Golgi in ORP9 and ORP11 knockout cells. (J) Golgi quantification of the PS sensor RFP-LactC2 indicates reduced PS levels in this organelle. This phenotype could be rescued by reconstitution of the missing protein in knockout cells (shown with a dagger). Red lines correspond to mean values from 3 experiments; n is number of analyzed cells. (K) The PI(4)P sensor OSBP- PH localizes more prominently to the Golgi area in ORP9 and ORP11 knockout cells. (I) Golgi quantification of the PI(4)P sensor confirms the accumulation of PI(4)P at this organelle. This phenotype was rescued by reconstitution of the missing protein in knockout cells (shown with a dagger). Red lines correspond to mean values from 3 experiments; n is number of analyzed cells.
To demonstrate the contribution of ORP9-ORP11 dimerization to their lipid transfer ability at membrane contact sites, we reconstituted these sites in vitro by attaching a His-tagged VAPB devoid of its transmembrane helix to donor liposomes and providing full-length ORP9 and ORP11 as tethers to the acceptor liposomes (Fig. 6F, S7F-H). PS transfer assay in these reconstituted contact sites showed that as a trimer, the ORP9-ORP11-VAPB complex displays an improved lipid transfer capacity (Fig. 6G, H).
PS is synthesized in the ER and its concentration increases along the secretory pathway as it is enriched on the cytosolic leaflet of the plasma membrane14. PI(4)P, on the other hand, is abundant in the trans Golgi, where it recruits many proteins to this membrane40. Another LTP localized at the ER-trans Golgi membrane contact sites, OSBP transfers cholesterol from the ER to the trans Golgi, while counter transporting PI(4)P to the ER for its hydrolysis by the ER-resident PI(4)P phosphatase SAC1 (Fig. 8). Homologous to OSBP, the ORP9-ORP11 dimer resides in the ideal intracellular interface to traffic PS in anterograde and PI(4)P in retrograde direction between the ER and trans Golgi (Fig. 8). This also suggested that the loss of either protein would cause PS and PI(4)P imbalances between the ER and trans Golgi. We tested this notion by using PI(4)P- and PS-binding biosensors41,42 (Fig. S7I, J). Golgi localization of these sensors indicated that PS levels were decreased in the Golgi of these cells (Fig. 6I, J). Also, PI(4)P showed accumulation in the Golgi of ORP9 and ORP11 knockout cells (Fig. 6K, L). We confirmed the PI(4)P accumulation by quantifying the Golgi localization of a PI(4)P specific antibody (Fig. S7J). Interestingly, both phenotypes, lowered PS and increased PI(4)P levels, were better pronounced in ORP9 knockout cells compared to ORP11 knockouts. Furthermore, both phenotypes could be rescued by reconstitution of the missing protein (Fig. 6J, L). Overall, these findings suggested that the ORP9-ORP11 dimer is required for maintaining PS and reducing PI(4)P levels in the Golgi apparatus.
6) De novo sphingomyelin synthesis in the Golgi is impaired in ORP9 and ORP11 knockouts
Next, we set out to investigate the possible role of ORP9 and ORP11 in regulating cellular sphingomyelin levels. By performing a sphingomyelin synthase activity assay that uses the fluorescent ceramide analogue NBD-ceramide as a substrate43, we found that ORP9 and ORP11 knockout cells do not have reduced sphingomyelin synthesis capacity (Fig. 7A, B). The same was also found in CERT knockout cells. Whereas all three knockouts demonstrated increased glucosylceramide synthesis capacity, supporting the lipidomics analysis (Fig. 3A). Unaltered sphingomyelin synthesis capacity was further validated by the unreduced protein and mRNA levels of both human sphingomyelin synthases, SMS1 and SMS2 (Fig. S8A, B).

ORP9 and ORP11 are needed for de novo sphingomyelin synthesis in the Golgi apparatus.
(A) Thin-layer chromatography readout of the enzymatic activity assay performed in lysates reveals the unreduced sphingomyelin synthesis capacity of knockout cells. (B) Quantification of the enzymatic activity assays corresponding to panel A. Note the increased GlcCer production capacity in the knockout cells. Red lines and error bars correspond to mean and standard deviation from 5 experiments, respectively. (C) Graphic representation of experiments using palmitic acid alkyne for monitoring de novo sphingomyelin synthesis. Alkyne modified sphingolipids are “clicked” with azido-coumarin before thin-layer chromatography (TLC) analysis. (D) TLC readout of de novo sphingomyelin synthesis assay in intact cells using palmitic acid alkyne. Knockout cells demonstrate reduced conversion of palmitic acid to sphingomyelin. FA: fatty acid, SM: sphingomyelin, LPE: lyso-O-phosphatidylethanolamine (E) Quantification of de novo sphingomyelin synthesis assay from panel C. Red lines and error bars correspond to mean and standard deviation from 5 experiments, respectively. (F) Simplified representation of Golgi-targeted lipidomics and enzymatic activity assays. (G) Western blot confirming the immunomagnetic isolation of trans Golgi membranes. Cross-reactivity to Protein G and/or Golgin-97 IgG were labeled with asterisks. (H-J) Lipidomics analysis of Golgi isolates show lowered PS levels in the Golgi of ORP9 and ORP11 knockout cells. Same Golgi fractions have reduced sphingomyelin but increased ceramide levels. Each colored line corresponds to a lipid species. Data points and the error bars correspond to mean and standard deviations from 4 experiments. (K) TLC readout of enzymatic activity assay performed in isolated Golgi from knockout cells. Golgi of ORP11 and especially that of ORP9 demonstrate lowered capacity to synthesize sphingomyelin. (L) Quantification of sphingomyelin synthesis activity assay performed in Golgi isolates corresponding to panel I.

Model of ORP9-ORP11 mediated promotion of sphingomyelin synthesis at the ER-trans Golgi contact site.
ORP9 and ORP11 require dimerization with each other to localize at ER-trans Golgi membrane contact sites, where they exchange PS for PI(4)P. Consequently loss of either protein causes PS and PI(4)P imbalances in the Golgi apparatus. Since only ORP9 contains a FFAT motif, its loss leads to a more pronounced effect on PS, PI(4)P and sphingolipid levels. The same contact site accommodates other LTPs. Multiple phosphatidylinositol transfer proteins (PITPs) traffic phosphatidylinositol to the Golgi for their phosphorylation. Each PITP at the ER-Golgi contact site serves a different function—one of these proteins, Nir2, also contains a FFAT motif (ref.46 and 54). OSBP and CERT are responsible for the anterograde trafficking of cholesterol and ceramide, the latter is used for sphingomyelin production. Cholesterol, sphingomyelin and PS are trafficked to the plasma membrane by vesicular means to be asymmetrically distributed between the leaflets of the plasma membrane.
SMS1 is localized at the trans Golgi, while SMS2 mainly localizes at the plasma membrane but is also found at the trans Golgi44. As the enzymatic activity assay in lysates reports on the global sphingomyelin synthesis capacity, we next investigated de novo sphingomyelin synthesis that occurs at the trans Golgi, where CERT as well as the ORP9-ORP11 dimer localize. For this purpose, we chased the metabolic fate of palmitic acid alkyne (Fig. 7C). Palmitic acid is the precursor of sphinganine and all sphingolipids (Fig. 3B, 7C). To enter the sphingolipid pathway, palmitic acid first needs to travel to the ER and later to the Golgi for conversion to sphingomyelin, unlike ceramide analogues, such as NBD-ceramide, that can be converted to sphingomyelin by the plasma membrane-resident SMS2. Furthermore, the palmitic acid alkyne does not contain a bulky fluorescent group and the terminal alkyne allows visualization by click chemistry (Fig. 7C). As this method enabled us to monitor de novo sphingomyelin production in intact cells, we confirmed the reduced de novo sphingomyelin synthesis in CERT knockout cells using this method (Fig. 7D, E, S8C). In addition, ORP9 and ORP11 knockouts also showed decreased conversion of palmitic acid to sphingomyelin, suggesting a similar defect as CERT knockouts. To confirm the decreased sphingomyelin synthesis, we quantified the Golgi localization of a DAG biosensor, C1ab domain of protein kinase D1, that can report on sphingomyelin synthesis45,46. This showed decreased DAG levels in the Golgi that can be accounted for lowered sphingomyelin synthesis (Fig. S8D).
The observations that loss of ORP9 or ORP11 does not affect CERT protein (Fig. 3E) or reduce CERT localization to the Golgi (Fig. S9) implied that CERT-mediated transfer routes are not affected in ORP9 or ORP11 knockouts. Lipidomics analysis showing accumulation of ceramide and glucosylceramide in ORP9/ORP11 knockouts further suggested the conversion of ER-bound ceramides to sphingomyelin in the Golgi is hampered.
To distinguish between two possibilities that may result in lowered sphingomyelin levels – a ceramide delivery defect to the trans Golgi or an inability to convert ceramide to sphingomyelin in the Golgi, we established an immunoisolation protocol for trans Golgi membranes using a monoclonal antibody against the trans Golgi marker Golgin-97 (Fig. 7F). These isolates were enriched for the trans Golgi marker Golgin- 97 and were devoid of other organelle markers, such as the ER, mitochondria, and lysosomes (Fig. 7G). We confirmed the membrane integrity of Golgin-97-enriched fractions by their sphingomyelin synthase activity, as these multi-pass transmembrane proteins require intact membranes for activity44 (Fig. S10A). Lipidomics analysis of these fractions validated that the loss of ORP11 and especially that of ORP9 results in lowered PS levels in the trans Golgi (Fig. 7H, S10B-D). The trans Golgi fractions also showed reduced sphingomyelin levels, confirming the limited de novo sphingomyelin synthesis (Fig. 7D, E, I S10E). Moreover, the same fractions showed elevated ceramide levels in these fractions (Fig. 7J, S10F), revealing that the knockouts do not have a ceramide delivery defect, but instead a lowered capacity to convert ceramide to sphingomyelin in their trans Golgi membranes. We tested this notion by performing a sphingomyelin synthase activity assay in the isolated Golgi membranes, where supplying excess substrate to these membranes bypasses the ceramide delivery routes (Fig. 7K, L). This assay further substantiated that the Golgi of ORP11 and especially of ORP9 knockout cells have a lowered sphingomyelin synthesis capacity. Meanwhile, localization of both sphingomyelin synthases was not reduced in the Golgi, as detected by three different antibodies (Fig. S11). Collectively, our results indicate that PS-PI(4)P exchange between the ER and trans Golgi mediated by the ORP9-ORP11 LTP complex is critical for de novo sphingomyelin synthesis in trans Golgi.
Discussion
In this study, we describe a gene knockout library for systematic characterization of intracellular LTPs. The arrayed design of the library enables high and low throughput analysis. As new LTPs are identified in regular basis, the arrayed feature of the library allows expansion to include newly identified LTPs, e.g. ATG2A, SHIP164, KIAA0100 (Hobbit in Drosophila), KIAA1109 (Csf1 in yeast) and RMDN3 are new human LTPs that are identified through the course of this study8–10,12,13.
Lipidomics analysis of the library demonstrated many lipid imbalances. We further validated loss of NPC1, NPC2, CERT, and GLTP with sphingolipid imbalances15,18,20 (Fig. 1C). In addition to sphingolipids imbalances, we found STARD7 knockout cells with increased levels of phosphatidylglycerol (PG), a lipid class exclusive to mitochondria in mammals (Fig. 1C). STARD7 is a phosphatidylcholine (PC) transfer protein that localizes to the mitochondrial intermembrane space to supply PC to the mitochondrial inner membrane47–49. Consequently, loss of STARD7 reduces PC levels in this membrane as well as decreasing cardiolipin levels and respiratory capacity48,49. While PC in the inner membrane is not a precursor of cardiolipin, it is possible the reduced PC levels in this membrane impair the activity of the cardiolipin synthase that uses PG as its substrate, suggesting an explanation for the PG accumulation in STARD7 knockout cells.
LTPs often localize at membrane contact sites to facilitate lipid exchanges between organelles. We found ORP9 and ORP11 localizing at the ER-trans Golgi contact sites to exchange PS and PI(4)P. We show that the dimerization is critical for the contact site localization, and consequently, loss of either protein is sufficient to disturb PS and PI(4)P levels in the Golgi. In return, this phospholipid imbalance reduces sphingomyelin synthesis capacity of the Golgi. Compared to ORP11 knockout cells, ORP9 knockout cells display more pronounced phenotypes of cellular sphingolipid imbalances (sphingomyelin and glucosylceramide), phospholipid imbalances in the Golgi apparatus (PS and PI(4)P), as well as reduced capacity of sphingomyelin synthesis in trans Golgi membranes. Furthermore, loss of ORP9 leads to a more dramatic effect on the Golgi localization of ORP11 than vice versa. This is most likely due to ORP9 providing a critical factor, i.e. the FFAT motif, for contact site localization, whereas it is possible the loss of ORP11 can be partially compensated by ORP10.
The contact site localization of the ORP9-ORP11 dimer is homologous to that of the ORP9-ORP10 dimer localizing at the ER-endosome and ER-Golgi contact sites asORP10 also uses its coiled coils to interact with ORP935,36. In both LTP complexes, ORP9 provides the FFAT motif required for ER contact. ORP10 can also deliver PS to Golgi membranes50, however, our lipidomics analysis of ORP10 knockout cells did not demonstrate any sphingolipid imbalances (Fig. S12A). Besides ORP9, ORP10 and ORP11, other LTPs are also shown to dimerize at the ER-Golgi interface. A recent structural study has revealed the architecture of a previously-described OSBP dimerization that is mediated by a central core domain containing two alpha helices51,52. CERT forms a similar dimer and the conformational changes dictated by the central core domain is responsible for regulating the activity of the CERT dimer53. Both OSBP and CERT homodimers form a T-shaped structure, dissimilar to the heterodimers of ORP9, ORP10 and ORP11.
What distinguishes ORP11 from ORP10? An analysis of expression profiles from >900 cancer cell types showed that ORP10 and ORP11 are not differentially expressed (Fig. S12B). On the contrary, they show a positive correlation. It is possible that ORP9 interacts with ORP10 or ORP11 in different biological conditions or sub-cellular locations. ER-endosome contact site localization of the ORP9-ORP10 dimer supports this notion35. Even within the Golgi, ORP9-ORP10 and ORP9-ORP11 dimers might be facilitating lipid flows at different sub-organellar domains. The presence of multiple phosphatidylinositol (PI) transfer proteins localized at ER-trans Golgi contact sites feeding PI(4)P synthesis in the Golgi for distinct purposes and the observation of different PI(4)P-containing sub-domains in the Golgi promotes the idea that ORPs could localize at different Golgi sub-domains55,56. Furthermore, all three proteins, together with OSBP and ORP1L, are recruited to the lysosomal damage site in response to the increased PI(4)P levels on lysosomal delimiting membrane34,57. Collectively, these reports highlight the spatiotemporally dynamic nature of PI(4)P-mediated lipid trafficking and suggest that the two dimers could have different functions.
An intriguing observation is that the loss of ORP9 causes more accumulation of ceramide than CERT knockouts, despite loss of either protein leading to a comparable reduction of sphingomyelin levels. As the loss of CERT would lead to a ceramide accumulation in the ER, it is possible that such an accumulation in the ER is sensed to reduce ceramide production in this organelle. An ER-resident candidate ceramide sensor for this purpose was suggested previously58. Meanwhile, our findings show a ceramide accumulation in the trans Golgi of ORP9 knockouts. Accordingly, ceramide accumulation in the Golgi caused by the loss of ORP9 would fail to “turn on” an ER-localized ceramide sensing machinery, thus leading to further ceramide accumulation compared to CERT knockout cells. This notion also supports our finding that the loss of the ORP9-ORP11 dimer causes ceramide accumulation primarily in the Golgi.
Asymmetric distribution of lipids between two bilayer leaflets is a characteristic feature of the plasma membrane. This is owed to the build-up of sphingomyelin and cholesterol on the outer leaflet and PS on the inner leaflet14. The transition of the thin, symmetrical ER membrane to a thicker, rigid and asymmetrical one takes place in the Golgi (Fig. 8)14. Sphingolipid, cholesterol and PS concentrations also increase along the secretory pathway. Various mechanisms are described to drive the sphingolipid and cholesterol trafficking against the concentration gradient, including thermodynamic trapping of cholesterol due to complex formation with sphingomyelin or energy release from the retrograde trafficking of PI(4)P followed by its hydrolysis in the ER14,31,59. The same PI(4)P gradient between the ER and Golgi could also power the anterograde trafficking of PS, which, unlike sphingomyelin or cholesterol, is still exposed on the cytosolic leaflet of the Golgi where it has a higher concentration than the ER – thus, maintaining lipid trafficking against the gradient requires energy. In brief, our finding that the ORP9-ORP11-dimer-mediated phospholipid exchange promoting the sphingomyelin synthesis reveal further intertwining of lipid gradients along the secretory pathway at the ER-trans Golgi membrane contact sites.
Conflict of Interest
Authors declare no conflict of interest.
Acknowledgements
Authors thank Ruud Wijdeven, Robbert Q. Kim of LUMC protein facility, Carolina Jost and the members of the Neefjes lab for their technical and critical input. Authors are especially grateful to Joost Holthuis and Matthijs Kol of University of Osnabrück for their intellectual input.
Materials and methods
Cell culture
MelJuSo and HEK293T (ATCC CRL-3216) cells were cultured in IMDM (Gibco #21980) and DMEM (Gibco #41966) supplemented with 8% fetal calf serum (Biowest #S1810), respectively. MelJuSo cell line authentication was performed by Eurofins Genomics (19-ZE-000487).
Library design, generation and transduction
Targeting and non-targeting guide sequences (Supplementary Table 1) were obtained from the Brunello Human CRISPR Knockout Pooled Library60 and cloned into lentiCRISPR v2 plasmid61 as described previously62. Cloning of guide RNAs were individually confirmed by Sanger sequencing.
For library transduction, HEK cells were seeded on a 96-well plate on the day before transfection and transfected with library plasmids and lentiviral packaging plasmids pRSVrev, pHCMV-G VSV-G, and pMDLg/pRRE using polyethyleneimine (Polysciences #23966). A day after replacing the medium, virus was harvested and MelJuSo cells were transduced in the presence of 4µg/ml polybrene (EMD Milipore #TR- 1003-G). Transduced cells were subjected to selection using 2µg/ml puromycin.
Lipid extractions and lipidomics analysis
For lipidomics analysis, library-generated cells were expanded to 15-cm dishes and cultured in IMDM supplemented with lipid-depleted serum (Pel-Freez #37217-5) for 3-4 days. Next, cells were scraped in 2% NaCl solution and lipids were extracted following the Bligh-Dyer protocol. In brief, harvested cells were resuspended in 200µL 2% (w/v) NaCl followed by addition of 500µL methanol and 250µL chloroform. Samples were vortexed for 5 min. Following phase separation by adding 250µL chloroform and 250µL 0.45% (w/v) NaCl, samples were centrifuged for 5min at 15,000xg. Next, bottom fractions were collected and dried under continuous nitrogen stream.
Comprehensive, quantitative shotgun lipidomics was carried out as described in detail elsewhere63,64. Briefly, dried lipid extracts were spiked with 54 deuterated internal standards and dissolved in methanol:chloroform 1:1 containing 10 mM ammonium acetate. Lipids are then analysed with a flow injection method at a flow rate of 8 µL/min applying differential ion mobility for lipid class separation and subsequent multiple reaction monitoring in positive and negative electrospray ionization mode. Using the Shotgun Lipidomics Assistant (SLA) software individual lipid concentrations are calculated after correction for their respective internal standards.
Data analysis and statistics
Data analyses, including lipidomics data analysis, were performed using R (4.1.0 “Camp Pontanezen”) and RStudio (2022.12.0+353) with following packages: ggplot2, dplyr, readr, ggrepel, ggcorrplot2, reshape2, ggbeeswarm, ggsignif, purr, tidyr, and tibble. For Z-score calculations, first the percentages of each lipid class within individual measurements were calculated, followed by calculating Z-scores for individual data points using the following formula: “Z = (x - μ)/σ”, where µ is the mean percentage of a lipid class and σ is the standard deviation. Next, average Z-scores for LTP knockout cell lines were calculated. For POPC normalized data analysis for the analysis of acyl chain distributions and Golgi lipidomics, each lipid subspecies normalized to palmitoyl-oleoyl-phosphatidylcholine (POPC) levels. For Golgi lipidomics, POPC- normalized values were normalized again to the mean of POPC-normalized values for MJS and gNT samples. Raw lipidomics data available at Supplementary Table 2.
Mean values are denoted in all graphs except for boxplots. When present, error bars indicate standard deviations. In boxplots, middle line denotes median, box boundaries denote the first (Q1) and third (Q3) quartiles, and the lower and upper whiskers denote “Q1-1.5*IQR” and “Q3+1.5*IQR”, respectively. IQR: inter-quartile range. For statistical analysis, student’s t-test is used, unless stated otherwise. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
Co-immunoprecipitation, SDS-PAGE and Western blotting
Co-immunoprecipitation from HEK293T cells, SDS-PAGE and Western blotting were performed as described previously27.
Immunofluorescence staining and quantifications
For equinatoxin staining, cells were fixed with 4%PFA:PBS (v/v) and permeabilized with 10µg/ml digitonin in PBS for 15min at RT. Further stainings were performed in PBS. PI4P staining was performed after fixation in 2% PFA/PBS for 15 minutes followed by permeabilization with 20μM digitonin in Buffer A (20mM PIPES, pH 6.8, 137mM NaCl and 2.7mM KCl). Blocking was performed in Buffer A supplemented with 5% (v/v) serum. Next, cells were incubated with the PI(4)P antibody and the anti-mouse IgM secondary antibody, respectively–both diluted in blocking solution. Cells were washed with buffer A and fixed in 2% PFA/PBS for 5 minutes. Coverslips were mounted on slides using Vectashield Vibrance (Vector Laboratories #H- 1700).All other immunofluorescence staining was performed as described previously27.
Images were acquired using a Zeiss LSM 900 with Airyscan. Images were analysed and quantified using ImageJ/FIJI software. To quantify the Golgi localization of lipid biosensors (OSBP-PH, LactC2 and C1ab), first a mask was created using Golgin-97 counter staining and this mask was used to quantify signal from trans Golgi as well as the cytoplasm. Golgi localization of immunofluorescence staining of endogenous proteins (ORP9, ORP11, CERT) and the PI(4)P antibody was performed first by creating a mask using Golgin-97 and later using this mask to quantify signal of interest relative to signal of Golgin-97. Manders’ coefficient for colocalization was calculated using the Jacop plugin for ImageJ/FIJI.
Flow cytometry analysis
MelJuSo cells were brought to suspension by trypsinization and stained with the indicated probes on ice prior to analysis using a BD LSR-II equipped with 488 and 561nm lasers. Data was analysed using FlowJo v.10 software.
Electron microscopy
Cells cultured in 6-cm dishes were fixed for an hour at room temperature by adding double concentrated fixative to the medium (final concentration: 1.5% glutaraldehyde in 0.1M cacodylate buffer). After three times rinsing with 0.1 M cacodylate buffer, the cells were postfixed with 1% osmium tetroxide and 1.5% uranyl acetate. Cells are dehydrated with a series of ethanol, followed by a series of mixtures of ethanol and EPON (LX112, Leadd) and at the end pure EPON. BEEM capsules filed with EPON were placed on the dishes with the open face down. After EPON polymerization at 40°C the first night and 70°C the second night, the BEEM capsules were snapped off. Ultrathin sections 80 nm were made parallel to the surface of the BEEM capsules containing the cultured cells. The sections were contrasted with uranyl acetate and lead hydroxide and examined with a Tecnai Twin transmission electron microscope (Thermo Fisher, Eindhoven, Netherlands). Overlapping images were automatically collected and stitched together into a composite image as previously described65.
Recombinant protein expression and purification
A codon optimized version of cDNA encoding the non-toxic version of equinatoxin22 was ordered from IDT technologies, GFP sequence was obtained from meGFP-C1 vector and a cDNA encoding the fusion protein was synthesized using Gibson Assembly. A codon optimized version of cDNA encoding the PH domain of FAPP1 containing the T13C, C37S, and C94Smutations were ordered from IDT technologies. cDNA encoding human VAPB gene was described previously27. cDNAs encoding ORD domains of ORP9 and ORP11, VAPB without its C-terminal transmembrane helix, FAPP1-PH, and EQT-GFP fusion protein were cloned into a pNKI1.8/GST-expression vector.
For FAPP1-PH and VAPB-His expressions E. coli BL21 was grown in LB medium and expression was induced when OD600 was at 0.6 for overnight at 18°C. For other proteins, E. coli BL21/Rosetta were grown in 2xYT medium and expression was induced when OD600 was at 1 for overnight at 18°C. Bacterial pellets were resuspended in GST purification buffer (50mM Tris pH 8.0, 250mM NaCl, 1mM EDTA, 1mM DTT) and lysed by tip sonication. Lysates were cleared by centrifugation at 12,000xg for 30 min. Proteins were purified using Glutathione Sepharose™ 4 Fast Flow (GE Healthcare #17-5132-03) and cleaved using 3C protease protein prior to reverse purification using glutathione beads followed by a HiLoad 16/60 Superdex 75 size exclusion chromatography.
Full-length ORP9 and ORP11 were expressed using a baculovirus expression in Spodoptera frugiperda (Sf9) using an adapted Bac-to-Bac system (Invitrogen). In brief, cDNAs were cloned to an in-house insect expression vector and bacmids were generated using EmBacY cells (Geneva Biotech) isolated using isopropanol precipitation. 10 μg Bcmid was transfected to sedentary Sf9 cells using CellFectin (Invitrogen) in SFM-II medium (Gibco) in a 6-well plate at 28 °C. Virus-containing medium was harvested (P0) after 72 hours for infection of 106 cells in Insect-Express medium (Lonza) to be cultured at 28°C while constant shaking. Cells were harvested by centrifugation after 72 hours and purified using Strep-Tactin Sepharose beads (iba #2-1201-010).
NBD-labelling of FAPP1-PH
Labelling of FAPP1-PH was performed according to ref.37. In brief, purified protein was incubated with 5- fold excess IANBD-amide overnight (Setareh Biotech #6281) followed by quenching of unbound dye with L-cysteine 5-fold excess of the dye. Next, labelled protein was subjected to Zeba Spin desalting column (Thermo Fisher #89890). Labelling efficiency was determined by absorbances at 280nm and 480nm using a NanoDrop.
Methyl-β-cyclodextrin and MTT viability assay
Cells were seeded in a 96-well plate and were cultured in OptiMEM (ThermoFisher #31985047) for 3 days. Cells were treated with 10mM methyl-β-cyclodextrin (Sigma #C4555) and cell viability was tested using MTT viability assay (Cayman #21795). Absorbance at 560nm was measured using a BMG ClarioStar plate reader.
Liposome preparations
For PS transfer assay using ORDs, donor liposomes composed of 2% NBD-PS (Avanti #810194), 2% Rhodamine-PE (Avanti #810150), 10% DOPE (Avanti #850725), 86% DOPC (Avanti #850375) and acceptor liposomes composed of DOPC with or without 5% brain PI(4)P (Avanti #840045) were used. For PS transfer assays using full-length proteins, donor liposomes composed of 2% NBD-PS, 2% Rhodamine- PE, 2% 18:1 DGS-NTA(Ni) (Avanti# 790404), 10% POPE (Avanti # 850757) and 84% POPC (Avanti #850457) and acceptor liposomes of 85% POPC, 10% POPE and 5% brain PI4P were used. For PI4P transfer assays, donor liposomes were 95% DOPC and 5% POPS (Avanti # 840034) and acceptor liposomes were 93% DOPC and 5% PI4P (Echelon #P-4016), and 2% Rhodamine-PE.
Lipids were mixed in a glass container and dried under a constant nitrogen flow to create a film. Lipids were freeze-dried at least for two hours under vacuum. Next, lipid films were rehydrated in HKM (50mM HEPES pH 7.2; 120mM potassium acetate; 1mM MgCl2) buffer for 30 minutes followed by 5 cycles of freeze thaw. Lipids were extruded using Avanti MiniExtruder using a 100nm or 200nm filter. Uniformity of lipids were confirmed using a Wyatt Nanostar Dynamic Light Scattering.
Lipid transfer assays
For PS transfer assays using ORDs, final concentrations of 80µM of each donor and acceptor vesicles were used in 100µL volume and the indicated amounts of protein of interest was added in 5µL. NBD fluorescence in time was measured using a BMG ClarioStar plate reader. For PS transfer assay using full- length proteins, 100µM of each donor and acceptor vesicles were used with 150nM ORP9, 150nM ORP11 and 450nM VAPB-His. Maximum rate of transfer (Vmax) was calculated using a self-starting non-linear least squares function implemented in R (SSmicmen) after background subtraction to no protein control and normalizing to maximum amount of fluorescence obtained after addition of 2% CHAPS. PI4P transfer assay were adapted from ref.37. Donor and acceptor liposomes were first incubated with 500nM NBD- labelled FAPP1-PH for 5 minutes before addition of 150nM ORD9 or ORD11. Data was fit using a self- starting non-linear least squares function implemented in R (SSmicmen).
Liposome floatation
10µM VAPB-His was incubated 360µM liposomes containing NTA-DGS lipids in 100µL HKM buffer for 30min at RT before mixing with 0.3mL HKM buffer containing 54% sucrose to obtain final concentration of 40.5% sucrose. Samples were laid at the bottom of an ultracentrifuge tube and cushioned with HKM buffer containing 30% and 0% sucrose. Samples were centrifuged at 200,000xg for 2 hours at 4°C and fractions were collected for Coomassie blue staining.
Liposome tethering
100nM of each ORP9, ORP11 and VAPB-His were incubated with donor and acceptor liposomes for 1h at RT. Diameter of liposomes were measured using a Wyatt Nanostar Dynamic Light Scattering.
AlphaFold & AlphaFold-multimer predictions
Structure predictions were performed using AlphaFold, AlphaFold-Multimer and ColabFold prediction tools, as described66–68.
Golgi isolation and quantification of Golgi lipid levels
Cells were washed twice with 0.25M Sucrose and scraped in IM buffer (0.25M Mannitol, 0.5mM EGTA, 5mM HEPES pH 7.4). Samples were passed through a 26xG needle for lysis. Lysates were cleared from nuclei by centrifugation twice at 600xg for 5min. Post-nuclear supernatant was subjected to protein determination using BCA protein determination kit. Equal amounts of protein were supplemented with 150mM NaCl and incubated with Protein A/G Magnetic Beads (ThermoFisher #88802) preloaded either or not with Golgin-97 antibody. Next, samples were washed 3 times with IM buffer supplemented with 150mM NaCl before lipid extraction for lipidomics analysis (described above) or enzymatic activity assay (described below). Amounts of Golgi fractions isolated from different knockouts were confirmed by western blotting.
siRNA transfections and metabolic chasing of BODIPY-C5-ceramide in intact cells
siRNA transfections were carried out as described previously27. siRNA for UGCG (M-006441-02-0005) and UGT8 (M-010270-02-0005) were obtained from Horizon Discovery. MelJuSo cells treated with siRNAs or 10µM PDMP (Cayman #62595) were washed twice with PBS and incubated with serum-free medium supplemented with 0.25µM BODIPY-C5-Ceramide complexed to BSA (Thermo Fisher #B22650). After 3 hours, cells were subjected to lipid extraction and thin layer chromatography as described below. The following lipids were used as standards: TopFlour-C11-galactosylceramide (Avanti Polar Lipids #810266), TopFlour-C11-glucosylceramide (Avanti Polar Lipid #810267) and BODIPY- C5-Lactosylceramide (Thermo Fisher #B34402).
Metabolic chasing of de novo sphingomyelin synthesis
Cells were incubated with 20µM ethanolic palmitic acid alkyne (Cayman Chemical #13266) in serum-free medium for 6 hours. Next, cells were washed twice in PBS and scraped in 2%NaCl solution. Lysates were subjected to protein determination using Pierce BCA Protein Kit (Thermo #23225) and equal amounts of proteins were used for lipid extractions as above. For alkaline hydrolysis, dried lipids were resuspended in 200µL methanolic sodium methoxide and incubated at room temperature for 1h. Samples were added 30µL acetic acid/water (1:4, v/v), 120µL 2% NaCl, and 400µL chloroform to re-extract lipids. Dried lipids were resuspended in 15µL chloroform and 65µL of click mix containing 400µM 3-Azido-7-hydroxycoumarin (Baseclick #BCFA-047-1) and 900µM tetrakis(acetonitrile)copper(I) tetrafluoroborate (Sigma #677892) in acetonitrile/ethanol (7:3, v/v) was added and incubated 3h at 45°C prior to TLC analysis.
Quantitative RT-PCR
RT-PCR was performed as described previously27 using the following primer sets:
CERT_1: ATGTCGGATAATCAGAGCTGGA / ATCCTGCCACCCATGAATGTA,
CERT_2: TCCATCTGTCTTAGCAAGGCT / GCTGTTCAATGGCATCTATCCA,
SMS1_1: TGTGCCGAGTCTCCTCTGA / CCGTTCTTGTGTGCTTCCAAA,
SMS1_2: CAGCATCAAGATTAAACCCAACG / TGGTGAGAACGAAACAGGAAAG,
SMS2_1: TCCTACGAACACTTATGCAAGAC / CCGGGTACTTTTTGGTGCCT,
SMS2_2: CAAATTGCTATGCCCACTGAATC / GTTGTCAAGACGAGGTTGAAAAC
Enzymatic activity assay in lysates and isolated Golgi fractions
For enzymatic activity measurements in lysates, cells were washed twice in 0.25M Sucrose and scraped in IM buffer (0.25M Mannitol, 0.5mM EGTA, 5mM HEPES pH 7.4). Samples were passed through a 26xG needle for lysis. Lysates were cleared from nuclei by centrifugation twice at 600xg for 5min. Post-nuclear supernatant was subjected to protein determination using BCA protein determination kit. Equal amounts of protein in a 50µL volume were mixed with 50µL IM buffer supplemented with 5µM NBD-C6-ceramide (Avanti Polar Lipids #8102109) from an ethanolic solution. Reactions were incubated 1h at 37°C in dark with constant shaking. Next, samples were subjected to lipid extractions and thin-layer chromatography as described. For the enzymatic activity assays in Golgi, isolated Golgi fractions were resuspended in 50µL IM buffer and incubated with NBD-C6-ceramide as above.
Thin-layer chromatography
Dried lipids were spotted on a thin-layer chromatography (TLC) Silica gel 60 (Merck #1.05554.0001) plate and developed in chloroform:methanol:acetone:acetic acid:water (50:10:20:10:5, v/v/v/v/v). Fluorescent images were acquired using a Typhoon FLA9500 equipped with a 488nm laser and a BPB1 filter (530DF20).
Gene expression analysis
Gene expression profiles from 947 cancer cell lines were obtained from the Cancer Cell Line Encyclopedia69.
Plasmids


Antibodies



Glucosylceramide is the main hexosylceramide in MelJuSo cells.
(A) MelJuSo cells silenced for glucosylceramide synthase (siUGCG) or galactosylceramide synthase (siUGT8) or treated with the glucosylceramide synthase inhibitor (PDMP) were fed with the fluorescent ceramide analog BODIPY-C5-ceramide. Lipids were isolated and separated by thin-layer chromatography. Note that the fluorescent band corresponding to monohexosylceramide is affected only when glucosylceramide synthesis is perturbed. (B) Quantifications corresponding to panel A. Bars and error bars correspond to mean and standard deviations from 4 experiments, respectively.

Overview of lipidomics analysis performed for LTP knockout library.
(A) Percentage distribution of 17 lipid classes in LTP knockout cells; each data point represents the mean percentage of an LTP knockout cell line. (B) Box plots of Z-scores of NT control cells. Note that Z-scores for NT control cells do not exceed the absolute value of 2. PC: phosphatidylcholine, LPC: lysophosphatidylcholine, PE: phosphatidylethanolamine, LPE: lysophosphatidylethanolamine, PS: phosphatidylserine, PA: phosphatidic acid, PG: phosphatidylglycerol, PI: phosphatidylinositol, DCer: dihydroceramide, Cer: ceramide, SM: sphingomyelin, HexCer: hexosyl-ceramide, LacCer: lactosylceramide, DG: diacylglycerol, TG: triacylglycerol, CE: cholesterol ester, and FFA: free fatty acid.

GLTP, NPC1 and NPC2 knockout cells do not display major phospholipid imbalances.
(A, B) Lipidomics analysis of GLTP knockouts show lowered glucosylceramide levels that is represented in various acyl chain species. (C) GLTP knockouts do not present altered phospholipid levels. (D) Lipidomics analysis of NPC1 and NPC2 knockout cells do not display major changes in their phospholipid repertoire. (E) Coomassie Blue staining of recombinant EQT-GFP.

Sphingolipid imbalances in CERT, ORP9 and ORP11 knockouts are represented in multiple acyl chain species.
(A) CERT, ORP9 and ORP11 knockouts do not display major phospholipid imbalances. (B) Reduced sphingomyelin and increased glucosylceramide levels in CERT, ORP9 and ORP11 knockout cells is observed in multiple acyl chain species. Lipid levels are normalized to the POPC (16:0/18:1) levels.

CERT, ORP9 and ORP11 knockouts do not display defects in Golgi morphology.
(A) Immunofluorescence staining for cis and trans Golgi markers, GM130 and Golgin-97 respectively, do not show any changes in ORP9, ORP11 and CERT knockouts. Scale bar 10µm. (B) Electron microscopy images for ORP9 and ORP11 knockouts do not display any changes in Golgi morphology. Scale bar 250nm.

ORP9 and ORP11 interact with each other via their coiled coils.
(A) AlphaFold prediction of ORP9 and ORP11 reveals secondary structures between their PH and ORD domains. (B) PCOILS predicts coiled coils in the same of both proteins. Residues corresponding to coiled coils are highlighted. (C) AlphaFold-multimer / ColabFold prediction for ORP9-ORP11 coils dimerization. (D) Predicted local distance difference test (pLDDT) and position aligned error plots for panel C. (E) Predicted local distance difference test for figure 4C. (F) Unique peptide counts from BioID experiments performed with VAPA, VAPB, MOSPD1, MOSPD2, and MOSPD3 from Cabukusta et al. 2020. Both ORP9 and ORP11, despite latter lacking a FFAT motif, detected in BioID experiments with VAPA and VAPB.

ORP9 and ORP11 are needed for maintaining phospholipid levels in the Golgi.
(A) Coomassie Blue staining of recombinant OSBP-related domains of ORP9 and ORP11. (B) ORP9 and ORP11 contain the critical residues for PS transfer.

Loss of ORP9 or ORP11 does not affect sphingomyelin synthase levels.
(A) Western blot analysis showing that the protein two human sphingomyelin synthases, SMS1 and SMS2, are not affected in ORP9 and ORP11 knockouts. (B) qRT-PCR showing that mRNA levels of SMS1 and SMS2 are not affected dramatically in knockout cells. Two primer sets per protein each was used (shown with roman numbers). Red lines correspond to mean values. (C) Thin-layer chromatography analysis visualizing the conversion of palmitic acid alkyne to sphingomyelin. To define the band corresponding to sphingomyelin, cells were treated with PDMP or with a cocktail of fumonisin B1 and myriocin prior to alkaline hydrolysis. (D) Golgi quantification of the DAG sensor, mCherry-C1ab, indicates reduced DAG levels in this organelle. Red lines correspond to mean from 3 experiments.

CERT is not less present in the Golgi of ORP9 and ORP11 knockouts.
(A) Immunofluorescent staining of ORP9, ORP11 and CERT knockout cells using two antibodies against CERT. Note that antibodies fail to stain the Golgi in CERT knockouts. (B) Quantifications corresponding to panel A. Loss of ORP9 or ORP11 do not reduce CERT localization at the Golgi. Note that loss of ORP11 increases CERT localization at the Golgi, shown by two antibodies. Red lines correspond to mean from 3 experiments.

Immunomagnetic isolation yields to intact Golgi membranes.
(A) Sphingomyelin synthase enzymatic activity assay performed on immunomagnetic Golgi isolates shows that the isolated membranes are intact and enzymatically active. Sphingomyelin synthases contain six transmembrane helices and require intact membrane for activity (Tafesse et al. 2006 “The Multigenic Sphingomyelin Synthase Family” J Biol Chem Volume 281, Issue 40). (B) Western blotting of immunomagnetic Golgi isolations from knockout cells using Golgin-97 antibody. (C) Amount of lipids isolated from samples in the absence or presence of the trans Golgi specific antibody Golgin-97. The plot is based on 16 data points obtained from n=4 experiments. Data points and error bars correspond to mean and standard deviations, respectively. (D) Distribution of PS species. (E) Distribution of sphingomyelin species. (F) Distribution of ceramide species.

Golgi localization of sphingomyelin synthases is not reduced in ORP9 and ORP11 knockout cells.
(A) Immunofluorescence images showing localization of sphingomyelin synthases in ORP9 and ORP11 knockout cells. (B) Quantification of images corresponding to panel A. Note that the localization of SMS1 or SMS2 is not reduced in the knockout cells. An increased localization for SMS1 in the Golgi apparatus in ORP9 knockout cells is detected by two antibodies. Red lines correspond to mean from 3 experiments.

ORP10 knockouts do not display sphingolipid imbalances.
(A) Lipidomics analysis of ORP10 knockouts do not reveal sphingolipid imbalances that are observed in ORP9 or ORP11 knockouts. (B) Expression analysis from Cancer Cell Line Encyclopedia shows that ORP9, ORP10 and ORP11 are not differentially expressed, but show a positive correlation.
References
- 1.Lipid map of the mammalian cellJ. Cell Sci 124:5–8Google Scholar
- 2.Lipid transfer proteins: the lipid commute via shuttles, bridges and tubesNature Reviews Molecular Cell Biology 20:85–101Google Scholar
- 3.The orchestra of lipid- transfer proteins at the crossroads between metabolism and signalingProg. Lipid Res 61:30–39Google Scholar
- 4.Coming together to define membrane contact sitesNat. Commun 10:1–11Google Scholar
- 5.The functional universe of membrane contact sitesNat. Rev. Mol. Cell Biol 21Google Scholar
- 6.A new family of StART domain proteins at membrane contact sites has a role in ER-PM sterol transportElife 4:1–46Google Scholar
- 7.Aster Proteins Facilitate Nonvesicular Plasma Membrane to ER Cholesterol Transport in Mammalian CellsCell 175:514–529Google Scholar
- 8.ATG2 transports lipids to promote autophagosome biogenesisJ. Cell Biol 218:1787–1798Google Scholar
- 9.Atg2 mediates direct lipid transfer between membranes for autophagosome formationNat. Struct. Mol. Biol 26:281–288Google Scholar
- 10.Phospholipid transfer function of PTPIP51 at mitochondria-associated ER membranesEMBO Rep 22Google Scholar
- 11.VPS13A and VPS13C are lipid transport proteins differentially localized at ER contact sitesJ. Cell Biol 217:3625–3639Google Scholar
- 12.Systematic analysis of membrane contact sites in Saccharomyces cerevisiae uncovers modulators of cellular lipid distributionElife 11Google Scholar
- 13.A novel superfamily of bridge-like lipid transfer proteinsTrends Cell Biol 32:962–974Google Scholar
- 14.Lipid landscapes and pipelines in membrane homeostasisNature 510:48–57Google Scholar
- 15.Molecular machinery for non-vesicular trafficking of ceramideNature 426:803–809Google Scholar
- 16.Genome-scale requirements for dynein-based trafficking revealed by a high- content arrayed CRISPR screenbioRxiv https://doi.org/10.1101/2023.03.01.530592Google Scholar
- 17.Glucosylceramide and galactosylceramide, small glycosphingolipids with significant impact on health and diseaseGlycobiology 31:1416–1434Google Scholar
- 18.Glycolipid transfer protein knockout disrupts vesicle trafficking to the plasma membraneJ. Biol. Chem 299Google Scholar
- 19.Sphingolipid lysosomal storage disordersNature 510:68–75Google Scholar
- 20.Niemann-Pick type C disease: The atypical sphingolipidosisAdv. Biol. Regul 70:82–88Google Scholar
- 21.Pathogenic variants of sphingomyelin synthase SMS2 disrupt lipid landscapes in the secretory pathwayElife 11Google Scholar
- 22.Sphingomyelin is sorted at the trans Golgi network into a distinct class of secretory vesicleProc. Natl. Acad. Sci. U. S. A 113:6677–6682Google Scholar
- 23.Structure, functions and regulation of CERT, a lipid-transfer protein for the delivery of ceramide at the ER–Golgi membrane contact sitesFEBS Lett 593:2366–2377Google Scholar
- 24.OSBP-related protein 11 (ORP11) dimerizes with ORP9 and localizes at the Golgi- late endosome interfaceExp. Cell Res 316:3304–3316Google Scholar
- 25.What the VAP: The Expanded VAP Family of Proteins Interacting With FFAT and FFAT-Related Motifs for Interorganellar ContactContact 4:251525642110122Google Scholar
- 26.Identification of MOSPD2, a novel scaffold for endoplasmic reticulum membrane contact sitesEMBO Rep 19:1–22Google Scholar
- 27.Human VAPome Analysis Reveals MOSPD1 and MOSPD3 as Membrane Contact Site Proteins Interacting with FFAT-Related FFNT MotifsCell Rep 33:108475Google Scholar
- 28.The pleckstrin homology domain of oxysterol-binding protein recognises a determinant specific to Golgi membranesCurr. Biol 8:729–739Google Scholar
- 29.Targeting of Golgi-specific pleckstrin homology domains involves both Ptdlns 4-kinase-dependent and -independent componentsCurr. Biol 12:695–704Google Scholar
- 30.ORP2 Delivers Cholesterol to the Plasma Membrane in Exchange for Phosphatidylinositol 4, 5-Bisphosphate (PI(4,5)P 2)Mol. Cell 73:458–473Google Scholar
- 31.A four-step cycle driven by PI(4)P hydrolysis directs sterol/PI(4)P exchange by the ER-Golgi Tether OSBPCell 155:830–843Google Scholar
- 32.Osh4p exchanges sterols for phosphatidylinositol 4-phosphate between lipid bilayersJ. Cell Biol 195:965–978Google Scholar
- 33.Interactome map uncovers phosphatidylserine transport by oxysterol-binding proteinsNature 501:257–261Google Scholar
- 34.A phosphoinositide signalling pathway mediates rapid lysosomal repairNature 609:815–821Google Scholar
- 35.PI4P/PS countertransport by ORP10 at ER–endosome membrane contact sites regulates endosome fissionJ. Cell Biol 221Google Scholar
- 36.ORP9 and ORP10 form a heterocomplex to transfer phosphatidylinositol 4-phosphate at ER-TGN contact sitesCell. Mol. Life Sci 80Google Scholar
- 37.Functional analyses of phosphatidylserine/PI(4)P exchangers with diverse lipid species and membrane contexts reveal unanticipated rules on lipid transferBMC Biol 19:248Google Scholar
- 38.PI4P/phosphatidylserine countertransport at ORP5- and ORP8-mediated ER - Plasma membrane contactsScience (80-.) 349:428–432Google Scholar
- 39.Phosphatidylserine transport by ORP/Osh proteins is driven by phosphatidylinositol 4-phosphateScience 349:432–436Google Scholar
- 40.Phosphoinositides as membrane organizersNat. Rev. Mol. Cell Biol 23:797–816Google Scholar
- 41.Membrane phosphatidylserine regulates surface charge and protein localizationScience 319:210–213Google Scholar
- 42.Multiple host proteins that function in phosphatidylinositol-4-phosphate metabolism are recruited to the chlamydial inclusionInfect. Immun 78:1990–2007Google Scholar
- 43.Switching head group selectivity in mammalian sphingolipid biosynthesis by active- site-engineering of sphingomyelin synthasesJ. Lipid Res 58:962–973Google Scholar
- 44.The multigenic sphingomyelin synthase familyJ. Biol. Chem 281:29421–29425Google Scholar
- 45.Sphingolipid metabolic flow controls phosphoinositide turnover at the trans-Golgi networkEMBO J 36:1736–1754Google Scholar
- 46.Coordinated lipid transfer between the endoplasmic reticulum and the Golgi complex requires the VAP proteins and is essential for Golgi- mediated transportMol. Biol. Cell 19:3871–3884Google Scholar
- 47.StarD7 mediates the intracellular trafficking of phosphatidylcholine to mitochondriaJ. Biol. Chem 285:7358–7365Google Scholar
- 48.PARL partitions the lipid transfer protein STARD7 between the cytosol and mitochondriaEMBO J 37:1–18Google Scholar
- 49.StarD7 protein deficiency adversely affects the phosphatidylcholine composition, respiratory activity, and cristae structure of mitochondriaJ. Biol. Chem 291:24880–24891Google Scholar
- 50.Molecular determinants of ER-Golgi contacts identified through a new FRET-FLIM systemJ. Cell Biol 218:1055–1065Google Scholar
- 51.Translocation of oxysterol binding protein to Golgi apparatus triggered by ligand bindingJ. Cell Biol 116:307–319Google Scholar
- 52.Nanoscale architecture of a VAP-A-OSBP tethering complex at membrane contact sitesNat. Commun 12:3459Google Scholar
- 53.CERT1 mutations perturb human development by disrupting sphingolipid homeostasisJ. Clin. Invest 133Google Scholar
- 54.Lipid Transfer Proteins and Membrane Contact Sites in Human CancerFront. Cell Dev. Biol 7:1–14Google Scholar
- 55.DGARM/C10orf76/ARMH3 for Ceramide Transfer Zone at the Endoplasmic Reticulum–Distal Golgi ContactsContact 7:25152564241239444Google Scholar
- 56.Mammalian PITPs at the Golgi and ER-Golgi Membrane Contact SitesContact 3:2515256420964170Google Scholar
- 57.Cholesterol transfer via endoplasmic reticulum contacts mediates lysosome damage repairEMBO J 41Google Scholar
- 58.Sphingomyelin synthase-related protein SMSr controls ceramide homeostasis in the ERJ. Cell Biol 185:1013–1027Google Scholar
- 59.Sterol transfer, PI 4P consumption, and control of membrane lipid order by endogenous OSBPEMBO J 36:3156–3174Google Scholar
- 60.Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9Nat. Biotechnol 34:184–191Google Scholar
- 61.Improved vectors and genome-wide libraries for CRISPR screeningNat. Methods 11:783–784Google Scholar
- 62.CRISPR Activation Screening Identifies VGLL3-TEAD1-RUNX1/3 as a Transcriptional Complex for PD-L1 ExpressionJ. Immunol https://doi.org/10.4049/JIMMUNOL.2100917Google Scholar
- 63.Cross-Laboratory Standardization of Preclinical Lipidomics Using Differential Mobility Spectrometry and Multiple Reaction MonitoringAnal. Chem 93:16369–16378Google Scholar
- 64.A DMS Shotgun Lipidomics Workflow Application to Facilitate High-Throughput, Comprehensive LipidomicsJ. Am. Soc. Mass Spectrom 32:2655–2663Google Scholar
- 65.Virtual nanoscopy: generation of ultra-large high resolution electron microscopy mapsJ. Cell Biol 198:457–469Google Scholar
- 66.Highly accurate protein structure prediction with AlphaFoldNature 596:583–589Google Scholar
- 67.ColabFold: making protein folding accessible to allNat. Methods 19:679–682Google Scholar
- 68.Protein complex prediction with AlphaFold-MultimerbioRxiv https://doi.org/10.1101/2021.10.04.463034Google Scholar
- 69.The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivityNature 483:603–607Google Scholar
- 70.SAC1 degrades its lipid substrate PtdIns4P in the endoplasmic reticulum to maintain a steep chemical gradient with donor membranesElife 7Google Scholar
Article and author information
Author information
Version history
- Preprint posted:
- Sent for peer review:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.91345. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2023, Cabukusta et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 2,892
- downloads
- 254
- citations
- 19
Views, downloads and citations are aggregated across all versions of this paper published by eLife.