Abstract
Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common genetic cause of Parkinson’s disease (PD), which is the leading neurodegenerative movement disorder characterized by the progressive loss of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNpc). However, whether LRRK2 mutations cause PD and degeneration of DA neurons via a toxic gain-of-function or a loss-of-function mechanism is unresolved and has pivotal implications in LRRK2 based PD therapy. In this study, we investigate whether LRRK2 and its functional homologue LRRK1 play an essential, intrinsic role in DA neuron survival through the development of DA neuron-specific LRRK conditional double knockout (cDKO) mice. We first generated and characterized floxed LRRK1 and LRRK2 mice and then confirmed that germline deletions of the floxed LRRK1 and LRRK2 alleles result in null alleles, as evidenced by the absence of LRRK1 and LRRK2 mRNA and protein in the respective homozygous deleted mutant mice. We further examined the specificity of Cre-mediated recombination driven by the dopamine transporter-Cre (DAT-Cre) knockin (KI) allele using a GFP reporter line and confirmed that DAT-Cre-mediated recombination is restricted to DA neurons in the SNpc. Crossing these validated floxed LRRK1 and LRRK2 mice with DAT-Cre KI mice, we then generated DA neuron-restricted LRRK cDKO mice and further showed reduced levels of LRRK1 and LRRK2 in dissected ventral midbrains of LRRK cDKO mice. While DA neuron-restricted LRRK cDKO mice of both sexes exhibit normal mortality and body weight, they develop age-dependent loss of DA neurons in the SNpc, as demonstrated by the progressive reduction of DA neurons in the SNpc of cDKO mice at 20 and 24 months of age. Moreover, DA neurodegeneration is accompanied with increases of apoptosis and elevated microgliosis in the SNpc of LRRK cDKO mice. These findings provide unequivocal evidence for the importance of LRRK in DA neurons and raise the possibility that LRRK2 mutations may impair its protection of DA neurons, leading to the loss of DA neurons in Parkinson’s disease.
Introduction
Parkinson’s disease (PD) is the most common movement disorder and is characterized by the progressive loss of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNpc). Dominantly inherited missense mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are the most common cause of both familial and sporadic PD, highlighting the importance of LRRK2 in PD pathogenesis (1–16). LRRK2 is a large protein of 2,527 amino acid residues containing several functional domains including several leucine-rich repeats (LRRs), a GTPase-like domain of Ras-of-complex (Roc), a C-terminal of Roc (COR) domain, and a serine/threonine MAPKKK-like kinase domain. LRRK1, a homologue of LRRK2, belongs to the evolutionarily conserved Roco protein family and contains similar LRRs, Roc, COR, and kinase domains (17–19). LRRK proteins are broadly expressed with LRRK2 being most abundant in the kidney (20). While most PD mutations are found in LRRK2, rare variants in the Roc, COR, and kinase domains of LRRK1 have been reported and may be associated with PD (21). Furthermore, the Roc-COR domain of LRRK2 forms dimers and exhibits conventional Ras-like GTPase properties, and the R1441/C/G/H and I1371V mutations destabilize dimer formation and decrease GTPase activity (22, 23). Recent high-resolution cryoEM structural studies of full-length LRRK2 demonstrated its existence as dimers and pathogenic mutations such as R1441/C/G/H and Y1699I at the Roc-COR interface, whereas the G2910S mutant and wild-type LRRK2 share similar structure (24).
Previous genetic studies demonstrated that LRRK2 plays essential roles in the autophagy-lysosomal pathway (25–28). Consistent with abundant expression of LRRK2 in kidneys, LRRK2-/-mice develop age-dependent phenotypes in the kidney, including autophagy-lysosomal impairments and increases of α-synuclein, apoptosis, and inflammatory responses (25, 26, 29). It has also been reported that LRRK2 is important for maintaining lung homeostasis, and LRRK2 deficiency results in impaired autophagy in alveolar type II epithelial cells (28). It was proposed that the lack of brain phenotypes in LRRK2-/-mice might be due to the presence of LRRK1 and potential functional compensation mechanisms (25, 26). Indeed, LRRK double knockout (DKO) mice develop age-dependent, progressive loss of DA neurons in the SNpc, beginning at 14 months of age (30). However, LRRK DKO mice also exhibit lower body weight and increased mortality, raising the possibility that DA neurodegeneration in LRRK DKO mice may be secondary to poor health.
In this study, we investigate whether LRRK2 and its functional homologue LRRK1 play an essential, intrinsic role in DA neuron survival through the development of DA neuron-specific LRRK conditional DKO (cDKO) mice. We first generated and confirmed floxed LRRK1 and LRRK2 mice, and then crossed them with the deleter CMV-Cre to create germline deletions of the floxed LRRK1 and LRRK2 alleles, followed by Northern and Western analyses to confirm the absence of LRRK1 and LRRK2 mRNA and protein in the respective homozygous deleted mutant mice. We also crossed a GFP reporter mouse with DAT-Cre KI mice and found that Cre-mediated recombination occurs in most, if not all, DA neurons and is restricted to DA neurons in the SNpc. We then crossed these thoroughly validated floxed LRRK1 and LRRK2 mice with DAT-Cre KI mice to generate DA neuron-restricted LRRK cDKO mice and further confirmed the reduction of LRRK1 and LRRK2 in dissected ventral midbrains of LRRK cDKO mice. While DA neuron-restricted LRRK cDKO mice of both sexes exhibit normal mortality and body weight, they develop age-dependent loss of DA neurons in the SNpc, as demonstrated by the progressive reduction of TH+ DA neurons or NeuN+ neurons in the SNpc of cDKO mice at 20 and 24 months of age. Interestingly, quantitative electron microscopy analysis showed a similar number of electron-dense vacuoles in SNpc neurons of LRRK cDKO mice relative to controls, in contrast to age-dependent, dramatic increases of vacuoles in SNpc neurons of germline LRRK DKO mice (30, 31). Moreover, DA neurodegeneration is accompanied with increases of apoptosis and elevated microgliosis in the SNpc of LRRK cDKO mice. These findings provide unequivocal evidence for the importance of LRRK in DA neurons and raise the possibility that LRRK2 mutations may impair this crucial physiological function, leading to the loss of DA neurons in Parkinson’s disease.
Results
Generation and molecular characterization of the floxed and deleted LRRK1 and LRRK2 alleles
LRRK2 and its homologue LRRK1 share several functional (LRRs, GTPase Roc, COR, and kinase) domains (Figure 1A). To investigate the intrinsic role of LRRK in DA neurons, we generated floxed LRRK1 (fLRRK1) and floxed LRRK2 (fLRRK2) mice, which permit deletions of LRRK1 and LRRK2 selectively in DA neurons by DAT-Cre, which expresses Cre recombinase under the control of the endogenous DAT promoter (32). We introduced two loxP sites in introns 26 and 29 of LRRK1 through homologous recombination and site-specific recombination by FLP recombinase to remove the positive selection PGK-neo cassette, which is flanked by two FRT sites (Figure 1B, C; Figure 1-figure supplement 1, 2). The embryonic stem (ES) cells carrying the targeted allele or the floxed allele were identified and validated by Southern analysis using the 5’ and 3’ external probes as well as the neo probe (Figure 1D; Figure 1-figure supplement 3). The validated ES cells carrying the floxed LRRK1 allele were injected into mouse blastocysts to develop floxed LRRK1 mice, which were further confirmed by Southern using the 5’ and 3’ external probes (Figure 1D). In the presence of Cre recombinase, the floxed LRRK1 region containing part of intron 26 (1,288 bp), exons 27-29, which encode the kinase domain, and part of intron 29 (1,023 bp) is deleted (Figure 1C), and the removal of exons 27-29 (625 bp) results in a frameshift of downstream codons.

Generation and characterization of floxed and deleted LRRK1 and LRRK2 alleles
(A) Schematic illustrations of human LRRK1 and LRRK2 proteins showing similar functional domains. LRRK12015 protein is derived from exons 2-34 (Ensembl Genome Database: ENSG00000154237). LRRK22527 protein is derived from exons 1-51 (ENSG00000188906). LRR: Leucine rich repeats; Roc: Ras-of-complex; COR: C-terminal of Roc; KIN: Kinase domain.
(B) Schematic illustrations of the gene structures of mouse LRRK1 and LRRK2. The boxes in blue are exons that encode the LRRK1 and LRRK2 proteins, and the gray boxes represent the 5’ and 3’ UTRs. The exons are not drawn in scale. The start codon ATG is in exon 2 of LRRK1 and exon 1 of LRRK2. The exons 27-29 of LRRK1 and the promoter/exons 1-2 of LRRK2 are flanked with loxP sites (green arrowheads).
(C) Targeting strategy for the generation of the targeted, floxed, and deleted LRRK1 alleles. The red boxes represent the targeted exons 27-29, and the blue boxes represent the untargeted exons. The locations and sizes of the 5’ and 3’ external probes are shown. The targeting vector contains the 5’ and 3’ homologous regions (marked by dashed lines) and the middle-targeted region, which includes a loxP site (green arrowhead) in intron 26 (1,288 bp upstream of exon 27) and the PGK-neo selection cassette flanked by two FRT (FLP recognition target) sequences (gray circles) followed by another loxP site in intron 29 (1,023 bp downstream of exon 29). A negative selection cassette encoding diphtheria toxin fragment A (DTA) is also included in the targeting vector to reduce ES cells bearing randomly inserted targeting vectors. ES cells carrying the correctly targeted LRRK1 allele were transfected with pCAG-FLP to remove the PGK-neo cassette and generate the floxed LRRK1 allele. Floxed LRRK1 mice were bred with CMV-Cre transgenic mice to generate germline deleted LRRK1 mice. Detailed strategy for generating targeting vector and DNA sequence of floxed LRRK1 allele can be found in Figure 1-figure supplement 1 and 2, respectively.
(D) Southern analysis of the targeted and floxed LRRK1 alleles. Genomic DNA from ES cells or mouse tails was digested with HindIII and hybridized with the 5’ or 3’ external probe. For the 5’ probe, the resulting 17.0 kb and 4.8 kb bands represent the wild-type (WT) and the targeted (T) or floxed (F) alleles, respectively. For the 3’ probe, the resulting 17.0 kb and 12.2 kb bands represent the WT and the floxed (F) alleles, respectively. Detailed Southern strategy can be found in Figure 1-figure supplement 3.
(E) Targeting strategy for the generation of the targeted, floxed, and deleted LRRK2 alleles. The red boxes represent LRRK2 exons 1 and 2, and the start codon ATG resides in exon 1. The locations and sizes of the 5’ and 3’ external probes are shown. The targeting vector contains the 5’ and 3’ homologous regions (marked by dashed lines) and the middle targeted region (from the promoter region to intron 2), which includes a loxP site (green arrowhead) upstream (1,768 bp) of the transcription initiation site and the PGK-neo selection cassette flanked by two FRT sequences (gray circles) and two loxP sites (green arrowheads) in intron 2 (878 bp downstream of exon 2). A negative selection cassette encoding DTA is also included in the targeting vector. Mice carrying the correctly targeted LRRK2 allele were crossed with Actin-FLP deleter mice to generate floxed LRRK2 mice, which were bred with CMV-Cre transgenic mice to generate germline deleted LRRK2 mice. Detailed strategy for generating targeting vector and DNA sequence of floxed LRRK2 allele can be found in Figure 1-figure supplement 4 and 5, respectively.
(F) Southern analysis of the targeted and floxed LRRK2 alleles. Genomic DNA from ES cells or mouse tails was digested with NheI and hybridized with the 5’ or 3’ external probe. For the 5’ probe, the resulting 11.5 kb and 3.6 kb bands represent the wild-type (WT) and the targeted (T) or floxed (F) alleles, respectively. For the 3’ probe, the resulting 11.5 kb and 5.2 kb bands represent the WT and the floxed (F) alleles, respectively. Detailed Southern strategy can be found in Figure 1-figure supplement 6.
(G) Northern analysis of poly(A)+ RNA prepared from the lung of mice carrying homozygous germline deleted (Δ/Δ) LRRK1 alleles derived from the floxed LRRK1 alleles using the cDNA probe of exons 2-3 (left) and exons 27-29 (right). Using the upstream exons 2-3 probe, the LRRK1 transcripts in wild-type mice are the expected size of ∼7.4 kb, whereas the detected LRRK1 transcripts in LRRK1 Δ/Δ mice are truncated, consistent with the deletion of exons 27-29 (625 bp), which results in a frameshift and likely degradation of the truncated LRRK1 mRNA. Using a probe specific for exons 27-29, there is no LRRK1 transcript in LRRK1 Δ/Δ mice, as expected. Both blots were hybridized with a GAPDH probe as loading controls. Detailed Northern strategy and full-size blots are included in Figure 1-figure supplement 7 and 8, respectively. See also Figure 1-figure supplement 9.
(H) Northern analysis of total RNA prepared from the neocortex of mice carrying homozygous germline LRRK2 deleted (Δ/Δ) alleles using the cDNA probe of exons 1-5 shows the absence of LRRK2 transcripts. The blot was hybridized with a GAPDH probe as a loading control. The full-size blot is included in Figure 1-figure supplement 10. See also Figure 1-figure supplement 11
(I) Left: Western analysis of wild-type (+/+) and homozygous LRRK1 Δ/Δ brains show the absence of LRRK1 protein. Right: Western analysis of the neocortex of wild-type (+/+) and homozygous LRRK2 Δ/Δ mice shows the absence of LRRK2 protein. Vinculin was used as a loading control. Full-size blots are included in Figure 1-Source Data 1.
The LRRK2 targeting vector contains the 5’ homologous region, a loxP site 1,768 bp upstream of the transcription initiation site, exons 1-2, the PGK-neo cassette flanked by two loxP sites and two FRT sequences, and the 3’ homologous region (Figure 1B, E; Figure 1-figure supplement 4, 5). The ES cell clones carrying the targeted allele were identified and validated by Southern analysis using the 5’ external probe (Figure 1F; Figure 1-figure supplement 6) and genomic PCR followed by sequencing. Mice carrying the LRRK2 targeted allele were further verified by Southern analysis using the 5’ and 3’ external probes (Figure 1-figure supplement 6) as well as the neo probe and were then crossed with the Actin-FLP mice (33) to remove the PGK-neo cassette flanked by two FRT sites to generate floxed LRRK2 mice (Figure 1E). The resulting floxed LRRK2 mice were confirmed by Southern analysis using the 5’ and 3’ external probes (Figure 1F). In the presence of Cre recombinase, the floxed LRRK2 region containing the promoter and exons 1-2 are deleted, likely resulting in a null allele, as we previously targeted a very similar region (∼2.5 kb upstream of the transcription initiation site and exons 1-2) to generate germline deletion of LRRK2 (25).
Dopaminergic neurons in the SNpc are a small neuronal population embedded in the ventral midbrain, making it difficult to confirm whether DA neuron-specific deletions of the floxed LRRK1 and LRRK2 regions result in null alleles. We previously generated three independent LRRK1 knockout (KO) mice, and only one KO line (Line 2) represents a LRRK1 null allele (30), whereas deletion of LRRK2 promoter region and exons 1-2 resulted in a LRRK2 null allele (25). We therefore generated germline deleted LRRK1 and LRRK2 mice from floxed LRRK1 and LRRK2 mice, respectively, by crossing them to germline deleter CMV-Cre transgenic mice (34).
We then performed Northern analysis of LRRK1 using both an upstream probe specific for exons 2-3 and a downstream probe specific for exons 27-29 (Figure 1G; Figure 1-figure supplement 7, 8). Because of the low expression level of LRRK1 and the relative abundance of LRRK1 in the lung (20), we enriched polyA+ RNA from the lung of the mice carrying homozygous germline deleted (Δ/Δ) LRRK1 alleles derived from the floxed LRRK1 alleles. Using a probe specific for exons 2-3, the LRRK1 transcripts in wild-type mice are the expected size of ∼7.4 kb, whereas the detected LRRK1 transcripts in LRRK1 Δ/Δ mice are smaller, consistent with the deletion of exons 27-29 (625 bp), resulting in a frameshift of downstream codons and the likely degradation of the truncated LRRK1 mRNA (Figure. 1G; Figure 1-figure supplement 8). Using a probe specific for exons 27-29, there is no LRRK1 transcript in LRRK1 Δ/Δ mice (Figure. 1G; Figure 1-figure supplement 8). Extensive RT-PCR analysis of total RNA isolated from the kidney, brain, and lung of LRRK1 Δ/Δ mice using an exon 32-specific primer for RT and exon-specific primer sets for PCR (e.g. exons 4-8, 11-17, 20-25, and 25-31), followed by sequencing confirmation of the PCR products, indicated normal LRRK1 splicing in fLRRK1/fLRRK1 mice and the lack of LRRK1 exons 27-29 in LRRK1 Δ/Δ mice (Figure 1-figure supplement 9).
Similarly, Northern analysis of LRRK2 using a probe specific for exons 1-5 and RT-PCR followed by sequencing confirmed the absence of LRRK2 mRNA in LRRK2 Δ/Δ brains and normal LRRK2 transcripts in fLRRK2/fLRRK2 brains (Figure 1H; Figure 1-figure supplement 10, 11). Furthermore, Western analysis confirmed the absence of LRRK1 and LRRK2 proteins in the brain of LRRK1 Δ/Δ and LRRK2 Δ/Δ mice, respectively (Fig. 1I). Taken together, our Northern, RT-PCR followed by sequencing, and Western analyses demonstrated that deletion of the floxed LRRK1 and LRRK2 alleles results in null mutations. Thus, floxed LRRK1 and LRRK2 alleles can be used to generate DA neuron-specific LRRK cDKO mice.
Generation and molecular characterization of DA neuron-specific LRRK cDKO mice
To generate DA neuron-specific LRRK cDKO mice, we used DAT-Cre KI mice, which express Cre recombinase under the control of the endogenous DAT promoter (32). To confirm if Cre-mediated recombination occurs broadly and specifically in DA neurons of the SNpc, we crossed DAT-Cre mice with the Rosa26-CAG-LSL-ZsGreen1 reporter mouse (35). Upon Cre expression, Cre recombinase removes the floxed “stop” cassette, resulting in the expression of EGFP. We found that Cre-mediated recombination (GFP+) occurs in TH+ cells in the SNpc (Figure 2A). Quantification of GFP+ and/or TH+ cells in the SNpc showed that 99% of TH+ dopaminergic neurons are also GFP+, demonstrating that Cre-mediated recombination takes place in essentially all DA neurons in the SNpc (Figure 2B).

Generation and characterization of DA neuron-specific LRRK cDKO mice
(A) Immunostaining of GFP and/or TH in the SNpc of DAT-Cre/+; Rosa26-CAG-LSL-ZsGreen1/+ mice at 2 months of age. Cre recombinase is expressed under the control of the DAT endogenous promoter and removes the floxed “stop” cassette, resulting in the expression of EGFP under the control of the ubiquitous CAG promoter.
(B) Quantification of GFP+/TH+ and TH+ cells shows that 99% of TH+ DA neurons (722 ± 46 TH+ cells per brain) in the SNpc are also GFP+ (713 ± 46 cells per brain), indicating that DAT-Cre mediated recombination occurs in essentially all TH+ DA neurons. N = 3 mice, 3 comparable sections per hemisphere, 320 μm apart. Raw quantification data are included in Figure 2-Source Data 1.
(C) Similar body weight between LRRK cDKO mice and littermate controls at all ages examined (F1,73 = 0.0210, p = 0.8853; 2M, 20M, 25M: p > 0.9999; 15M: p = 0.7468, two-way ANOVA with Bonferroni’s post hoc multiple comparisons). Raw quantification data are included in Figure 2-Source Data 2.
(D) Similar brain weight between LRRK cDKO and control mice (F1,61 = 0.0440, p = 0.8345; 2M: p = 0.3893; 15M: p > 0.9999; 20M: p > 0.9999; 25M: p = 0.3223, two-way ANOVA with Bonferroni’s post hoc multiple comparisons). Raw quantification data are included in Figure 2-Source Data 2.
(E) Western analysis of LRRK1 and LRRK2 proteins in the dissected cerebral cortex (CTX) and ventral midbrain (vMB) of LRRK cDKO and littermate controls at 2 months of age. Full-size blots are included in Figure 2-Source Data 3.
(F) Quantification shows significant decreases of LRRK1 and LRRK2 in the dissected ventral midbrain of LRRK cDKO mice (LRRK1, p = 0.0432; LRRK2, p = 0.0162, unpaired two-tailed Student’s t-test), compared to controls, but not in the dissected cortex of cDKO mice (LRRK1, p = 0.7648; LRRK2, p = 0.2325). Raw quantification data are included in Figure 2-Source Data 4.
The number in the column indicates the number of mice used in the study. Red-filled and open circles represent data obtained from individual male and female mice, respectively. All data are expressed as mean ± SEM. *p < 0.05. Scale bar: 100 μm.
Having confirmed fLRRK1 and fLRRK2 mice as well as DAT-Cre mice, we then bred them together to generate LRRK cDKO mice (fLRRK1/fLRRK1; fLRRK2/fLRRK2; DAT-Cre/+), which were further bred with fLRRK1/fLRRK1; fLRRK2/fLRRK2 mice to generate cDKO and littermate controls (fLRRK1/fLRRK1; fLRRK2/fLRRK2). It was previously reported that germline LRRK DKO mice failed to gain weight as they aged (30). However, DA neuron-specific LRRK cDKO and littermate control mice have similar body and brain weights at the ages of 2-24 months (Figure 2C, D). Western analysis showed a significant reduction of LRRK1 and LRRK2 proteins in the dissected ventral midbrain but not in the cerebral cortex of DA neuron-specific LRRK cDKO, relative to littermate controls at 2-3 months of age (Figure 2E, F).
Age-dependent loss of DA neurons in the SNpc of LRRK cDKO mice
To determine whether the inactivation of LRRK selectively in DA neurons of the SNpc impacts their survival, we performed TH immunostaining and quantified TH+ DA neurons in the SNpc of LRRK cDKO mice and littermate controls. The morphology of TH+ DA neurons in LRRK cDKO mice at the ages of 15, 20, and 24 months appears normal (Figure 3A). TH+ neuron counting revealed that the number of DA neurons in the SNpc at the age of 15 months is similar between cDKO mice (10,000 ± 141) and littermate controls (10,077 ± 310, F1,46 = 16.59, p = 0.0002; p > 0.9999, two-way ANOVA with Bonferroni’s post hoc multiple comparisons; Figure 3B). However, at the age of 20 months, the number of TH+ neurons in the SNpc of cDKO mice (8,948 ± 273) is significantly reduced, compared to controls (10,244 ± 220; p = 0.0041), and is further decreased at the age of 24 months (Control: 9,675 ± 232, cDKO: 8,188 ± 452; p = 0.0010).

Age-dependent loss of DA neurons in the SNpc of LRRK cDKO mice
(A) TH immunostaining shows TH+ DA neurons in the SNpc of LRRK cDKO and littermate controls at the age of 15, 20, and 24 months. Higher power views of the boxed areas show grossly normal DA neuron morphology in LRRK cDKO mice.
(B) Quantification of all TH+ DA neurons in the SNpc reveals similar numbers of DA neurons in LRRK cDKO mice (10,000 ± 141) and littermate controls (10,077 ± 310, p > 0.9999) at 15 months of age. At 20 months of age, the number of DA neurons in the SNpc of LRRK cDKO mice (8,948 ± 273) is significantly reduced, compared to control mice (10,244 ± 220, F1,46 = 16.59, p = 0.0002; p = 0.0041, two-way ANOVA with Bonferroni’s post hoc multiple comparisons). By 24 months of age, the reduction of DA neurons in the SNpc of LRRK cDKO mice (8,188 ± 452) relative to controls (9,675 ± 232, p = 0.0010) is greater, compared to that at 20 months of age. Raw quantification data are included in Figure 3-Source Data 1.
(C) Immunohistological analysis of TH and NeuN shows TH+ dopaminergic neurons (green) and NeuN+ neurons (red) in the SNpc of LRRK cDKO mice and controls at 24 months of age.
(D) Quantification of NeuN+ cells in the SNpc shows that the number of NeuN+ neurons in LRRK cDKO mice (17,923 ± 813) is significantly lower than that in control mice (21,907 ± 469, p = 0.0006, Student’s t-test), indicating loss of neurons in the SNpc of LRRK cDKO mice. All TH+ cells are NeuN+. The number of TH+/NeuN+ cells in the SNpc of LRRK cDKO mice (10,500 ± 644) is also lower, compared to control mice (14,102 ± 310, p = 0.0001). There is no significant difference in the number of NeuN+/TH-neurons between littermate controls (7,804 ± 249) and cDKO mice (7,423 ± 344, p = 0.3747). Raw quantification data are included in Figure 3-Source Data 2.
The number in the column indicates the number of mice used in the study. Red-filled and open circles represent data obtained from individual male and female mice, respectively. All data are expressed as mean ± SEM. **p < 0.01, ***p < 0.001. Scale bar: 100 μm.
We further performed TH and NeuN double immunostaining of LRRK cDKO and control mice at 24 months of age (Figure 3C), and found that the number of NeuN+ neurons is also significantly reduced in the SNpc of cDKO mice (17,923 ± 813), compared to controls (21,907 ± 469, p = 0.0006, Student’s t-test; Figure 3D). The number of TH+/NeuN+ cells in the SNpc of LRRK cDKO mice (10,500 ± 644) is also lower, compared to control mice (14,102 ± 310, p = 0.0001; Figure 3D). These data indicate that the decreases in the number of TH+ cells are not due to decreases in TH expression in DA neurons, but rather a result of the loss of DA neuron cell bodies in the SNpc of LRRK cDKO mice.
We further evaluated apoptosis in the SNpc of LRRK cDKO and littermate controls at the age of 24 months using an antibody specific for active Caspase-3 to label apoptotic cells. We observed increases in apoptotic DA neurons, labeled by active Caspase-3+ and TH+ immunoreactivity, in the SNpc of LRRK cDKO mice (Figure 4A). Quantification of active Caspase-3+/TH+ apoptotic DA neurons shows a significant increase in the SNpc of LRRK cDKO mice (323 ± 38), compared to controls (157 ± 8, p = 0.0004, Student’s t-test; Figure 4B). These results further support that LRRK plays an intrinsic role in the survival of DA neurons in the SNpc during aging.

Increases in apoptotic DA neurons in the SNpc of LRRK cDKO mice
(A) Representative images of TH and active Caspase-3 immunostaining show TH+ DA neurons (green) and active Caspase-3+ apoptotic cells (red) in the SNpc of LRRK cDKO and control mice at the age of 24 months.
(B) Quantification of active Caspase-3+/TH+ cells shows significant increases of apoptotic DA neurons in the SNpc of LRRK cDKO mice (323 ± 38) at 24 months of age, relative to controls (157 ± 8, p = 0.0004, unpaired Student’s t-test). Raw quantification data are included in Figure 4-Source Data 1.
The number in the column indicates the number of mice used in the study. Red-filled and open circles represent data obtained from individual male and female mice, respectively. All data are expressed as mean ± SEM. ***p < 0.001. Scale bar: 100 μm.
Previously, we reported the reduction of noradrenergic neurons in the locus coeruleus (LC) of LRRK DKO mice (30). We therefore quantified TH+ noradrenergic neurons in the LC of LRRK cDKO mice at the age of 24 months, and found a similar number of TH+ cells in the LC of LRRK cDKO and littermate controls (Control: 3,419 ± 86, cDKO: 3,350 ± 99, p = 0.6057, Student’s t-test; Figure 5A, B). Further examination of the GFP reporter line crossed with DAT-Cre showed the lack of Cre-mediated recombination in the LC (Figure 5C).

Normal number of TH+ noradrenergic neurons in the LC of LRRK cDKO mice
(A) Representative images of TH+ noradrenergic neurons in the locus coeruleus (LC) of LRRK cDKO mice and littermate controls at 24 months of age.
(B) Quantification of TH+ neurons shows similar numbers of TH+ noradrenergic neurons in the LC of LRRK cDKO mice (3,350 ± 99) and controls (3,419 ± 86, p = 0.6057, unpaired Student’s t-test). Raw quantification data are included in Figure 5-Source Data 1.
(C) Top: Immunostaining of TH and GFP in the LC of DAT-Cre/+; Rosa26-CAG-LSL-ZsGreen1/+ mice at 2 months of age. There is no GFP+ (green) cell in the LC, indicating that DAT-Cre is not expressed in the LC. Bottom: Higher power views of the boxed areas.
The number in the column indicates the number of mice used in the study. Red-filled and open circles represent data obtained from individual male and female mice, respectively. All data are expressed as mean ± SEM. Scale bar: 100 μm.
Quantitative EM analysis of the SNpc in LRRK cDKO mice
We previously reported striking age-dependent increases of electron-dense autophagic and autolysosomal vacuoles as well as the presence of large lipofuscin granules in the surviving SNpc neurons of LRRK DKO mice beginning at 10 months of age (30, 31). To determine whether selective inactivation of LRRK in DA neurons similarly results in the accumulation of electron-dense autophagic and autolysosomal vacuoles in the SNpc, we performed EM analysis in the SNpc of LRRK cDKO mice and littermate controls at the ages of 25 months (Figure 6). We observed various electron-dense double membrane autophagosomes and single membrane autolysosomes as well as lipofuscin granules composed of lipid-containing residues of lysosomal digestion in the SNpc of LRRK cDKO and littermate control mice (Figure 6C-F). Interestingly, there are similar numbers of electron-dense vacuoles in the SNpc of LRRK cDKO mice and littermate controls at the age of 25 months (Control: 6.72 ± 0.43, cDKO: 6.99 ± 0.52, p = 0.6839, Student’s t-test; Figure 6G). We also found no significant difference in the area of electron-dense vacuoles in the SNpc between LRRK cDKO and littermate controls at the age of 25 months (Control: 4.43 ± 0.44 μm2; cDKO: 4.60 ± 0.49 μm2, p = 0.8048; Figure 6G). The difference in age-dependent accumulation of electron-dense vacuoles in the SNpc between germline DKO mice and DA neuron-restricted cDKO suggests that LRRK in non-DA neurons such as microglia, which is lacking in germline DKO but is expressed normally in cDKO mice, may play a more prominent role.

Unchanged number of electron-dense vacuoles in the SNpc of LRRK cDKO mice
(A, B) Representative EM images showing electron-dense vacuoles (arrowheads) in SNpc neurons of cDKO mice and littermate controls at the age of 25 months.
(C-F) Higher power views showing various electron-dense vacuoles, autolysosomes (single arrows), autophagosomes (double arrows), and lipid-containing vacuoles (asterisks) in SNpc neurons of littermate control (C, D) and cDKO (E, F) mice.
(G) Left: The average number of electron-dense vacuoles (>0.5 μm in diameter) in the SNpc neuronal profiles per mouse is not significantly different between LRRK cDKO mice and littermate controls at the age of 25 months (Control: 6.72 ± 0.43; cDKO: 6.99 ± 0.52, p = 0.6839, unpaired two-tailed Student’s t-test). Right: The total area of electron-dense vacuoles (>0.5 μm in diameter) in the SNpc neuronal profiles per mouse is similar between LRRK cDKO and littermate controls (Control: 4.43 ± 0.44 μm2; cDKO: 4.60 ± 0.49 μm2, p = 0.8048). Raw quantification data are included in Figure 6-Source Data 1.
The value in parentheses indicates the number of mice (left) and neuron profiles (right) used in the quantification. Red-filled and open circles represent data obtained from individual male and female mice, respectively. All data are expressed as mean ± SEM. Scale bar: 1 μm.
Enhanced microgliosis in the SNpc of LRRK cDKO mice
We further evaluated whether elevated microgliosis accompanies DA neurodegeneration in the SNpc of LRRK cDKO mice. We performed immunohistochemical analysis of Iba1, which labels microglia, and TH, which marks DA neurons and processes, thus showing the boundary of the SNpc (Figure 7A-C). We found that the number of Iba1+ immunoreactive microglia is significantly increased in the SNpc of LRRK cDKO mice at 15 months of age (2541.3 ± 193.0), compared to controls (1736.7 ± 82.9; p = 0.0017, two-way ANOVA with Bonferroni’s post hoc multiple comparisons; Figure 7A, D). The number of Iba1+ immunoreactive microglia in the SNpc of LRRK cDKO is further increased compared to controls at the age of 20 (Control: 2426.0 ± 67.7, cDKO: 3639.0 ± 127.1, p < 0.0001; Figure 7B, D) and 25 months (Control: 2640.0 ± 187.1, cDKO: 4088.8 ± 100.3, p < 0.0001; Figure 7C, D). These results show that despite the selective inactivation of LRRK in DA neurons of LRRK cDKO mice, microgliosis accompanies DA neuronal loss in the SNpc.

Elevated microgliosis in the SNpc of LRRK cDKO mice
(A-C) Representative images of Iba1+ microglia (red, marked by yellow arrowheads) and TH+ dopaminergic neurons (green) in the SNpc of LRRK DKO mice and controls at 15 (A), 20 (B), and 24 (C) months of age.
(D) Quantification of Iba1+ microglia shows significant increases in the number of Iba1+ microglia in the SNpc of LRRK cDKO mice compared to control mice at 15 (control: 1736.7 ± 82.9, cDKO: 2541.3 ± 193.0, p = 0.0017, two-way ANOVA with Bonferroni’s post hoc multiple comparisons), 20 (control: 2426.0 ± 67.7, cDKO: 3639.0 ± 127.1, p < 0.0001), and 24 months of age (control: 2640.0 ± 187.1, cDKO: 4088.8 ± 100.3, p < 0.0001). Raw quantification data are included in Figure 7-Source Data 1.
The number in the column indicates the number of mice used in the study. Red-filled and open circles represent data obtained from individual male and female mice, respectively. All data are expressed as mean ± SEM. ****p < 0.0001. Scale bar: 100 μm.
Discussion
LRRK2 mutations represent ∼5% familial and 1-2% of sporadic PD cases, and the G2019S mutation is the most common mutation but with a higher age of onset and incomplete penetrance (74% at age 79) (36). Despite the importance of LRRK2 in PD pathogenesis, whether LRRK2 mutations cause PD via a loss-of-function or a gain-of-function mechanism remains highly debated and unresolved. Neither LRRK2-deficient mice nor LRRK2 R1441C and G2019S KI mice develop dopaminergic neurodegeneration (25, 37, 38). It was proposed that the lack of brain phenotypes in LRRK2-/-mice might be due to the presence of LRRK1 (25, 26), which is broadly expressed in the brain including the midbrain (https://www.proteinatlas.org/ENSG00000154237-LRRK1/brain). Indeed, germline deletions of LRRK2 and LRRK1 result in age-dependent loss of DA neurons and increases of apoptosis and microgliosis in the SNpc of LRRK DKO mice (30, 31). However, the pleiotropic roles of LRRK1 and LRRK2 in the kidney (25, 26, 29), lung (28), and bone (39, 40), and the observed earlier mortality and lower body weight in LRRK DKO mice raised the possibility that DA neurodegeneration in LRRK DKO mice may be due to poor health.
In this study, we address this important question through the development of floxed LRRK1 and LRRK2 mice (Figure 1; Figure 1-figure supplement 1-11), which permit the dissection of cell intrinsic function of LRRK in DA neurons. We generated DA neuron-specific LRRK cDKO mice using the DAT-
Cre KI allele (32) to delete floxed LRRK1 and LRRK2 regions selectively in DA neurons. Indeed, using an EGFP reporter line, we found that DAT-Cre drives Cre-mediated recombination in almost all DA neurons in the SNpc (Figure 2). Unlike the LRRK germline DKO mice (30), DA neuron-specific LRRK cDKO mice exhibit normal body weight and mortality during mouse lifespan (Figure 2). Importantly, LRRK cDKO mice develop age-dependent DA neurodegeneration, as evidenced by progressive reductions of DA neurons in the SNpc at the age of 20-24 months (Figure 3) and increases of apoptotic DA neurons (Figure 4), whereas the number of noradrenergic neurons in the LC is uncaged, consistent with the lack of Cre-mediated recombination in the LC by DAT-Cre (Figure 5). Interestingly, quantitative EM analysis showed similar numbers of electron-dense vacuoles in the SNpc of LRRK cDKO and control mice even at 25 months of age (Figure 6), in contrast to dramatic, age-dependent increases of vacuoles in the SNpc of LRRK DKO mice (30, 31). Lastly, DA neurodegeneration in the SNpc of LRRK cDKO mice is accompanied with elevated microgliosis (Figure 7).
The toxic gain-of-function pathogenic mechanism was supported by earlier biochemical reports showing that LRRK2 mutations (e.g. R1441C/G, G2019S) enhance kinase activity, leading to elevated levels of pSer1292-LRRK2 (41), pSer935-LRRK2 (42, 43), pT73-Rab10, and pS106-Rab12 (44). However, most transgenic mice overexpressing mutant LRRK2 did not produce neurodegeneration or DA neuron loss (45–53), suggesting that enhanced kinase activity does not correlate with compromised DA neuronal survival, though two reports showed that overexpression of LRRK2 G2019S but not R1441C resulted in DA neurodegeneration (54, 55). Thus, further studies are needed to elucidate the differences of these seemingly conflicting transgenic findings and to understand the differences between the R1441C and G2019S mutations.
The loss-of-function pathogenic mechanism was supported by mouse knockout findings showing that germline inactivation of LRRK results in age-dependent loss of DA neurons in the SNpc and DA terminals in the striatum (30, 31). The current study demonstrated a cell intrinsic role of LRRK in support of DA neuron survival in the SNpc of the aging brain, providing further genetic evidence of an essential, cell autonomous requirement of LRRK in DA neuron survival. However, highly penetrant PD-linked mutations are dominantly-inherited missense mutations (6) in LRRK2, and there have been no reported deletion mutations that are linked to or causal of familial PD, despite various variants were reported in LRRK2 and LRRK1 that are associated with sporadic PD (but not linked to familial PD). One plausible explanation is that LRRK2 mutant may act in a dominant negative manner, inhibiting the activity of the wild-type LRRK2. This notion is supported by structural studies showing that the GTPase domain forms a dimer, and that the R1441/C/G/H and I1371V mutations destabilize dimer formation and decrease GTPase activity (22). LRRK2 may function as a dimer, which is further supported by the crystal structure of LRRK2’s WD40 domain dimer at 2.6 Å resolution (56). Additional studies also suggested that LRRK2 functions as a dimer (57–59), and that LRRK2 and LRRK1 can form a heterodimer (60). Furthermore, LRRK2 G2385R variant, a risk factor for PD (61–64), has been reported as a partial loss-of-function mutation (65, 66). Future studies are needed to differentiate the possibility between a toxic gain-of-function pathogenic mechanism vs. loss-of-function mutations exerting a dominant negative effect further impairing LRRK2 activity of the wild-type protein encoded by the LRRK2 wild-type allele, as the gain-of-function or loss-of-function pathogenic mechanism underlying LRRK2 mutations pivots opposing LRRK2 based therapeutic development of PD therapies.
Finally, it was surprising to find no accumulation of autophagic and autolysosomal vacuoles in SNpc neurons of LRRK cDKO mice, even at the age of 25 months. This suggests that non-dopaminergic cells (e.g. microglia), in which LRRK expression is unaffected in cDKO mice but is absent in germline DKO mice, may contribute to the dramatic phenotypic differences. Development of cell type-specific cDKO mice, such as microglia-specific LRRK cDKO mice, would permit further dissection of cell autonomous and non-cell autonomous role of LRRK in dopaminergic neuronal survival and whether glial LRRK plays a more important role in the regulation of the autophagy-lysosomal pathway.
Materials and methods
Key Resource Table




Mice
All animal use was approved by the IACUC committees of Harvard Medical School and Brigham and Women’s Hospital, and conformed to the USDA Animal Welfare Act, PHS Policy on Humane Care and Use of Laboratory Animals, the “ILAR Guide for the Care and Use of Laboratory Animals” and other applicable laws and regulations. Mice were housed in constant humidity- and temperature-controlled rooms and maintained on a 12 hr light/dark cycle and were given standard rodent chow and water. Mice of both sexes at multiple ages, from 2 months to 25 months, were used. Floxed LRRK1 (fLRRK1) and the resulting germline deleted LRRK1Δ alleles, and floxed LRRK2 (fLRRK2) and the resulting germline deleted LRRK2Δ alleles were generated and thoroughly validated at the genomic DNA, mRNA, and protein levels. DAT-IRES-Cre (The Jackson Laboratory, IMSR_JAX:006660), ACT-FLPe (IMSR_JAX:005703), CMV-Cre transgenic (IMSR_JAX:006054), and Rosa26-CAG-LSL-ZsGreen1 mice (IMSR_JAX:007906) used in the current study were previously characterized and reported (32–35). LRRK1/LRRK2 cDKO mice (fLRRK1/fLRRK1; fLRRK2/fLRRK2; DAT-IRES-Cre/+) and littermate controls (fLRRK1/fLRRK1; fLRRK2/fLRRK2) were obtained from multiple breeding cages of fLRRK1/fLRRK1; fLRRK2/fLRRK2 and cDKO mice. All mice were maintained on the C57BL6 and 129 hybrid genetic background (F1: IMSR_JAX:101043). All phenotypic analyses were performed in a genotype blind manner, as previously described (67).
Generation of targeted and floxed LRRK1 and LRRK2 alleles
The generation and validation of the LRRK1 and LRRK2 targeting vectors, the targeted, floxed, and deleted LRRK1 and LRRK2 alleles by Southern, Northern, RT-PCR, and the sequences of the floxed LRRK1 and LRRK2 alleles are included in Figure 1-figure supplement 1-11.
LRRK1
To generate the LRRK1 targeting vector, we first PCR amplified the left middle homologous region (2,079 bp) containing partial intron 26, exon 27, and partial intron 27 of LRRK1 from mouse BAC DNA (clone RP23-213J23, BACPAC Resources Center) using primers, P3 and P4. The PCR fragment was subcloned into the pGEM-T vector (A1360, Promega) to generate pLM1 (for details, see Figure 1-figure supplement 1). The right middle homologous region (3,403) containing LRRK1 genomic region from partial intron 27 to partial intron 29 was amplified by PCR using primers, P5 and P6, and then subcloned into the pGEM-T vector (pLM2). The left middle homologous region containing pGEM-T plasmid was then digested with NotI and KpnI (endogenous KpnI site in the intron 27) and subcloned into the NotI and KpnI sites of the right middle homologous region containing pGEM-T plasmid (pLM3).
After that, the middle homologous region (5.5 kb), from partial intron 26 to partial intron 29, was released by NotI and SacII digestions and was blunted by Klenow, and then subcloned into the SmaI site of PGKneoF2L2DTA vector (#13445, addgene) to generate the middle homologous region-PGKneoF2L2DTA plasmid (pLM4).
The left homologous region (2,016 bp) containing partial intron 25, exon 26, and partial intron 27 of LRRK1 was PCR amplified from mouse BAC DNA (clone RP23-213J23, BACPAC Resources Center) using primers, P1 and P2. The PCR fragment was digested with SacII (introduced by P1) and NotI (introduced by P2 along with HindIII), and was subcloned into the SacII and NotI sites of the PGKneoF2L2DTA vector (pLM5). The right homologous region (3,131 bp) containing partial intron 29, exon 30, and partial intron 30 of LRRK1 was PCR amplified from mouse BAC DNA (clone RP23-213J23) using primers, P7 and P8. The PCR fragment was digested with SalI (introduced by P7) and HindIII (introduced by P8), and was subcloned into the SalI and HindIII sites of the PGKneoF2L2DTA vector (pLM6).
The left homologous region in the PGKneoF2L2DAT vector (pLM5) was digested with SacII and NotI, and subcloned into the SacII and NotI sites of the right homologous region containing pGKneoF2L2DTA plasmid (pLM6) to generate pLM7. Finally, the loxP-middle homologous region-PGK-Neo-loxP fragment was released from pLM4 by NotI and SalI digestions, and subcloned into the NotI and SalI sites of pLM7 to generate the final target vector (pLM8), which contains two loxP sites (intron 26 and intron 29). Upon Cre-mediated recombination, the endogenous LRRK1 genomic sequence flanked by the 5’ loxP site (1,288 bp upstream of LRRK1 exon 27) to the 3’ loxP site (1,023 bp downstream of exon 29) is excised. The PGK-neo cassette flanked by two FRT sites is under the control of the mouse phosphoglycerate kinase 1 (PGK) promoter and contains the bovine growth hormone polyA signal. To enhance the ratio of ES cells carrying homologous recombination events instead of random insertion of the targeting vector (68), the negative selection PGK-DTA cassette, which encodes diphtheria toxin A chain, was also included in the LRRK1 targeting vector.
The LRRK1 targeting vector was linearized by XhoI digestion, and then electroporated into MKV6.5 embryonic stem (ES) cells (a gift from R. Jaenisch), which were derived from B6/129 F1 mice (The Jackson Laboratory, IMSR_JAX:101043). G418 was applied to the culture at 150 μg/ml 24 h later, and after 6 days of G418 selection, the surviving ES clones (480) were picked and screened by Southern analysis using HindIII digestion of genomic DNA followed by hybridization with the 5’ external and 3’ external probes to confirm proper recombination events in the 5’ and 3’ homologous regions, respectively.
25 ES cell clones were confirmed to carry the proper homologous recombination events at the 5’ homologous region, giving rise to the 17.0 kb and the 4.8 kb bands, which represent the wild-type and the targeted allele, respectively (Figure 1D), and the 3’ homologous region, giving rise to the 17.0 kb and the 14.1 kb bands, which represent the wild-type and the targeted allele, respectively. We then expanded the selected 4 ES cell clones (3A11, 3D8, 3H1, and 3H6) and further verified by Southern using the 5’ and 3’ external, and neo probes. Two ES cell clones (3D8 and 3H6) were transfected with pCAGGS-flpE-puro (#20733, addgene) to delete the PGK-neo cassette by FLP recombinase. Three resulting ES cell clones (3D8C5, 3D8E5, and 3H6G7) were confirmed by Southern analysis using the 5’ and 3’ external probes and the neo probe to confirm the floxed LRRK1 allele by the deletion of the PGK-neo cassette.
LRRK2
To generate the LRRK2 targeting vector, the left homologous region (2,579 bp) containing the LRRK2 promoter region was PCR amplified from mouse BAC DNA (clone RP23-526A2, BACPAC Resources Center) using primers, P9 and P10, and subcloned into the pGEM-T vector to generate pLRRK2#1 (for details see Figure 1-figure supplement 4). The BamHI-loxP-NheI-SpeI fragment (56 bp), which was generated by annealing two complementary oligos, P39 and P40, was introduced to the BamHI and SpeI sites of pLRRK2#1 to generate pLRRK2#2. The middle homologous region, containing genomic sequences from the promoter region to partial intron 2, was PCR amplified from mouse BAC DNA (clone RP23-526A2) using primers, P11 and P12, digested with XbaI and NotI, and subcloned into the XbaI and NotI sites of the pGEM-T vector to generate pLRRK2#3, which was digested with XbaI and NotI, and subcloned into the XbaI and NotI sites of pLRRK2#2 to generate pLRRK2#4. The right homologous region (3,503 bp), which contains partial intron 1, exon 2, and partial intron 2, was PCR amplified from mouse BAC DNA (clone RP23-526A2) using primers, P13 and P14, and the PCR fragment was subcloned into the EcoRV site of pBluescript II KS (+) vector (212207, Agilent) to generate pLRRK2#5. The right homologous region in pLRRK2#5 was digested with BamHI followed by Klenow, and then digested with ClaI. The released fragment was subcloned into the EcoRV and ClaI sites of the PGKneoF2L2DTA vector to generate pLRRK2#6. LFNT-tk/pBS plasmid (a gift from S. Tonegawa) was digested with SacII (followed by Klenow) and NotI (followed by SspI digestion to make it easier to isolate the NotI-SacII/KN fragment) to release the loxP-FRT-PKG-neo-loxP-FRT fragment (2,928 bp), and then subcloned into the XbaI (followed by Klenow) and NotI sites of pLRRK2#6 to generate pLRRK2#7. Finally, pLRRK2#4 containing the left-loxP-middle homologous regions was digested with EcoRV and NotI, and subcloned into AleI and NotI sites of pLRRK2#7 containing the loxP-FRT-PKG-neo-loxP-FRT-right homologous region to generate the final targeting vector, which contains the loxP sites in the promoter region (1,768 bp upstream of the transcription initiation site) and in LRRK2 intron 2 (878 bp downstream of exon 2). Upon Cre-mediated recombination, the floxed endogenous LRRK2 genomic sequences from the 5’ loxP site (1,768 bp upstream of LRRK2 transcription) to the 3’ loxP site in intron 2 (878 bp downstream of exon 2) are excised. The negative selection PGK-DTA cassette is also included in the LRRK2 targeting vector.
The LRRK2 targeting vector was linearized by AhdI digestion, and then electroporated into MKV6.5 ES cells. G418 was applied to the culture at 150 ug/ml 24 h later, and after 6 days of G418 selection, the surviving ES clones (480) were picked and screened by Southern analysis using NheI digestion of genomic DNA followed by hybridization with the 5’ external probe (753 bp, PCR amplified using P19 and P20). Southern analysis confirmed that two ES cell clones (N24 and N34) carry the proper recombination event in the 5’ homologous arm, giving rise to 11.6 kb and 3.6 kb bands, which represent the wild-type and targeted alleles, respectively (Figure 1F), followed by genomic PCR confirmation for the proper recombination in the right arm.
Three (3D8C5, 3A11, 3H6) and one (N24) ES clones for LRRK1 and LRRK2, respectively, were microinjected into C57BL/6 mouse blastocysts to generate chimera mice, which were bred with B6/129 F1 mice to produce heterozygous floxed LRRK1 and targeted LRRK2 mice. Floxed LRRK1 mice were confirmed by Southern analysis using the 5’ and 3’ external probes (Figure 1D). Targeted LRRK2 mice were confirmed by Southern (data shown in Figure 1-figure supplement 6; NheI digestion followed by hybridization with the 5’ external probe and SphI digestion followed by hybridization with the 3’ external probe). Targeted LRRK2 mice were then bred with Actin-FLP deleter mice (IMSR_JAX:005703) (33) to generate floxed LRRK2 mice, which were confirmed by Southern analysis using the 5’ and 3’ external probes following NheI digestion (Figure 1F). Heterozygous fLRRK1/+ and fLRRK2/+ mice were crossed with each other to obtain homozygous single floxed mice (fLRRK1/fLRRK1 and fLRRK2/fLRRK2) and double floxed mice (fLRRK1/fLRRK1; fLRRK2/fLRRK2).
Generation of deleted LRRK1/LRRK2 alleles and DA neuron-specific cDKO mice
In order to ensure that Cre-mediated deletion of the floxed LRRK1 and LRRK2 alleles results in null alleles, we crossed floxed LRRK1 and LRRK2 mice with germline deleter, CMV-Cre transgenic mice (B6.C-Tg(CMV-cre)1Cgn/J; IMSR_JAX:006054) (34), to generate LRRK1 deleted (Δ/Δ) mice (by removing exons 27-29) and LRRK2 deleted (Δ/Δ) mice (by removing the promoter region and exons 1-2) for further molecular characterization. To generate DA neuron-specific LRRK1/LRRK2 cDKO mice, we used DAT-Cre KI mice (B6.SJL-Slc6a3tm1.1(cre)Bkmn/J; IMSR_JAX:006660), which express Cre recombinase under the control of the endogenous DAT promoter (32). We crossed double floxed mice with DAT-Cre mice to generate LRRK cDKO mice (fLRRK1/fLRRK1; fLRRK2/fLRRK2; DAT-Cre/+). LRRK cDKO and littermate control mice used in the phenotypic analysis were obtained by crossing fLRRK1/fLRRK1; fLRRK2/fLRRK2; DAT-Cre/+ with fLRRK1/fLRRK1; fLRRK2/fLRRK2 mice. We only used cDKO and control mice that carry all floxed LRRK1 and LRRK2 alleles for phenotypic analysis.
Southern analysis
For the identification and validation of the targeted and floxed LRRK1 alleles, we used the 5’ external, 3’ external, and neo probes. Genomic DNA from ES cells or mouse tails was digested with HindIII. The 5’ external probe (377 bp), which is 839 bp upstream of the 5’ homologous region, was PCR amplified from mouse BAC DNA (clone RP23-213J23) using primers P15 and P16. The 3’ external probe (305 bp), which is 2,736 bp downstream of the 3’ homologous region, was PCR amplified from mouse BAC DNA (clone RP23-213J23) using primers P17 and P18. The neo probe (363 bp) was PCR amplified from pSoriano plasmid using primers P23 and P24. Following HindIII digestion, the presence of the 17.0 kb product using either the 5’ or 3’ external probe represents the wild-type allele, whereas the 4.8 kb (the 5’ external probe) and the 12.2 kb (the 3’ external probe) products represent the floxed LRRK1 allele. Genomic DNA digested by HindIII and hybridized with the neo probe further confirmed the wild-type and floxed alleles (no band) and the targeted LRRK1 allele (14.1 kb).
For the identification and validation of the targeted and floxed LRRK2 alleles, we used the 5’ and 3’ external probes as well as the neo probe. Genomic DNA from ES cells or mouse tails was digested with NheI or SphI followed by hybridization with the 5’ or 3’ external probe or the neo probe. The 5’ external probe (753 bp), which is 84 bp upstream of the 5’ homologous region, was PCR amplified from mouse BAC DNA (clone RP23-526A2) using primers P19 and P20. The 3’ external probe (622 bp), which is 38 bp downstream of the 3’ homologous region, was PCR amplified from mouse BAC DNA (clone RP23-526A2) using primers P21 and P22. Following NheI digestion, the presence of the 11.5 kb product using either the 5’ or 3’ external probe represents the wild-type allele, whereas the 3.6 kb (the 5’ external probe) and the 5.2 kb (the 3’ external probe) products represent the floxed LRRK2 allele.
PCR genotyping
Genomic PCR was performed to determine the presence of the deleted, the floxed, and/or the wild-type alleles. For LRRK1, the following primers were used: P25 (5’-ATTGGTCTTTGAAGAGACAGCATCTGG, forward primer, 392 nt downstream of exon 26), P26 (5’-TTTCCCTGAGGTGGAGAAGTGACTGG, reverse primer, 567 nt downstream of exon 26), and P27 (5’-TCACGTCGTCTAAGCCTCCT, reverse primer, 1,218 nt downstream of exon 29). The PCR products from P25 and P26 are 266 bp and 405 bp, which represent the wild-type and the fLRRK1 alleles, respectively, whereas the PCR product from P25 and P27 is 583 bp, which represents the deleted LRRK1 allele. For LRRK2, the following primers were used: P28 (5’-CTTCCTCAGAAGTTAGGTAAACATTGAGTG, forward primer, 2,069 nt upstream of exon 1), P29 (5’-CTAAGTGACACCGTGTTTCCAAAGTC, reverse primer, 1,739 nt upstream of exon 1), and P30 (5’-GGAAAGTTTCACAATTGGAAAAATAAAAATATTTACTGCAGATA, reverse primer at 2,848 nt downstream of exon 2). The PCR products from P28 and P29 are 305 bp and 367 bp, representing the wild-type and the fLRRK2 alleles, respectively, whereas the PCR product from P28 and P30 is 587 bp, which represents the deleted LRRK2 allele.
For DAT-IRES-Cre, the following primers were used: JKM1823 (5’-TGGCTGTTGGTGTAAAGTGG, forward primer at exon 16 and 3’-UTR), JKM1824 (5’-GGACAGGGACATGGTTGACT, reverse primer at 3’-UTR), and JKM1825 (5’-CCAAAAGACGGCAATATGGT, reverse primer at IRES sequence). The PCR product from JKM1823 and JKM1824 is 264 bp, which represents the wild-type allele, whereas the PCR product from JKM1823 and JKM1825 is 152 bp, which represents the DAT-IRES-Cre KI allele.
Northern analysis
Total RNA was isolated from brains, kidneys, or lungs using TRI reagent (T9424, Millipore-Sigma) according to the manufacturer’s instruction. For the LRRK1 Northern analysis, polyA+ RNA was enriched from ∼500 μg total RNA using the Poly(A)Purist™ MAG Kit (AM1922, ThermoFisher) according to the manufacturer’s instruction. For the LRRK2, ∼10 μg of total RNA was used for Northern analysis. RNA was separated in formaldehyde agarose gel, and transferred into Amersham Hybond-nylon membrane (RPN303N, GE Healthcare). Probes were synthesized using Prime-It II random labeling kit (#300385, Agilent) and then used for membrane hybridization at 55°C overnight.
The cDNA probe specific for LRRK1 exons 2-3 (383 bp) was PCR amplified using primers P31 (5’-CAGGATGAGCGTGTGTCTGCAG) and P32 (5’-CCTTCTCCTGTGAGGATTCGCTCT). The cDNA probe specific for LRRK1 exons 27-29 (550 bp) was PCR amplified using primers P33 (5’-CTGGCCTACCTGCACAAGAA) and P34 (5’-CCTTCCCATCCCAGAACACC).
The cDNA probe specific for LRRK2 exons 1-5 (437 bp) was PCR amplified using primers P35 (5’-AGGAAGGCAAGCAGATCGAG) and P36 (5’-GGCTGAATATCTGTGCATGGC). The probe specific for GAPDH exons 5-7 (452 bp) was PCR amplified using primers P37 (5’-ACCACAGTCCATGCCATCAC) and P38 (5’-TCCACCACCCTGTTGCTGTA).
Hybridization was performed using α-32P-dCTP-labeled probes specific to each gene. Specific signals were detected by autoradiography with Hyperfilm (E3018, Amersham).
RT-PCR
Total RNA was isolated from brains, kidneys, or lungs using TRI reagent (T9424, Millipore-Sigma) according to the manufacturer’s instruction. Approximately 1 μg of RNA was reverse-transcribed using Superscript III (18080093, Thermo Fisher Scientific) according to the manufacturer’s instructions. For RT-PCR analysis of LRRK1 transcripts in mice carrying the homozygous floxed or deleted alleles, we used primers P53 and P54 for exons 4-8 (714 bp), P57 and P58 for exons 11-17 (818 bp), P63 and P64 for exons 20-25 (922 bp), or P41 and P42 for exons 25-31 to confirm normal splicing of LRRK1 mRNA in fLRRK1/fLRRK1 mice and truncated LRRK1 transcripts lacking exons 27-29 in Δ/Δ mice (for details see Figure 1-figure supplement 9). For RT-PCR analysis of LRRK2 transcripts, we used primers P35 and P36 in exons 1-5 to confirm normal splicing of LRRK2 mRNA (437 bp) in fLRRK2/fLRRK2 mice and the absence of RT-PCR products in LRRK2 Δ/Δ mice (Figure 1-figure supplement 11). The identity of the PCR products was confirmed by sequencing.
Western analysis
Fresh tissues were collected and homogenized in an ice-cold stringent RIPA buffer (50 mM Tris-Cl (pH 7.6), 150 mM NaCl, 0.5 mM EDTA, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 1mM PMSF supplement with protease inhibitor cocktail (P8340, Sigma) and phosphatase inhibitor cocktail (P0044, Sigma)), followed by sonication. Homogenates were centrifuged at 14,000xg for 20 min at 4°C to separate supernatants (RIPA buffer-soluble fraction). An equal amount (10-40 μg per lane) of total proteins from each preparation were loaded and separated on NuPAGE gels (Invitrogen), and transferred to nitrocellulose membranes. The membranes were blocked in Intercept (TBS) Blocking Buffer (927-60001, Li-Cor) for 1 hr at room temperature, and incubated at 4°C overnight with specific primary antibodies. Primary antibodies used were rabbit anti-LRRK1 (ANR-101, Alomone Lab, RRID: AB_2756700), rabbit anti-LRRK2 (ab133474, abcam, RRID: AB_2713963), mouse anti-α-Vinculin (05-386, Millipore, RRID: AB_309711). Membranes were then incubated with dye-coupled secondary antibodies, goat anti-mouse IRdye680 (#925-68070, LI-COR, RRID: AB_2651128) or goat anti-rabbit IRdye800 (#925-32211, LI-COR, RRID: AB_2651127). Signals were quantified using the Odyssey Infrared Imaging System (LI-COR).
Histological analysis
Mice were anesthetized with ketamine (100 mg/kg) + xylazine (10 mg/kg) + acepromazine (3 mg/kg), and transcardially perfused with phosphate-buffered saline solution (PBS, pH 7.4) containing 0.25 g/L heparin (H3149, Sigma) and 5 g/L procaine (P9879, Sigma). Brains were post-fixed in 4% formaldehyde in PBS (pH 7.4) (15710, Electron Microscopy Sciences) at 4°C overnight and then processed for paraffin embedding following standard procedures. For frozen sections, post-fixed brains were immersed in a sucrose series solution (15% and 30% sucrose in PBS) at 4°C overnight for cryoprotection, and then brains were embedded in an OCT compound (4583, Sakura). Serial coronal sections (16 µm) of paraffinized brains or frozen brains were obtained using Leica RM2235 or Leica CM1860, respectively. Coronal sections containing the SNpc or LC were selected for immunohistochemical analysis.
Histological analyses were performed as described previously (30, 31, 67). Briefly, for DAB-derived TH-immunohistochemistry, coronal sections were deparaffinized, alcohol-dehydrated, and then subjected to permeabilization with a solution containing 0.1% Triton X-100 in TBS followed by antigen retrieval for 5 min in 10 mM sodium citrate buffer, pH 6.0. Endogenous peroxidase activity was quenched by incubating in 0.3% H2O2 in methanol. Sections were then blocked with a solution containing 5% normal goat serum (S-1000, Vector Laboratories) and 0.1% Triton X-100 in TBS for 1 hr at room temperature. After blocking, sections were incubated with the primary antibody, rabbit anti-TH (1:750, ab112, abcam, RRID: AB_297840) overnight at 4°C. Sections were washed three times in 0.1% Triton X-100 in TBS followed by 1 hr incubation with goat biotinylated anti-rabbit IgG secondary antibody (1:250, BA-1000, Vector Laboratories, RRID: AB_2313606) at room temperature and 30 min incubation with Vectastain Elite ABC reagent (PK-6100, Vector Laboratories) and then developed using chromogenic DAB substrate (SK-4100, Vector Laboratories).
For immunofluorescence staining of paraffin sections, coronal sections were deparaffinized, alcohol-dehydrated, and then subjected to permeabilization with a solution containing 0.1% Triton X-100 in PBS followed by antigen retrieval for 5 min in 10 mM sodium citrate buffer, pH 6.0 except those for cleaved-caspase3 immunostaining which were performed antigen retrieval for 10 min. Sections were then blocked with a solution containing 10% normal goat serum and 0.1% Triton X-100 in PBS for 1 hr at room temperature. After blocking, sections were incubated with primary antibodies overnight at 4°C. The primary antibodies used were mouse anti-TH (1:50, sc-25269, Santa Cruz, RRID: AB_628422), rabbit anti-NeuN (1:400, 12943S, Cell Signaling Technology, RRID: AB_2630395), rabbit anti-cleaved caspases-3 (1:150, 9661, Cell Signaling Technology, RRID: AB_2341188), or rabbit anti-Iba1 (1:500, 019-19,751, Wako, RRID: AB_839504). Sections were washed three times in 0.1% Triton X-100 in PBS followed by 1 hr incubation with fluorophore-conjugated secondary antibodies, goat anti-mouse IgG Alexa Fluor 488 (1:500, A11001, ThermoFisher, RRID: AB_2534069) and goat anti-rabbit IgG Alexa Fluor 555 (1:500, A32732, ThermoFisher, RRID: AB_2633281) at room temperature. Fluorescence images were taken (a stack of 2-3 confocal images spaced at 4 μm), projected with maximal intensity projection mode, and analyzed by FV1000 confocal microscope system (Olympus)
For immunofluorescence staining of cryopreserved sections, coronal brain sections were washed with PBS to rinse out OCT, and then blocked with a solution containing 5% normal goat serum and 0.1% Triton X-100 in TBS for 1 hr at room temperature. After blocking with 10% NGS, sections were incubated with primary antibodies, rabbit anti-GFP (1: 1000, ab290, abcam, RRID: AB_303395), and mouse anti-TH (1:50, sc-25269, Santa Cruz, RRID: AB_628422), overnight at 4°C. Sections were incubated with fluorophore-conjugated secondary antibodies, goat anti-rabbit IgG Alexa Fluor 488 (1:500, A11034, ThermoFisher, RRID: AB_2576217) and goat anti-mouse IgG Alexa Fluor 555 (1:250, A21424, ThermoFisher, RRID: AB_141780) for 1 hr at room temperature. Fluorescence images were taken and analyzed by FV1000 confocal microscope system (Olympus).
The number of GFP+ and GFP+/TH+ cells in the SNpc of DAT-IRES-Cre/+; Rosa26-CAG-LSL-ZsGreen1/+ reporter mice were quantified using 3 comparable coronal sections (16 µm in thickness, spaced 320 μm apart) per brain (n = 3 brains, one hemisphere). The percentage of GFP+ DA neurons in the SNpc was obtained by dividing the sum of GPF+/TH+ neurons by the sum of total TH+ neurons quantified.
Quantification of TH+ DA neurons in the SNpc or LC was performed as previously described (30, 31, 67, 69). Briefly, TH+ neurons in the SNpc, which were marked based on morphological features as previously described (70), were quantified in every 10th serial coronal section (16 µm in thickness) throughout the SNpc (a total of 6-9 sections, spaced 160 µm apart). Total number of TH+ cells in the SNpc was calculated as follows: [total number of TH+ DA neurons quantified in all 6-9 sections] x 10 (every 10th section sampled) x 2 (both hemispheres). Similar results were obtained independently by two investigators using coded samples. Total number of TH+ noradrenergic neurons in the LC (a total of 6-9 sections, spaced 80 µm apart) was calculated as follows: [total number of TH+ noradrenergic neurons quantified in all 6-9 sections] x 5 (every 5th section sampled) x 2 (both hemispheres).
NeuN+, active Caspase-3+, or Iba1+ cells in the SNpc, which was marked by TH immunoreactivity, were quantified using serial coronal sections (16 μm in thickness, every 10th section, a total of 6-9 sections per brain). Compared to chromogenic DAB immunostaining followed by counting under the stereomicroscope, which captures TH-positive dopaminergic neurons from the single plane layer of the sections, immunofluorescence immunostaining picks up more cells with higher sensitivity by maximal intensity projection mode throughout the entire layer of the section under the confocal microscope. Thus, more TH-positive dopaminergic neurons in the SNpc were captured and quantified under confocal microscopy compared to DAB staining. The total number of NeuN+, active Caspase-3+, or Iba1+ cells in the SNpc, which was marked by TH immunoreactivity, was calculated as follows: [total number of NeuN+, active Caspase-3+, or Iba1+ cells in all sections counted] x 10 (every 10th section sampled) x 2 (both hemispheres).
Quantitative EM analysis
The collection and quantification of the EM images were performed as described previously (30, 71). Mice were perfused with PBS containing 0.25 g/L heparin and 5 g/L procaine followed by a fixative solution containing 2.5% paraformaldehyde and 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.4) (#1549, Electron Microscopy Science). Brains were dissected and post-fixed overnight in a fixative solution at 4°C. The dissected tissues were trimmed to 1-2 mm3 cubes followed by osmication and uranyl acetate staining, dehydration in graded alcohol, and embedded in TABB 812 Resin (Marivac Ltd.) at the Harvard Medical School EM facility. 0.5 μm sections were stained with toluidine blue and viewed under the light stereomicroscope (Nikon Eclips E600) to find the SNpc area for EM viewing. Then adjacent sections were cut with 80 nm in thickness with the Leica Ultracut S microtome, picked up on formvar-carbon coated slot Copper grids, stained with 0.2% Lead Citrate, and viewed and imaged under the JEOL 1200x Electron Microscope. A minimum of 10 micrographs containing the entire cell body in the SNpc area were analyzed for each brain. The image was analyzed by using the Fiji version of ImageJ. The number of electron-dense autophagic and lysosomal vacuoles (> 0.5 μm in diameter) in individual neuronal profiles was quantified. We previously calculated the diameter of electron-dense autophagic/lysosomal vacuoles by measuring the longest side manually (30, 31). In the current study, we used Feret’s Diameter (72) to accurately measure the longest distance between any of two points in the electron-dense autophagic/lysosomal vacuoles, resulting in a higher number of electron-dense vacuoles quantified. The number of electron-dense vacuoles (> 0.5 μm in diameter) in individual neuronal profiles was quantified. The area of electron-dense vacuoles (> 0.5 μm in diameter) was quantified and averaged in individual neuronal profiles. Finally, the average number or area of vacuoles was calculated per genotype. Experiments were done in a genotype blind manner (after scarifying mice, the brain samples were coded and sent to the Harvard Medical School EM Core, where the images were captured, and the vacuoles were quantified by another independent experimenter).
Experimental design and statistical analysis
Group sizes were determined based on prior studies. Littermates of control and cDKO mice were randomly distributed between experimental groups. Data acquisition and quantification were performed in a genotype blind manner with the exception of molecular analyses (Southern, Northern, RT-PCR, and Western). All statistical analyses were performed using Prism 9 (GraphPad software) or Excel (Microsoft). All data are presented as the means ± SEM. The exact sample size, the number of mice or neurons, of each experiment is indicated in the figure or the legend.
Statistical analyses were conducted using a two-tailed Student’s t-test for the comparison of a given variable in two genotypes or two-way ANOVA followed by Bonferroni’s post hoc comparisons for the comparison of more than two conditions. Statistical outliers were identified and excluded using the ROUT method with 1% the maximum desired false discovery rate developed by Prism. All statistical comparisons were performed on data from ≥ 4 biologically independent samples and replicated on different experimental days. Significance is shown as *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, and not significantly different values are often not noted.
Data availability
All data generated or analyzed during this study are included in the manuscript and supporting file. Source Data files have been provided for Figures 1 to 7.
Funding disclosure
This work was supported by a grant from the NIH (R37NS071251 to J.S.).
Acknowledgements
We thank H. Zhao for technical assistance, Y. Yuan for organizing experimental data, and Shen lab members for discussion. We are grateful to M. Ericsson at the Harvard Medical School Electron Microscopy Core for her expert assistance.



Generation of the LRRK1 targeting vector

Genomic DNA sequence of the floxed LRRK1 allele

Southern strategy for the targeted and floxed LRRK1 alleles 5’ external probe: 377 bp (LRRK1 intron 25)



Generation of the LRRK2 targeting vector

Genomic DNA sequence of the floxed LRRK2 allele

Southern analysis of the targeted and floxed LRRK2 alleles

Northern strategy for LRRK1 mRNA

Northern analysis of LRRK1 mRNA in mice carrying LRRK1 germline deleted alleles
LRRK1 Northern blots (polyA+ RNA from the lung) using exons 2-3 or exons 27-29 probe: The exons 2-3 probe detected the full-length LRRK1 transcripts (∼7.4 kb) in wild-type (+/+) mice and reduced size transcripts in LRRK1 Δ/Δ mice, likely due to the absence of exons 27-29 (625 bp), which was confirmed by sequencing of RT-PCR products (see Figure 1-figure supplement 9). The truncated LRRK1 mRNA lacking exons 27-29 is present in lower levels, likely due to mRNA degradation by nonsense-mediated decay, as the absence of exons 27-29 (625 bp) results in a frameshift of downstream codons.
The exons 2-3 probe also recognizes the fusion transcript LRRK1-lacZ (∼4.6 kb) in LRRK1/2 DKO mice, which contains LRRK1 exons 1-3 and exon 2 of engrailed, IRES and lacZ cDNA (Figure 1, Figure S1 in Giaime et al., Neuron, 2017). The exons 27-29 probe also recognizes the full-length LRRK1 transcripts (∼7.4 kb) in wild-type (+/+) mice but no truncated LRRK1 transcripts, due to the germline deletion of the genomic region from intron 26-intron 29, lacking exons 27-29. The exons 27-29 probe also did not detect the LRRK1-lacZ fusion transcript, which only contains exons 1-3, in LRRK1/2 DKO mice. While polyA enrichment reduced levels of 18S and 28S rRNAs, they are still present in the lanes/samples.

RT-PCR analysis of the deleted LRRK1 allele
RT-PCR analysis using a LRRK1 exon 32-specific primer P47 (5’GGCTCAGGTCATGCTCAGTT) for RT and PCR primer sets in LRRK1 exons 4-8, 11-17, 20-25, and 25-31 indicates normal splicing in homozygous floxed LRRK1 (F/F) mice and properly deleted transcripts in LRRK1 Δ/Δ mice. The identity of all PCR products was confirmed by sequencing.

Northern analysis of LRRK2 mRNA in mice carrying floxed or germline deleted LRRK2 alleles
LRRK2 Northern blot (total RNA from the brain) using exons 1-5 probe: The probe detected the full-length LRRK2 transcript (∼8.3 kb) in wild-type (+/+) and fLRRK2/fLRRK2 mice, and no transcript in LRRK2 Δ/Δ mice, derived from floxed LRRK2 alleles, and previously generated LRRK1/2 DKO mice (Giaime et al., Neuron, 2017).

RT-PCR analysis of the deleted LRRK2 allele
RT-PCR analysis using an LRRK2 exon 51-specific primer P93 (5’TCGTGTGGAAGATTGAGGTCC) for RT, and primers in LRRK2 exons 1 and 5, P35 and P20, for PCR, which shows normal splicing in fLRRK2/fLRRK2 brains and the absence of PCR products in LRRK2 Δ/Δ brains. The identity of the PCR product in +/+ and fLRRK2/fLRRK2 brains was confirmed by sequencing: The 437 bp product contains LRRK2 exons 1-5.
References
- 1.Cloning of the gene containing mutations that cause PARK8-linked Parkinson’s diseaseNeuron 44:595–600Google Scholar
- 2.Protein kinases linked to the pathogenesis of Parkinson’s diseaseNeuron 44:575–7Google Scholar
- 3.Mutations in LRRK2 cause autosomal-dominant parkinsonism with pleomorphic pathologyNeuron 44:601–7Google Scholar
- 4.A common LRRK2 mutation in idiopathic Parkinson’s diseaseLancet 365:415–6Google Scholar
- 5.LRRK2 exon 41 mutations in sporadic Parkinson disease in EuropeansArch Neurol 64:425–30Google Scholar
- 6.LRRK2 links genetic and sporadic Parkinson’s diseaseBiochem Soc Trans 47:651–61Google Scholar
- 7.A Comprehensive Analysis of Population Differences in LRRK2 Variant Distribution in Parkinson’s DiseaseFront Aging Neurosci 11:13Google Scholar
- 8.LRRK2 pathogenic substitutions in Parkinson’s diseaseNeurogenetics 6:171–7Google Scholar
- 9.LRRK2 R1441G in Spanish patients with Parkinson’s diseaseNeurosci Lett 382:309–11Google Scholar
- 10.A clinic-based study of the LRRK2 gene in Parkinson disease yields new mutationsNeurology 65:741–4Google Scholar
- 11.Identification of a Japanese family with LRRK2 p.R1441G-related Parkinson’s diseaseNeurobiol Aging 35:2656–e17-.e23Google Scholar
- 12.Isolated nigral degeneration without pathological protein aggregation in autopsied brains with LRRK2 p.R1441H homozygous and heterozygous mutationsActa Neuropathol Commun. 6:105Google Scholar
- 13.Genetic screening for a single common LRRK2 mutation in familial Parkinson’s diseaseLancet 365:410–2Google Scholar
- 14.A frequent LRRK2 gene mutation associated with autosomal dominant Parkinson’s diseaseLancet 365:412–5Google Scholar
- 15.Clinical and positron emission tomography of Parkinson’s disease caused by LRRK2Ann Neurol 57:453–6Google Scholar
- 16.Identification of a novel LRRK2 mutation linked to autosomal dominant parkinsonism: evidence of a common founder across European populationsAm J Hum Genet 76:672–80Google Scholar
- 17.Roc, a Ras/GTPase domain in complex proteinsBiochim Biophys Acta 1643:5–10Google Scholar
- 18.The Parkinson disease gene LRRK2: evolutionary and structural insightsMol Biol Evol 23:2423–33Google Scholar
- 19.Ancient origin of the Parkinson disease gene LRRK2J Mol Evol 67:41–50Google Scholar
- 20.Dynamic and redundant regulation of LRRK2 and LRRK1 expressionBMC Neurosci 8Google Scholar
- 21.Rare variants in LRRK1 and Parkinson’s diseaseNeurogenetics 15:49–57Google Scholar
- 22.Structure of the ROC domain from the Parkinson’s disease-associated leucine-rich repeat kinase 2 reveals a dimeric GTPaseProc Natl Acad Sci U S A 105:1499–504Google Scholar
- 23.The Roc-COR tandem domain of leucine-rich repeat kinase 2 forms dimers and exhibits conventional Ras-like GTPase propertiesJ Neurochem 147:409–28Google Scholar
- 24.Structural analysis of the full-length human LRRK2Cell 184:3519–27Google Scholar
- 25.Loss of leucine-rich repeat kinase 2 causes impairment of protein degradation pathways, accumulation of alpha-synuclein, and apoptotic cell death in aged miceProc Natl Acad Sci U S A 107:9879–84Google Scholar
- 26.Loss of leucine-rich repeat kinase 2 causes age-dependent bi-phasic alterations of the autophagy pathwayMol Neurodegener 7Google Scholar
- 27.LRRK2 protein levels are determined by kinase function and are crucial for kidney and lung homeostasis in miceHum Mol Genet 20:4209–23Google Scholar
- 28.LRRK2 plays essential roles in maintaining lung homeostasis and preventing the development of pulmonary fibrosisProc Natl Acad Sci U S A 118Google Scholar
- 29.Genetic analysis of Parkinson’s disease-linked leucine-rich repeat kinase 2Biochem Soc Trans 40:1042–6Google Scholar
- 30.Age-Dependent Dopaminergic Neurodegeneration and Impairment of the Autophagy-Lysosomal Pathway in LRRK Deficient MiceNeuron 96:796–807Google Scholar
- 31.Motor Impairments and Dopaminergic Defects Caused by Loss of Leucine-Rich Repeat Kinase Function in MiceJ Neurosci 42:4755–65Google Scholar
- 32.Characterization of a mouse strain expressing Cre recombinase from the 3’ untranslated region of the dopamine transporter locusGenesis 44:383–90Google Scholar
- 33.High-efficiency deleter mice show that FLPe is an alternative to Cre-loxPNat Genet 25:139–40Google Scholar
- 34.A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cellsNucleic Acids Res 23:5080–1Google Scholar
- 35.A robust and high-throughput Cre reporting and characterization system for the whole mouse brainNat Neurosci 13:133–40Google Scholar
- 36.Phenotype, genotype, and worldwide genetic penetrance of LRRK2-associated Parkinson’s disease: a case-control studyLancet Neurol 7:583–90Google Scholar
- 37.R1441C mutation in LRRK2 impairs dopaminergic neurotransmission in miceProc Natl Acad Sci U S A 106:14622–7Google Scholar
- 38.Progressive dopaminergic alterations and mitochondrial abnormalities in LRRK2 G2019S knock-in miceNeurobiol Dis 78:172–95Google Scholar
- 39.Targeted disruption of leucine-rich repeat kinase 1 but not leucine-rich repeat kinase 2 in mice causes severe osteopetrosisJ Bone Miner Res 28:1962–74Google Scholar
- 40.Identification of a novel LRRK1 mutation in a family with osteosclerotic metaphyseal dysplasiaJ Hum Genet 62:437–41Google Scholar
- 41.Ser1292 autophosphorylation is an indicator of LRRK2 kinase activity and contributes to the cellular effects of PD mutationsScience translational medicine 4:164ra1Google Scholar
- 42.Phosphopeptide analysis reveals two discrete clusters of phosphorylation in the N-terminus and the Roc domain of the Parkinson-disease associated protein kinase LRRK2J Proteome Res 9:1738–45Google Scholar
- 43.LRRK2 Phosphorylation, More Than an EpiphenomenonFront Neurosci 14Google Scholar
- 44.Phosphoproteomics reveals that Parkinson’s disease kinase LRRK2 regulates a subset of Rab GTPaseseLife 5:e12813Google Scholar
- 45.Mutant LRRK2(R1441G) BAC transgenic mice recapitulate cardinal features of Parkinson’s diseaseNat Neurosci 12:826–8Google Scholar
- 46.Leucine-rich repeat kinase 2 regulates the progression of neuropathology induced by Parkinson’s-disease-related mutant alpha-synucleinNeuron 64:807–27Google Scholar
- 47.Enhanced striatal dopamine transmission and motor performance with LRRK2 overexpression in mice is eliminated by familial Parkinson’s disease mutation G2019SJ Neurosci 30:1788–97Google Scholar
- 48.Impaired dopaminergic neurotransmission and microtubule-associated protein tau alterations in human LRRK2 transgenic miceNeurobiol Dis 40:503–17Google Scholar
- 49.Neurodegenerative phenotypes in an A53T α-synuclein transgenic mouse model are independent of LRRK2Hum Mol Genet 21:2420–31Google Scholar
- 50.Conditional expression of Parkinson’s disease-related R1441C LRRK2 in midbrain dopaminergic neurons of mice causes nuclear abnormalities without neurodegenerationNeurobiol Dis 71:345–58Google Scholar
- 51.Selective expression of Parkinson’s disease-related Leucine-rich repeat kinase 2 G2019S missense mutation in midbrain dopaminergic neurons impairs dopamine release and dopaminergic gene expressionHum Mol Genet 24:5299–312Google Scholar
- 52.Lack of exacerbation of neurodegeneration in a double transgenic mouse model of mutant LRRK2 and tauHum Mol Genet 24:3545–56Google Scholar
- 53.Overexpression of Parkinson’s Disease-Associated Mutation LRRK2 G2019S in Mouse Forebrain Induces Behavioral Deficits and α-Synuclein PathologyeNeuro 4Google Scholar
- 54.Dopaminergic neuronal loss, reduced neurite complexity and autophagic abnormalities in transgenic mice expressing G2019S mutant LRRK2PloS one 6:e18568Google Scholar
- 55.Robust kinase- and age-dependent dopaminergic and norepinephrine neurodegeneration in LRRK2 G2019S transgenic miceProc Natl Acad Sci U S A 115:1635–40Google Scholar
- 56.Crystal structure of the WD40 domain dimer of LRRK2Proc Natl Acad Sci U S A 116:1579–84Google Scholar
- 57.The Parkinson disease-associated leucine-rich repeat kinase 2 (LRRK2) is a dimer that undergoes intramolecular autophosphorylationJ Biol Chem 283:16906–14Google Scholar
- 58.Dependence of leucine-rich repeat kinase 2 (LRRK2) kinase activity on dimerizationJ Biol Chem 284:36346–56Google Scholar
- 59.The WD40 domain is required for LRRK2 neurotoxicityPloS one 4:e8463Google Scholar
- 60.Heterodimerization of Lrrk1-Lrrk2: Implications for LRRK2-associated Parkinson diseaseMech Ageing Dev 131:210–4Google Scholar
- 61.Lrrk2 G2385R is an ancestral risk factor for Parkinson’s disease in AsiaParkinsonism Relat Disord 13:89–92Google Scholar
- 62.The LRRK2 G2385R variant is a risk factor for sporadic Parkinson’s disease in the Korean populationParkinsonism Relat Disord 16:85–8Google Scholar
- 63.LRRK2 Gly2385Arg variant is a risk factor of Parkinson’s disease among Han-Chinese from mainland ChinaEur J Neurol 15:301–5Google Scholar
- 64.The association between the LRRK2 G2385R variant and the risk of Parkinson’s disease: a meta-analysis based on 23 case-control studiesNeurol Sci 35:1495–504Google Scholar
- 65.The G2385R variant of leucine-rich repeat kinase 2 associated with Parkinson’s disease is a partial loss-of-function mutationThe Biochemical journal 446:99–111Google Scholar
- 66.The LRRK2 G2385R variant is a partial loss-of-function mutation that affects synaptic vesicle trafficking through altered protein interactionsSci Rep 7:5377Google Scholar
- 67.Protocols for assessing neurodegenerative phenotypes in Alzheimer’s mouse modelsSTAR Protocols 2Google Scholar
- 68.Heterogeneous populations of ES cells in the generation of a floxed Presenilin-1 alleleGenesis 26:5–8Google Scholar
- 69.Histological analysis of neurodegeneration in the mouse brainMethods Mol Biol 1004:91–113Google Scholar
- 70.Midbrain dopaminergic neurons in the mouse: computer-assisted mappingJ Comp Neurol 369:361–71Google Scholar
- 71.Motor impairments and dopamingergic defects caused by loss of LRRK function in miceJ Neurosci 42:4755–65Google Scholar
- 72.Feret‘s Statistical Diameter as a Measure of Particle SizeNature 162:329–30Google Scholar
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Reviewed Preprint version 3:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.92673. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2023, Kang et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 2,009
- downloads
- 137
- citations
- 9
Views, downloads and citations are aggregated across all versions of this paper published by eLife.