Generation and characterization of floxed and deleted LRRK1 and LRRK2 alleles

(A) Schematic illustrations of human LRRK1 and LRRK2 proteins showing similar functional domains. LRRK12015 protein is derived from exons 2-34 (Ensembl Genome Database: ENSG00000154237). LRRK22527 protein is derived from exons 1-51 (ENSG00000188906). LRR: Leucine rich repeats; Roc: Ras-of-complex; COR: C-terminal of Roc; KIN: Kinase domain.

(B) Schematic illustrations of the gene structures of mouse LRRK1 and LRRK2. The boxes in blue are exons that encode the LRRK1 and LRRK2 proteins, and the gray boxes represent the 5’ and 3’ UTRs. The exons are not drawn in scale. The start codon ATG is in exon 2 of LRRK1 and exon 1 of LRRK2. The exons 27-29 of LRRK1 and the promoter/exons 1-2 of LRRK2 are flanked with loxP sites (green arrowheads).

(C) Targeting strategy for the generation of the targeted, floxed, and deleted LRRK1 alleles. The red boxes represent the targeted exons 27-29, and the blue boxes represent the untargeted exons. The locations and sizes of the 5’ and 3’ external probes are shown. The targeting vector contains the 5’ and 3’ homologous regions (marked by dashed lines) and the middle-targeted region, which includes a loxP site (green arrowhead) in intron 26 (1,288 bp upstream of exon 27) and the PGK-neo selection cassette flanked by two FRT (FLP recognition target) sequences (gray circles) followed by another loxP site in intron 29 (1,023 bp downstream of exon 29). A negative selection cassette encoding diphtheria toxin fragment A (DTA) is also included in the targeting vector to reduce ES cells bearing randomly inserted targeting vectors. ES cells carrying the correctly targeted LRRK1 allele were transfected with pCAG-FLP to remove the PGK-neo cassette and generate the floxed LRRK1 allele. Floxed LRRK1 mice were bred with CMV-Cre transgenic mice to generate germline deleted LRRK1 mice. Detailed strategy for generating targeting vector and DNA sequence of floxed LRRK1 allele can be found in Figure 1-figure supplement 1 and 2, respectively.

(D) Southern analysis of the targeted and floxed LRRK1 alleles. Genomic DNA from ES cells or mouse tails was digested with HindIII and hybridized with the 5’ or 3’ external probe. For the 5’ probe, the resulting 17.0 kb and 4.8 kb bands represent the wild-type (WT) and the targeted (T) or floxed (F) alleles, respectively. For the 3’ probe, the resulting 17.0 kb and 12.2 kb bands represent the WT and the floxed (F) alleles, respectively. Detailed Southern strategy can be found in Figure 1-figure supplement 3.

(E) Targeting strategy for the generation of the targeted, floxed, and deleted LRRK2 alleles. The red boxes represent LRRK2 exons 1 and 2, and the start codon ATG resides in exon 1. The locations and sizes of the 5’ and 3’ external probes are shown. The targeting vector contains the 5’ and 3’ homologous regions (marked by dashed lines) and the middle targeted region (from the promoter region to intron 2), which includes a loxP site (green arrowhead) upstream (1,768 bp) of the transcription initiation site and the PGK-neo selection cassette flanked by two FRT sequences (gray circles) and two loxP sites (green arrowheads) in intron 2 (878 bp downstream of exon 2). A negative selection cassette encoding DTA is also included in the targeting vector. Mice carrying the correctly targeted LRRK2 allele were crossed with Actin-FLP deleter mice to generate floxed LRRK2 mice, which were bred with CMV-Cre transgenic mice to generate germline deleted LRRK2 mice. Detailed strategy for generating targeting vector and DNA sequence of floxed LRRK2 allele can be found in Figure 1-figure supplement 4 and 5, respectively.

(F) Southern analysis of the targeted and floxed LRRK2 alleles. Genomic DNA from ES cells or mouse tails was digested with NheI and hybridized with the 5’ or 3’ external probe. For the 5’ probe, the resulting 11.5 kb and 3.6 kb bands represent the wild-type (WT) and the targeted (T) or floxed (F) alleles, respectively. For the 3’ probe, the resulting 11.5 kb and 5.2 kb bands represent the WT and the floxed (F) alleles, respectively. Detailed Southern strategy can be found in Figure 1-figure supplement 6.

(G) Northern analysis of poly(A)+ RNA prepared from the lung of mice carrying homozygous germline deleted (Δ/Δ) LRRK1 alleles derived from the floxed LRRK1 alleles using the cDNA probe of exons 2-3 (left) and exons 27-29 (right). Using the upstream exons 2-3 probe, the LRRK1 transcripts in wild-type mice are the expected size of ∼7.4 kb, whereas the detected LRRK1 transcripts in LRRK1 Δ/Δ mice are truncated, consistent with the deletion of exons 27-29 (625 bp), which results in a frameshift and likely degradation of the truncated LRRK1 mRNA. Using a probe specific for exons 27-29, there is no LRRK1 transcript in LRRK1 Δ/Δ mice, as expected. Both blots were hybridized with a GAPDH probe as loading controls. Detailed Northern strategy and full-size blots are included in Figure 1-figure supplement 7 and 8, respectively. See also Figure 1-figure supplement 9.

(H) Northern analysis of total RNA prepared from the neocortex of mice carrying homozygous germline LRRK2 deleted (Δ/Δ) alleles using the cDNA probe of exons 1-5 shows the absence of LRRK2 transcripts. The blot was hybridized with a GAPDH probe as a loading control. The full-size blot is included in Figure 1-figure supplement 10. See also Figure 1-figure supplement 11

(I) Left: Western analysis of wild-type (+/+) and homozygous LRRK1 Δ/Δ brains show the absence of LRRK1 protein. Right: Western analysis of the neocortex of wild-type (+/+) and homozygous LRRK2 Δ/Δ mice shows the absence of LRRK2 protein. Vinculin was used as a loading control. Full-size blots are included in Figure 1-Source Data 1.

Generation and characterization of DA neuron-specific LRRK cDKO mice

(A) Immunostaining of GFP and/or TH in the SNpc of DAT-Cre/+; Rosa26-CAG-LSL-ZsGreen1/+ mice at 2 months of age. Cre recombinase is expressed under the control of the DAT endogenous promoter and removes the floxed “stop” cassette, resulting in the expression of EGFP under the control of the ubiquitous CAG promoter.

(B) Quantification of GFP+/TH+ and TH+ cells shows that 99% of TH+ DA neurons (722 ± 46 TH+ cells per brain) in the SNpc are also GFP+ (713 ± 46 cells per brain), indicating that DAT-Cre mediated recombination occurs in essentially all TH+ DA neurons. N = 3 mice, 3 comparable sections per hemisphere, 320 μm apart. Raw quantification data are included in Figure 2-Source Data 1.

(C) Similar body weight between LRRK cDKO mice and littermate controls at all ages examined (F1,73 = 0.0210, p = 0.8853; 2M, 20M, 25M: p > 0.9999; 15M: p = 0.7468, two-way ANOVA with Bonferroni’s post hoc multiple comparisons). Raw quantification data are included in Figure 2-Source Data 2.

(D) Similar brain weight between LRRK cDKO and control mice (F1,61 = 0.0440, p = 0.8345; 2M: p = 0.3893; 15M: p > 0.9999; 20M: p > 0.9999; 25M: p = 0.3223, two-way ANOVA with Bonferroni’s post hoc multiple comparisons). Raw quantification data are included in Figure 2-Source Data 2.

(E) Western analysis of LRRK1 and LRRK2 proteins in the dissected cerebral cortex (CTX) and ventral midbrain (vMB) of LRRK cDKO and littermate controls at 2 months of age. Full-size blots are included in Figure 2-Source Data 3.

(F) Quantification shows significant decreases of LRRK1 and LRRK2 in the dissected ventral midbrain of LRRK cDKO mice (LRRK1, p = 0.0432; LRRK2, p = 0.0162, unpaired two-tailed Student’s t-test), compared to controls, but not in the dissected cortex of cDKO mice (LRRK1, p = 0.7648; LRRK2, p = 0.2325). Raw quantification data are included in Figure 2-Source Data 4.

The number in the column indicates the number of mice used in the study. Red-filled and open circles represent data obtained from individual male and female mice, respectively. All data are expressed as mean ± SEM. *p < 0.05. Scale bar: 100 μm.

Age-dependent loss of DA neurons in the SNpc of LRRK cDKO mice

(A) TH immunostaining shows TH+ DA neurons in the SNpc of LRRK cDKO and littermate controls at the age of 15, 20, and 24 months. Higher power views of the boxed areas show grossly normal DA neuron morphology in LRRK cDKO mice.

(B) Quantification of all TH+ DA neurons in the SNpc reveals similar numbers of DA neurons in LRRK cDKO mice (10,000 ± 141) and littermate controls (10,077 ± 310, p > 0.9999) at 15 months of age. At 20 months of age, the number of DA neurons in the SNpc of LRRK cDKO mice (8,948 ± 273) is significantly reduced, compared to control mice (10,244 ± 220, F1,46 = 16.59, p = 0.0002; p = 0.0041, two-way ANOVA with Bonferroni’s post hoc multiple comparisons). By 24 months of age, the reduction of DA neurons in the SNpc of LRRK cDKO mice (8,188 ± 452) relative to controls (9,675 ± 232, p = 0.0010) is greater, compared to that at 20 months of age. Raw quantification data are included in Figure 3-Source Data 1.

(C) Immunohistological analysis of TH and NeuN shows TH+ dopaminergic neurons (green) and NeuN+ neurons (red) in the SNpc of LRRK cDKO mice and controls at 24 months of age.

(D) Quantification of NeuN+ cells in the SNpc shows that the number of NeuN+ neurons in LRRK cDKO mice (17,923 ± 813) is significantly lower than that in control mice (21,907 ± 469, p = 0.0006, Student’s t-test), indicating loss of neurons in the SNpc of LRRK cDKO mice. All TH+ cells are NeuN+. The number of TH+/NeuN+ cells in the SNpc of LRRK cDKO mice (10,500 ± 644) is also lower, compared to control mice (14,102 ± 310, p = 0.0001). There is no significant difference in the number of NeuN+/TH-neurons between littermate controls (7,804 ± 249) and cDKO mice (7,423 ± 344, p = 0.3747). Raw quantification data are included in Figure 3-Source Data 2.

The number in the column indicates the number of mice used in the study. Red-filled and open circles represent data obtained from individual male and female mice, respectively. All data are expressed as mean ± SEM. **p < 0.01, ***p < 0.001. Scale bar: 100 μm.

Increases in apoptotic DA neurons in the SNpc of LRRK cDKO mice

(A) Representative images of TH and active Caspase-3 immunostaining show TH+ DA neurons (green) and active Caspase-3+ apoptotic cells (red) in the SNpc of LRRK cDKO and control mice at the age of 24 months.

(B) Quantification of active Caspase-3+/TH+ cells shows significant increases of apoptotic DA neurons in the SNpc of LRRK cDKO mice (323 ± 38) at 24 months of age, relative to controls (157 ± 8, p = 0.0004, unpaired Student’s t-test). Raw quantification data are included in Figure 4-Source Data 1.

The number in the column indicates the number of mice used in the study. Red-filled and open circles represent data obtained from individual male and female mice, respectively. All data are expressed as mean ± SEM. ***p < 0.001. Scale bar: 100 μm.

Normal number of TH+ noradrenergic neurons in the LC of LRRK cDKO mice

(A) Representative images of TH+ noradrenergic neurons in the locus coeruleus (LC) of LRRK cDKO mice and littermate controls at 24 months of age.

(B) Quantification of TH+ neurons shows similar numbers of TH+ noradrenergic neurons in the LC of LRRK cDKO mice (3,350 ± 99) and controls (3,419 ± 86, p = 0.6057, unpaired Student’s t-test). Raw quantification data are included in Figure 5-Source Data 1.

(C) Top: Immunostaining of TH and GFP in the LC of DAT-Cre/+; Rosa26-CAG-LSL-ZsGreen1/+ mice at 2 months of age. There is no GFP+ (green) cell in the LC, indicating that DAT-Cre is not expressed in the LC. Bottom: Higher power views of the boxed areas.

The number in the column indicates the number of mice used in the study. Red-filled and open circles represent data obtained from individual male and female mice, respectively. All data are expressed as mean ± SEM. Scale bar: 100 μm.

Unchanged number of electron-dense vacuoles in the SNpc of LRRK cDKO mice

(A, B) Representative EM images showing electron-dense vacuoles (arrowheads) in SNpc neurons of cDKO mice and littermate controls at the age of 25 months.

(C-F) Higher power views showing various electron-dense vacuoles, autolysosomes (single arrows), autophagosomes (double arrows), and lipid-containing vacuoles (asterisks) in SNpc neurons of littermate control (C, D) and cDKO (E, F) mice.

(G) Left: The average number of electron-dense vacuoles (>0.5 μm in diameter) in the SNpc neuronal profiles per mouse is not significantly different between LRRK cDKO mice and littermate controls at the age of 25 months (Control: 6.72 ± 0.43; cDKO: 6.99 ± 0.52, p = 0.6839, unpaired two-tailed Student’s t-test). Right: The total area of electron-dense vacuoles (>0.5 μm in diameter) in the SNpc neuronal profiles per mouse is similar between LRRK cDKO and littermate controls (Control: 4.43 ± 0.44 μm2; cDKO: 4.60 ± 0.49 μm2, p = 0.8048). Raw quantification data are included in Figure 6-Source Data 1.

The value in parentheses indicates the number of mice (left) and neuron profiles (right) used in the quantification. Red-filled and open circles represent data obtained from individual male and female mice, respectively. All data are expressed as mean ± SEM. Scale bar: 1 μm.

Elevated microgliosis in the SNpc of LRRK cDKO mice

(A-C) Representative images of Iba1+ microglia (red, marked by yellow arrowheads) and TH+ dopaminergic neurons (green) in the SNpc of LRRK DKO mice and controls at 15 (A), 20 (B), and 24 (C) months of age.

(D) Quantification of Iba1+ microglia shows significant increases in the number of Iba1+ microglia in the SNpc of LRRK cDKO mice compared to control mice at 15 (control: 1736.7 ± 82.9, cDKO: 2541.3 ± 193.0, p = 0.0017, two-way ANOVA with Bonferroni’s post hoc multiple comparisons), 20 (control: 2426.0 ± 67.7, cDKO: 3639.0 ± 127.1, p < 0.0001), and 24 months of age (control: 2640.0 ± 187.1, cDKO: 4088.8 ± 100.3, p < 0.0001). Raw quantification data are included in Figure 7-Source Data 1.

The number in the column indicates the number of mice used in the study. Red-filled and open circles represent data obtained from individual male and female mice, respectively. All data are expressed as mean ± SEM. ****p < 0.0001. Scale bar: 100 μm.

Generation of the LRRK1 targeting vector

Genomic DNA sequence of the floxed LRRK1 allele

Southern strategy for the targeted and floxed LRRK1 alleles 5’ external probe: 377 bp (LRRK1 intron 25)

Generation of the LRRK2 targeting vector

Genomic DNA sequence of the floxed LRRK2 allele

Southern analysis of the targeted and floxed LRRK2 alleles

Northern strategy for LRRK1 mRNA

Northern analysis of LRRK1 mRNA in mice carrying LRRK1 germline deleted alleles

LRRK1 Northern blots (polyA+ RNA from the lung) using exons 2-3 or exons 27-29 probe: The exons 2-3 probe detected the full-length LRRK1 transcripts (∼7.4 kb) in wild-type (+/+) mice and reduced size transcripts in LRRK1 Δ/Δ mice, likely due to the absence of exons 27-29 (625 bp), which was confirmed by sequencing of RT-PCR products (see Figure 1-figure supplement 9). The truncated LRRK1 mRNA lacking exons 27-29 is present in lower levels, likely due to mRNA degradation by nonsense-mediated decay, as the absence of exons 27-29 (625 bp) results in a frameshift of downstream codons.

The exons 2-3 probe also recognizes the fusion transcript LRRK1-lacZ (∼4.6 kb) in LRRK1/2 DKO mice, which contains LRRK1 exons 1-3 and exon 2 of engrailed, IRES and lacZ cDNA (Figure 1, Figure S1 in Giaime et al., Neuron, 2017). The exons 27-29 probe also recognizes the full-length LRRK1 transcripts (∼7.4 kb) in wild-type (+/+) mice but no truncated LRRK1 transcripts, due to the germline deletion of the genomic region from intron 26-intron 29, lacking exons 27-29. The exons 27-29 probe also did not detect the LRRK1-lacZ fusion transcript, which only contains exons 1-3, in LRRK1/2 DKO mice. While polyA enrichment reduced levels of 18S and 28S rRNAs, they are still present in the lanes/samples.

RT-PCR analysis of the deleted LRRK1 allele

RT-PCR analysis using a LRRK1 exon 32-specific primer P47 (5’GGCTCAGGTCATGCTCAGTT) for RT and PCR primer sets in LRRK1 exons 4-8, 11-17, 20-25, and 25-31 indicates normal splicing in homozygous floxed LRRK1 (F/F) mice and properly deleted transcripts in LRRK1 Δ/Δ mice. The identity of all PCR products was confirmed by sequencing.

Northern analysis of LRRK2 mRNA in mice carrying floxed or germline deleted LRRK2 alleles

LRRK2 Northern blot (total RNA from the brain) using exons 1-5 probe: The probe detected the full-length LRRK2 transcript (∼8.3 kb) in wild-type (+/+) and fLRRK2/fLRRK2 mice, and no transcript in LRRK2 Δ/Δ mice, derived from floxed LRRK2 alleles, and previously generated LRRK1/2 DKO mice (Giaime et al., Neuron, 2017).

RT-PCR analysis of the deleted LRRK2 allele

RT-PCR analysis using an LRRK2 exon 51-specific primer P93 (5’TCGTGTGGAAGATTGAGGTCC) for RT, and primers in LRRK2 exons 1 and 5, P35 and P20, for PCR, which shows normal splicing in fLRRK2/fLRRK2 brains and the absence of PCR products in LRRK2 Δ/Δ brains. The identity of the PCR product in +/+ and fLRRK2/fLRRK2 brains was confirmed by sequencing: The 437 bp product contains LRRK2 exons 1-5.